Download Interactions of TCA cycle enzymes and of the CcpA

Interactions of TCA cycle enzymes
and of the CcpA-HPrSer46P complex
with various cre-elements in Bacillus subtilis
Interaktionen von Enzymen des Citratzyklus
und des CcpA-HPrSer46P-Komplexes mit
verschiedenen cre-Elementen in Bacillus subtilis
Der Naturwissenschaftlichen Fakultät
der Friedrich-Alexander-Universität Erlangen-Nürnberg
zur
Erlangung des Doktorgrades Dr. rer. nat.
vorgelegt von
Maike Bartholomae
aus Wassertrüdingen
Als Dissertation genehmigt
von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität
Erlangen-Nürnberg
Tag der mündlichen Prüfung
02. Mai 2013
Vorsitzender der Promotionskommission:
Prof. Dr. Johannes Barth
Erstberichterstatter:
Prof. Dr. Andreas Burkovski
Zweitberichterstatter:
Prof. Dr. Jörg Stülke
Table of contents
1
Zusammenfassung_____________________________________________________ - 1 -
2
Summary ____________________________________________________________ - 2 -
3
Introduction __________________________________________________________ - 3 3.1
The Gram-positive model organism Bacillus subtilis____________________________ - 3 -
3.2
Metabolon formation in B. subtilis _________________________________________ - 3 -
3.2.1
TCA cycle as central part of metabolism and anabolism ________________________________ - 4 -
3.2.2
Regulation of mdh, icd and citZ ___________________________________________________ - 5 -
3.2.3
The NADP dependent isocitrate dehydrogenase Icd __________________________________ - 7 -
3.2.4
The malate dehydrogenase Mdh __________________________________________________ - 8 -
3.2.5
The citrate synthase CitZ _________________________________________________________ - 9 -
3.3
Regulation of carbon metabolism of B. subtilis _______________________________ - 11 -
3.3.1
The phosphoenolpyruvate: sugar phosphotransferase system (PEP:PTS) _________________ - 11 -
3.3.2
The catabolite control protein A and CCR in B. subtilis ________________________________ - 12 -
3.3.3
The catabolite responsive element cre ____________________________________________ - 15 -
3.3.4
The regulation of ackA, gntR, xylA and xynP ________________________________________ - 16 -
3.4
4
+
Scope of the thesis _____________________________________________________ - 17 -
Material and Methods ________________________________________________ - 18 4.1
Material ______________________________________________________________ - 18 -
4.1.1
Chemicals ____________________________________________________________________ - 18 -
4.1.2
Auxiliary Material _____________________________________________________________ - 20 -
4.1.3
Instruments __________________________________________________________________ - 21 -
4.1.4
Reagent mixtures _____________________________________________________________ - 22 -
4.1.5
Proteins, enzymes and standards _________________________________________________ - 22 -
4.1.6
Oligonucleotides ______________________________________________________________ - 23 -
4.2
Bacterial strains _______________________________________________________ - 24 -
4.3
Plasmids _____________________________________________________________ - 24 -
4.4
Buffer and media ______________________________________________________ - 25 -
4.4.1
General buffers and solutions ____________________________________________________ - 25 -
4.4.2
Buffers and solutions for protein purification _______________________________________ - 25 -
4.4.3
DNA and protein gel electrophoresis ______________________________________________ - 26 -
4.4.3.1
DNA gel electrophoresis ____________________________________________________ - 26 -
4.4.3.2
Protein gel electrophoresis _________________________________________________ - 26 -
4.4.4
Media and supplements ________________________________________________________ - 28 -
I
Table of contents
4.5
Methods _____________________________________________________________ - 29 -
4.5.1
General methods ______________________________________________________________ - 29 -
4.5.2
Growth of bacteria ____________________________________________________________ - 29 -
4.5.3
Transformation of E. coli ________________________________________________________ - 29 -
4.5.3.1
Preparation of CaCl2 competent E. coli cells ____________________________________ - 29 -
4.5.3.2
Transformation of E. coli ___________________________________________________ - 30 -
4.5.3.3
Long time storage of bacterial strains _________________________________________ - 30 -
4.5.4
Methods for purification and modification of nucleic acids ____________________________ - 30 -
4.5.4.1
Hybridization of cre DNA ___________________________________________________ - 30 -
4.5.4.2
Isolation of chromosomal DNA from B. subtilis _________________________________ - 31 -
4.5.4.3
Isolation of plasmid DNA from E. coli _________________________________________ - 31 -
4.5.4.4
Polymerase chain reaction (PCR) _____________________________________________ - 32 -
4.5.4.5
