A Dnmt2-like protein mediates DNA methylation in
... (unmethylated, negative control) and Drosophila embryos were spotted onto a membrane and stained for 5methylcytosine and DNA, respectively. This revealed a clearly differential staining pattern for 5-methylcytosine, while the DNA staining pattern was equal for all samples (Fig. 1E). As an additional ...
... (unmethylated, negative control) and Drosophila embryos were spotted onto a membrane and stained for 5methylcytosine and DNA, respectively. This revealed a clearly differential staining pattern for 5-methylcytosine, while the DNA staining pattern was equal for all samples (Fig. 1E). As an additional ...
Complete Sequence of the Mitochondrial DNA of
... However, phylum Mollusca is the marked exception to the rule, and the mitochondrial genomic structure is unusually variable. Complete mitochondrial gene organizations have been determined for five molluscan species (representing three different classes): the blue mussel Mytilus edulis, of the class ...
... However, phylum Mollusca is the marked exception to the rule, and the mitochondrial genomic structure is unusually variable. Complete mitochondrial gene organizations have been determined for five molluscan species (representing three different classes): the blue mussel Mytilus edulis, of the class ...
- Wiley Online Library
... Griffith in 1928 (Griffith, 1928) when he studied the conditions responsible for acquisition of a capsule by unencapsulated strains of Streptococcus pneumoniae. The molecular basis of this phenomenon was not understood, however, before DNA was identified as the transforming agent by Avery and co-wor ...
... Griffith in 1928 (Griffith, 1928) when he studied the conditions responsible for acquisition of a capsule by unencapsulated strains of Streptococcus pneumoniae. The molecular basis of this phenomenon was not understood, however, before DNA was identified as the transforming agent by Avery and co-wor ...
HMG 9_9.book(ddd146.fm)
... In order to evaluate the prevalence of RTT related to MECP2 mutations, we have carried out a systematic analysis of the MECP2 gene in 46 typical RTT patients and screened by DGGE (n = 38) and by direct sequencing (n = 8) the whole coding sequence of this gene. Upon analysis by DGGE of exon 1 to exon ...
... In order to evaluate the prevalence of RTT related to MECP2 mutations, we have carried out a systematic analysis of the MECP2 gene in 46 typical RTT patients and screened by DGGE (n = 38) and by direct sequencing (n = 8) the whole coding sequence of this gene. Upon analysis by DGGE of exon 1 to exon ...
PowerPoint-presentatie - the biopsychology research group
... Recent data suggest that copy number variants (CNVs) can contribute to complex disease susceptibility. The relative impact of CNVs compared to single nucleotide polymorphisms (SNPs) on one of the processes underlying disease vulnerability, variable gene expression, has been estimated at 18% (1). The ...
... Recent data suggest that copy number variants (CNVs) can contribute to complex disease susceptibility. The relative impact of CNVs compared to single nucleotide polymorphisms (SNPs) on one of the processes underlying disease vulnerability, variable gene expression, has been estimated at 18% (1). The ...
Molecular Detection of Mycobacterium tuberculosis
... False-positive PCR results in comparison with culture were observed for both assays. Although initially disappointing, many of these results were seen to be positive in both assays. Because these assays target different fragments of DNA, this suggests that actual organisms or TB DNA could be present ...
... False-positive PCR results in comparison with culture were observed for both assays. Although initially disappointing, many of these results were seen to be positive in both assays. Because these assays target different fragments of DNA, this suggests that actual organisms or TB DNA could be present ...
Reliable classification of two-class cancer data using evolutionary
... K. Deb, A. Raji Reddy / BioSystems 72 (2003) 111–129 ...
... K. Deb, A. Raji Reddy / BioSystems 72 (2003) 111–129 ...
PDF
... We used the human RefSeq gene annotation from golden path December 2001 database to explore further the possible functional implications of these CSEs. The locations of CSEs in the human genome were compared with a total of 14,653 RefSeq gene structures. We found that 94.9% of these genes and 81% of ...
... We used the human RefSeq gene annotation from golden path December 2001 database to explore further the possible functional implications of these CSEs. The locations of CSEs in the human genome were compared with a total of 14,653 RefSeq gene structures. We found that 94.9% of these genes and 81% of ...
PDF - Timetree.org
... seed plants (15), and, when they did, the result has been shown to be highly improbable with molecular data (16). Nevertheless, other than rejecting an anthophyte association, molecular data have so far failed to provide a single universally supported hypothesis of relationship among living spermato ...
