• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Metabolismus erytrocytů - Univerzita Karlova v Praze
Metabolismus erytrocytů - Univerzita Karlova v Praze

... normal level HbA1- 5%; a buildup of HbA1- increased glucose concentration the HbA1 level is proportional to average blood glucose concentration over previous weeks; in individuals with poorly controlled diabetes, increases in the quantities of these glycated hemoglobins are noted (patients ...
7.014 Section Problem:
7.014 Section Problem:

Dear teacher/student
Dear teacher/student

... NAVIGENE consists of a cover page and an instructional guide. On the cover page you can find several questions. The main structure is the “phenomenon-protein-gene” triangle: following your discovery of a protein or cellular process in the biology handbook that you want to clarify, you may choose whe ...
Combinatorial mutagenesis to restrict amino acid usage in an
Combinatorial mutagenesis to restrict amino acid usage in an

Systemic Delivery of siRNA by a Plant PHLOEM SMALL RNA
Systemic Delivery of siRNA by a Plant PHLOEM SMALL RNA

Apoptosis
Apoptosis

... Effector Caspases: Activate downstream caspases and act on Various cellular substrates In the first example, the effector caspases cleave an inhibitor or an effector protein. An example of this would be CAD (Caspase-Activated Deoxyribonuclease), and ICAD (Inhibitor of CAD). When ICAD binds to CAD, ...
1dl5 Lichtarge lab 2006
1dl5 Lichtarge lab 2006

... at least 10Å2 , which is roughly the area needed for one water molecule to come in the contact with the residue. Furthermore, we require that these residues form a “cluster” of residues which have neighbor within 5Å from any of their heavy atoms. Note, however, that, if our picture of protein evol ...
Misincorporation of free m-tyrosine into cellular proteins: a potential
Misincorporation of free m-tyrosine into cellular proteins: a potential

"Genetic Methods of Polymer Synthesis". In: Encyclopedia of
"Genetic Methods of Polymer Synthesis". In: Encyclopedia of

... Recombinant DNA methods have been traditionally used in site-directed mutagenesis studies designed to probe protein folding or enzymatic activity. The ease with which genetic sequences can be constructed has, however, led to the increased use of these methods for the synthesis of proteins with repet ...
12–3 RNA and Protein Synthesis
12–3 RNA and Protein Synthesis

... Copyright Pearson Prentice Hall ...
Nuclear Magnetic Resonance (NMR) Spectroscopy
Nuclear Magnetic Resonance (NMR) Spectroscopy

... The incorporation of stable isotopes of carbon and nitrogen into biomolecules is readily accomplished by growth of a suitable microorganism in a medium containing biosynthetic precursors for both amino acids and nucleotides. The organism of choice is Escherichia coli, the most common bacterium used ...
Stability, catalytic versatility and evolution of the
Stability, catalytic versatility and evolution of the

... stable in order to maintain their native structures but also have to be flexible to allow conformational changes during catalysis. These opposing requirements are particularly striking for enzymes from extremophiles, which must be both stable and active under extreme conditions of salt, pH and tempe ...
This application form constitutes a tax invoice upon payment
This application form constitutes a tax invoice upon payment

... *** Available to Ordinary Members residing overseas for more than 12 months. ...
Chapter 11 Lecture PowerPoint - McGraw Hill Higher Education
Chapter 11 Lecture PowerPoint - McGraw Hill Higher Education

... Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. ...
Chapter 26:Biomolecules: Amino Acids, Peptides, and Proteins
Chapter 26:Biomolecules: Amino Acids, Peptides, and Proteins

... and S, depending on which COOH reacts with which NH2 we get AS or SA • The long, repetitive sequence of NCHCO atoms that make up a continuous chain is called the protein’s backbone • Peptides are always written with the N-terminal amino acid (the one with the free NH2 group) on the left and the ...
Origin and evolution of peptide-modifying
Origin and evolution of peptide-modifying