Restriction of DNA ________________________________________________________ - 32 -
4.5.4.6
Dephosphorylation of DNA _________________________________________________ - 33 -
4.5.4.7
Ligation of DNA fragments __________________________________________________ - 33 -
4.5.4.8
Elution of DNA from agarose gels ____________________________________________ - 33 -
4.5.4.9
Sequencing of DNA ________________________________________________________ - 33 -
4.5.5
Methods for purification and analysis of proteins ____________________________________ - 34 -
4.5.5.1
Denaturating protein gel electrophoresis (PAGE) ________________________________ - 34 -
4.5.5.2
Native PAGE _____________________________________________________________ - 34 -
4.5.5.3
Cell cultivation for protein overexpression _____________________________________ - 34 -
4.5.5.4
Sonication _______________________________________________________________ - 34 -
4.5.5.5
Overexpression test _______________________________________________________ - 35 -
4.5.5.6
Purification of CcpA(His)6, Mdh(His)6, Icd(His)6, IcdS104P(His)6 and CitZ(His)6 from Bacillus
subtilis
_______________________________________________________________________ - 35 -
4.5.5.7
Preparation of E. coli DH5α p4813/ HPr kinase extract ___________________________ - 36 -
4.5.5.8
Purification of HPrSer46P ___________________________________________________ - 36 -
4.5.5.9
Dialysis of protein solutions _________________________________________________ - 37 -
4.5.5.10
Surface plasmon resonance (SPR) analysis _____________________________________ - 37 -
4.5.5.11
Icd activity assay __________________________________________________________ - 39 -
4.5.5.12
Mdh activity assay ________________________________________________________ - 40 -
4.5.5.13
CitZ activity assay _________________________________________________________ - 40 -
4.5.6
Computer programs, databases and online services __________________________________ - 41 -
4.5.6.1
Computer programs _______________________________________________________ - 41 -
4.5.6.2
Databases and online services _______________________________________________ - 41 -
II
Table of contents
5
Results _____________________________________________________________ - 43 5.1
Metabolite dependent interaction of Isocitrate dehydrogenase with Malate
dehydrogenase of Bacillus subtilis _______________________________________________ - 43 5.1.1
Purification of Mdh(His)6, Icd(His)6 and IcdS104P(His)6 ________________________________ - 43 -
5.1.2
Interaction of Mdh(His)6 and Icd(His)6 _____________________________________________ - 44 -
5.1.3
SPR analysis of the interaction of Icd(His)6 and Mdh(His)6 in the presence of cofactors and
substrates __________________________________________________________________________ - 45 5.1.3.1
SPR analysis of Icd(His)6 binding to Mdh(His)6 in the presence of isocitrate, α-ketoglutarate,
malate and oxaloacetate ____________________________________________________________ - 45 5.1.3.2
5.2
Influence of the enzymatic activity of Icd(His)6 on the binding to Mdh(His)6 __________ - 47 -
Interaction of Mdh(His)6 and IcdS104P(His)6 _________________________________ - 48 -
5.2.1
Activity of Icd(His)6 and IcdS104P(His)6 ____________________________________________ - 48 -
5.2.2
SPR analysis of IcdS104P(His)6 binding to Mdh(His)6 __________________________________ - 49 -
5.2.3
SPR analysis of IcdS104P(His)6 binding to Mdh(His)6 in the presence of isocitrate, α-ketoglutarate,
malate and oxaloacetate ______________________________________________________________ - 50 5.2.4
Quantification of the interaction between IcdS104P(His) 6 and Mdh(His)6 stimulated by isocitrate,
+
NADP and MgCl2 ____________________________________________________________________ - 52 -
5.3
Mutual influence of Icd and Mdh on their enzymatic activity ___________________ - 53 -
5.3.1
Influence of Icd and IcdS104P on Mdh activity ______________________________________ - 54 -
5.3.2
Influence of Mdh on the enzymatic activity of Icd and IcdS104P ________________________ - 56 -
5.4
Interaction analysis of Malate dehydrogenase and Citrate synthase _____________ - 58 -
5.4.1
Purification of CitZ(His)6 ________________________________________________________ - 58 -
5.4.2
SPR analysis of CitZ(His)6 binding to Mdh(His)6 ______________________________________ - 59 -
5.4.3
SPR-analysis of CitZ(His)6 and Mdh(His)6 interaction in the presence of malate and oxaloacetate
____________________________________________________________________________ - 59 -
5.5
Interaction of various cre-elements with the CcpA-HPrSer46P complex ___________ - 61 -
5.5.1
Purification of CcpA(His)6 and HPrSer46P __________________________________________ - 61 -
5.5.1.1
Purification of CcpA(His)6 ___________________________________________________ - 61 -
5.5.1.2
Purification of HPrSer46P ___________________________________________________ - 62 -
5.5.2
Qualitative and quantitative analysis of CcpA coeffector complexes interacting with various cre-