... seed plants (15), and, when they did, the result has been shown to be highly improbable with molecular data (16). Nevertheless, other than rejecting an anthophyte association, molecular data have so far failed to provide a single universally supported hypothesis of relationship among living spermato ...
Identifying microbes from environment water samples in a
... Sample preparation is crucial to achieving accurate and high sensitivity detection of target analytes in various analytical approaches – and depending on the analytical technique, may be the most complex and time-consuming aspect of the process. For intact cell (also known as whole cell) MALDI-TOF M ...
... Sample preparation is crucial to achieving accurate and high sensitivity detection of target analytes in various analytical approaches – and depending on the analytical technique, may be the most complex and time-consuming aspect of the process. For intact cell (also known as whole cell) MALDI-TOF M ...
Identifying Common Genetic Variants by High
... detected variants (7, 8, 11, 13 ). Indeed, heteroduplex scanning methods as a rule detect sequence variants but do not identify or genotype those variants. Common sequence variants that do not cause disease occur at a frequency much greater than that of disease-causing variants. These common variant ...
... detected variants (7, 8, 11, 13 ). Indeed, heteroduplex scanning methods as a rule detect sequence variants but do not identify or genotype those variants. Common sequence variants that do not cause disease occur at a frequency much greater than that of disease-causing variants. These common variant ...
Floral organ identity genes in the orchid
... proteins (Figure 2a; Okamuro et al., 1997). This suggests that DcOAP2 is an AP2-like transcription factor, which may play a role in orchid flower development. All of the predicted protein sequences of MADS box genes cloned contain the conserved MIK region and a divergent Cterminal region. DcOPI poss ...
... proteins (Figure 2a; Okamuro et al., 1997). This suggests that DcOAP2 is an AP2-like transcription factor, which may play a role in orchid flower development. All of the predicted protein sequences of MADS box genes cloned contain the conserved MIK region and a divergent Cterminal region. DcOPI poss ...
Multiplex RT-PCR kit.
... translocation specific band. The breakpoint is identified by the molecular size of the translocation specific amplicon using Interpretation Table 4. More than one translocation specific band shows presence of alternative spliced mRNA from the fusion gene. Figure 2 shows workflow for testing blood or ...
... translocation specific band. The breakpoint is identified by the molecular size of the translocation specific amplicon using Interpretation Table 4. More than one translocation specific band shows presence of alternative spliced mRNA from the fusion gene. Figure 2 shows workflow for testing blood or ...
Molecular Genetic Testing For BRAF Mutations
... is ~0.1% mutant DNA in a wild-type background. Poor DNA quality, insufficient DNA quantity or the presence of PCR inhibitors can result in uninterpretable or (rarely) inaccurate results. • The BRAF (V600E) mutation only by Sanger sequencing uses a DNA-based PCR-sequencing assay to detect the V600E i ...
... is ~0.1% mutant DNA in a wild-type background. Poor DNA quality, insufficient DNA quantity or the presence of PCR inhibitors can result in uninterpretable or (rarely) inaccurate results. • The BRAF (V600E) mutation only by Sanger sequencing uses a DNA-based PCR-sequencing assay to detect the V600E i ...
An assessment of factors affecting the likelihood
... (iii) Stabilization of plant DNA in the bacterial recipient The stability of translocated plant DNA in the bacterial cytoplasm would depend on its susceptibility to fragmentation and degradation by bacterial enzymes and on whether it is integrated into the bacterial chromosome or into a plasmid. The ...
... (iii) Stabilization of plant DNA in the bacterial recipient The stability of translocated plant DNA in the bacterial cytoplasm would depend on its susceptibility to fragmentation and degradation by bacterial enzymes and on whether it is integrated into the bacterial chromosome or into a plasmid. The ...
Developmental Validation of the Quantifiler Real-Time
... sex determination using the amplification of homologous but distinct regions of the X and Y chromosomes (4,5). The Quantifiler kits were designed for the quantification of human nuclear DNA, and their genomic targets reflect the particular roles for which the kits were intended. The Quantifiler Huma ...
... sex determination using the amplification of homologous but distinct regions of the X and Y chromosomes (4,5). The Quantifiler kits were designed for the quantification of human nuclear DNA, and their genomic targets reflect the particular roles for which the kits were intended. The Quantifiler Huma ...
CS790 – Introduction to Bioinformatics
... Indels are difficult, must align sequences: ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT Intro to Bioinformatics – Sequence Alignment ...