... group of proteins, frequently termed cupins, are also known to share a similar DSBH fold with the above two superfamilies. These are typified by the non-catalytic sugar-binding domain of the bacterial transcription factor AraC, the plant seed-storage proteins and enzymes such as the oxalate oxidase a ...
Nucleotide Sequence of the Gene Coding for the
Nucleotide Sequence of the Gene Coding for the

... not conserved, and are these regions responsible for the obN2 3H2+ 2NH3; the detailsof its mechanism are notknown served differences in the nitrogenase proteins? If this is true, (1). The enzyme system has been isolated from at least 10 may it be possible, by DNA recombination in vitro, to condiffer ...
RNA - Southgate Schools
RNA - Southgate Schools

... leucine • Six other codons specify arginine. ...
Structure-Function Analysis of the UDP-N-acetyl-D
Structure-Function Analysis of the UDP-N-acetyl-D

... Plasmid Constructs and Mutagenesis—Mouse ppGaNTase-T1 isoform was amplified and cloned from a first-strand cDNA synthesis reaction of mouse kidney total RNA, using the following sense and antisense oligonucleotide primers Mlu-mT1 (CACACGCGTTGCCTGCTGGTGACGTTCTAGAGCTAGT) and Bam-mT1 (ATGCGGATCCAGCCCAG ...
A  INSTRUCTIONS
A INSTRUCTIONS

... For each wrong answer, you will be awarded -1 (Negative one) mark. Multiple answers to a question will be treated as a wrong answer. For each un-attempted question, you will be awarded 0 (Zero) mark. ...
Topology and Phosphorylation of Soybean Nodulin
Topology and Phosphorylation of Soybean Nodulin

... of these proteins seems to consist of six putative membranespanning domains. The striking conservation of these proteins from E. coli to mammals has led to the proposal that these proteins may have derived from a common ancestor to play similar roles in diverse organisms (Baker and Saier, 1990); how ...
Supplementary Figures 1 - 5, Methods
Supplementary Figures 1 - 5, Methods

... consists of seven helices (PDB code: 3PJA). (B) Predicted structure of the C-terminal ...
Characteristics of the caspase-like catalytic domain of
Characteristics of the caspase-like catalytic domain of

... virus and orthopoxvirus processing proteases and a family of de-sumoylating proteases; and clan CD encompassing the five families, caspases, legumains, gingipains, clostripain, and separase. Recently, bioinformatics approaches have identified two further families within this clan: the paracaspases a ...
regulation of a bacteriophage t4 late gene, soc, which
regulation of a bacteriophage t4 late gene, soc, which

... initiated at PEl6.08 and PE16.57,respectively. Thus, both transcripts include all of the soc-coding sequence. A short (approximately 300-base) transcript (marked with a closed square in Figure 3), detected with probe 2 but not with probe 1, was present only in the, late RNA samples (Figure 3, panel ...
BRNO UNIVERSITY OF TECHNOLOGY FACULTY OF
BRNO UNIVERSITY OF TECHNOLOGY FACULTY OF

... organisms. It is based on the concept of the proteome as a complete set of proteins produced by a given cell or organism under a defined conditions. Proteins present the major constituent of living cells and participate in almost every biological process in all organisms. Therefore, a comprehensive ...
< 1 ... 144 145 146 147 148 149 150 151 152 ... 466 >

Two-hybrid screening



Two-hybrid screening (also known as yeast two-hybrid system or Y2H) is a molecular biology technique used to discover protein–protein interactions (PPIs) and protein–DNA interactions by testing for physical interactions (such as binding) between two proteins or a single protein and a DNA molecule, respectively.The premise behind the test is the activation of downstream reporter gene(s) by the binding of a transcription factor onto an upstream activating sequence (UAS). For two-hybrid screening, the transcription factor is split into two separate fragments, called the binding domain (BD) and activating domain (AD). The BD is the domain responsible for binding to the UAS and the AD is the domain responsible for the activation of transcription. The Y2H is thus a protein-fragment complementation assay.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report