elements ___________________________________________________________________________ - 63 5.5.2.1
Selection and preparation of the analyzed cre-elements __________________________ - 63 -
5.5.2.2
Qualitative analysis of CcpA-HPrSer46P binding to xylA-cre _______________________ - 64 -
5.5.2.3
Quantification of the CcpA HPrSer46P xylA-cre interaction ________________________ - 65 -
5.5.2.4
Quantification of CcpA HPrSer46P complexes interacting with xynP-cre, ackA-cre2, gntR-
credown and syn-cre _________________________________________________________________ - 66 -
III
Table of contents
6
Discussion __________________________________________________________ - 69 6.1
Indications for the formation of a TCA cycle metabolon _______________________ - 69 -
6.2
Structure and kinetics of the CcpA-HPrSer46P complex interacting with various cre-
elements ___________________________________________________________________ - 75 6.3
Outlook ______________________________________________________________ - 79 -
7
Bibliography ________________________________________________________ - 80 -
8
Abbreviation index __________________________________________________ - 102 -
IV
Zusammenfassung
1 Zusammenfassung
Metabolons sind supramolekulare Komplexe aus Enzymen, welche aufeinanderfolgende Reaktionen katalysieren. Da
Metabolons den Transfer von Metaboliten zwischen den einzelnen Enzymen erleichtern, sind möglicherweise auch
die einzelnen Enzyme des Citratzyklus in Bacillus subtilis in einem Multienzymkomplex angeordnet. Kürzlich
publizierte in vivo Analysen deuten darauf hin, dass die Malatdehydrogenase Mdh, die Isocitratdehydrogenase Icd
und die Citratsynthase CitZ das Kernstück eines Citratzyklusmetabolons in B. subtilis bilden. Deswegen wurde in
dieser Arbeit die Interaktion zwischen den oben genannten Enzymen und die Dynamik dieser Interaktionen mittels
Oberflächenplasmonenresonanz (SPR) charakterisiert. Mit derselben Messmethode wurde auch der Einfluss von
Substraten und Kofaktoren auf diese Interaktionen ermittelt. Diese Analysen zeigten eine schwache, aber spezifische
Interaktion zwischen Mdh und Icd, welche ausschließlich durch die Substrate von Icd, die Kombination von Isocitrat,
NADP+ und Mg2+, stimuliert wurde. Dieser stimulatorische Effekt ist hochspezifisch, da keine weiteren Metabolite und
Kofaktoren von Icd und Mdh einen Einfluß auf die Interaktion von Mdh und Icd zeigten. Um die Dynamik der
Interaktion des Icd-Isocitrat-NADP+-Mg2+-Komplexes mit Mdh zu charakterisieren, wurden kinetische SPR Analysen
durchgeführt. Da Wildtyp Icd die Substrate für diese Analyse zu schnell umsetzte, wurde stattdessen eine IcdS104P
Mutante eingesetzt. Die Interaktion des Enzyms mit Mdh wurde durch die Mutation nicht beeinträchtigt und wurde
durch Isocitrat, NADP+ und Mg2+ stimuliert. Im Vergleich zum Wildtypenzym ist die Enzymaktivität der IcdS104P
Mutante jedoch 174-fach geringer. Die Quantifizierung der Mdh-IcdS104P Interaktion ohne Substrate und Kofaktoren
zeigte eine langsame Assoziationsgeschwindigkeit mit einem ka-Wert von 2,0 ± 0,2 x 102 M-1s-1 bei einer
Dissoziationsgeschwindigkeitskonstante (kd) von 1.0 ± 0.07 x 10-3 s-1, woraus sich eine Dissoziationskonstante (KD) von
5,0 ± 0,1 µM ergab. In Anwesenheit von Isocitrat, NADP+ und Mg2+ nahm die Affinität von IcdS104P zu Mdh
resultierend aus einer schnelleren Assoziation (ka = 1,7 ± 0,7 x 103 M-1s-1) bei langsamerer Dissoziation (kd =
2,6 ± 0,6 x 10-4 s-1) mit einem KD-Wert von 0,15 ± 0,03 µM um Faktor 33 zu. Interessanterweise wurde durch die
Komplexbildung die enzymatische Aktivität von Wildtyp Icd in Gegenwart von Mdh verdoppelt. Dagegen wurde die
Aktivität von Mdh durch die Anwesenheit von Icd oder IcdS104P nicht beeinflußt. Diese höhere enzymatische
Aktivität von Icd in Anwesenheit von Mdh, bei gleichbleibender Mdh Aktivität führt zu einer Überproduktion an αKetoglutarat durch den Citratzyklus als Reaktion auf hohe Verfügbarkeit von Kohlenstoffquellen und NADP +, welche
erhöhte anabole Anforderungen der Zelle signalisieren. Das im Überschuss synthetisierte α-Ketoglutarat kann im
Aminosäureanabolismus verwendet werden, da α-Ketoglutarat als Vorläufermolekül von Glutamat dient. Eine
Interaktion der beiden Enzyme Mdh und CitZ wurde auch in Anwesenheit der entsprechenden Metabolite nicht
nachgewiesen. Dies stellte ein überraschendes Ergebnis dar, da die Interaktion dieser Enzyme in anderen
Organismen bereits nachgewiesen wurde. Darüber hinaus wird die endergonische Umwandlung von Malat zu
Oxalacetat durch Mdh nur durch die sofortige Weiterverarbeitung von Oxalacetat durch CitZ ermöglicht. Da keine
direkte Interaktion zwischen Mdh und CitZ nachgewiesen wurde, ist es möglich, dass andere Faktoren, z.B. weitere
Enzyme des Citratzyklus zusätzlich an deren Komplexbildung beteiligt sind. Deswegen wurde abschließend ein
hypothetisches Modell des Citratzyklusmetabolons vorgestellt, welches alle Enzyme des Citratzyklus umfasst.