... Indels are difficult, must align sequences: ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT Intro to Bioinformatics – Sequence Alignment ...
Cloning and characterisation of a cysteine proteinase gene
... 2.9. SDS-PAGE and Western blotting After growth, recombinant bacteria were pelleted at 4,000 £ g for 10 min, resuspended in sample buffer, and subjected to SDS-12% PAGE. Western blotting was carried out as described elsewhere (Towbin et al., 1979). After electrophoresis, proteins from bacterial extr ...
... 2.9. SDS-PAGE and Western blotting After growth, recombinant bacteria were pelleted at 4,000 £ g for 10 min, resuspended in sample buffer, and subjected to SDS-12% PAGE. Western blotting was carried out as described elsewhere (Towbin et al., 1979). After electrophoresis, proteins from bacterial extr ...
Pourcel et al., Microbiology 2005
... Y. pseudotuberculosis represents an older, more diverged species from which Y. pestis probably emerged as a clone (Achtman et al., 1999). The three CRISPRs are present at least in some members of this species, and can be amplified using the Y. pestis primer pairs. We analysed the CRISPRs of nine str ...
... Y. pseudotuberculosis represents an older, more diverged species from which Y. pestis probably emerged as a clone (Achtman et al., 1999). The three CRISPRs are present at least in some members of this species, and can be amplified using the Y. pestis primer pairs. We analysed the CRISPRs of nine str ...
The distribution of DNA translocation times in solid
... are 8 ± 2 nm in diameter. As shown in figure 1(A), the silicon nitride membrane contains a nanopore separating two chambers connected electrically only by an ionic solution inside the nanopore. When a voltage is applied across the membrane, a stable open pore current I0 will be observed. After addin ...
... are 8 ± 2 nm in diameter. As shown in figure 1(A), the silicon nitride membrane contains a nanopore separating two chambers connected electrically only by an ionic solution inside the nanopore. When a voltage is applied across the membrane, a stable open pore current I0 will be observed. After addin ...
Anhydrobiosis without trehalose in bdelloid rotifers
... PCR fragments from two negative control species (Mus musculus and Homo sapiens), as well as the two bdelloid rotifer species P. roseola and A. vaga, indicating that tps genes are not present in their genomes (Fig. 2). Two fragments were weakly ampli¢ed from P. roseola DNA, but more than 50 cloning a ...
... PCR fragments from two negative control species (Mus musculus and Homo sapiens), as well as the two bdelloid rotifer species P. roseola and A. vaga, indicating that tps genes are not present in their genomes (Fig. 2). Two fragments were weakly ampli¢ed from P. roseola DNA, but more than 50 cloning a ...
Handbook on SMA genetics_final_051209
... intragenic SMN1 point mutations. Exonic regions must be individually amplified; therefore, sequence analysis does not detect exonic deletions or duplications. ...
... intragenic SMN1 point mutations. Exonic regions must be individually amplified; therefore, sequence analysis does not detect exonic deletions or duplications. ...
Defensive microbial symbionts in Hymenoptera Martin Kaltenpoth
... Alternatively, symbionts can modulate the host’s immune system in a way that enhances the efficiency of protection against pathogens. The immune system is generally stimulated by contact with low levels of pathogenic bacteria (Evans & Lopez 2004) or fungi (Konrad et al. 2012). Previously pathogen-ex ...
... Alternatively, symbionts can modulate the host’s immune system in a way that enhances the efficiency of protection against pathogens. The immune system is generally stimulated by contact with low levels of pathogenic bacteria (Evans & Lopez 2004) or fungi (Konrad et al. 2012). Previously pathogen-ex ...
Metagenomics
Metagenomics is the study of genetic material recovered directly from environmental samples. The broad field may also be referred to as environmental genomics, ecogenomics or community genomics. While traditional microbiology and microbial genome sequencing and genomics rely upon cultivated clonal cultures, early environmental gene sequencing cloned specific genes (often the 16S rRNA gene) to produce a profile of diversity in a natural sample. Such work revealed that the vast majority of microbial biodiversity had been missed by cultivation-based methods. Recent studies use either ""shotgun"" or PCR directed sequencing to get largely unbiased samples of all genes from all the members of the sampled communities. Because of its ability to reveal the previously hidden diversity of microscopic life, metagenomics offers a powerful lens for viewing the microbial world that has the potential to revolutionize understanding of the entire living world. As the price of DNA sequencing continues to fall, metagenomics now allows microbial ecology to be investigated at a much greater scale and detail than before.