Der zweite Teil dieser Arbeit beschäftigte sich mit der Kohlenstoffkatabolitenregulation (KKR). Dieser Mechanismus
ermöglicht Lebewesen die Auswahl der Kohlenstoffquelle, welche das schnellste Wachstum ermöglicht. In B. subtilis
wird die KKR durch das Katabolit Kontroll Protein A (CcpA) in Komplex mit dessen Koeffektor HPrSer46P bei Bindung
an seine Operatorbindestellen („catabolite responsive elements“, cres) vermittelt. Die Transkription kataboler Gene
wie z.B. gntR, xylA und xynP und von Genen des Überflußmetabolismus, z.B. ackA wird durch CcpA reguliert, jedoch
mit jeweils unterschiedlichen Regulationsfaktoren. Um den Einfluß der cre-Sequenzen auf die Regulation zu
ermitteln, wurden in dieser Arbeit die Kinetiken und Affinitäten der Interaktionen des CcpA-HPrSer46P Komplexes
mit den cre-Sequenzen der oben genannten Gene bestimmt. Obwohl nur geringe Sequenzteile der cre-Elemente
konserviert sind, ist die Affinität des CcpA-HPrSer46P Komplexes zu ackA-cre2, gntR-credown, syn-cre und xylA-cre
nahezu identisch mit einem KD-Wert von 1,6-3,8 nM. Interessanterweise ist die Affinität des CcpA-HPrSer46P
Komplexes zu xynP-cre mit einem KD-Wert von nur 0,2 ± 0,1 nM bis zu 19-fach erhöht. Diese höhere Affinität erklärt
den hohen Repressionsfaktor von xynP und die stärkere Regulation durch CcpA im Vergleich zu gntR, xylA und ackA.
-1-
Summary
2 Summary
Metabolons are supramolecular complexes of enzymes which catalyze subsequent reactions. Since the
formation of a metabolon facilitates the transfer of metabolites, in Bacillus subtilis, the enzymes of the TCA
cycle are likely organized in multienzyme complexes. Recently, in vivo analyses suggested, that the TCA cycle
enzymes malate dehydrogenase Mdh, isocitrate dehydrogenase Icd and citrate synthase CitZ form the core of a
TCA cycle metabolon in B. subtilis. Therefore, in this work, the interactions between these enzymes and their
dynamics were characterized in vitro by surface plasmon resonance (SPR). Moreover, the impact of substrates
and cofactors on this interaction was determined by SPR measurements as well. These analyses revealed a
weak, but specific interaction between Mdh and Icd. Their interaction was exclusively stimulated by a mixture
+
2+
of isocitrate, NADP and Mg , which are the substrates of Icd. This stimulation is highly specific, because no
other metabolites and cofactors of Icd or Mdh, respectively, influenced the interaction between Mdh and Icd.
+
2+
To determine the dynamics of the interaction between the Icd-isocitrate-NADP -Mg complex and Mdh,
kinetic SPR analyses were performed. Since wildtype Icd converts its substrate too fast to perform kinetic
studies, a IcdS104P mutant was used instead. The mutation neither influenced the interaction of the enzyme
+
2+
with Mdh nor affected the stimulation of isocitrate, NADP and Mg . However, in comparison to wildtype Icd,
the mutant showed a 174-fold reduced activity. The quantification of the Mdh-IcdS104P interaction revealed a
2
-1 -1
slow association rate constant (ka) of 2.0 ± 0.2 x 10 M s and a dissociation rate constant (kd) of
-3 -1
1.0 ± 0.07 x 10 s , resulting in a dissociation equilibrium constant (KD) of 5.0 ± 0.1 µM. The presence of
+
2+
isocitrate, NADP and Mg increased the affinity of IcdS104P to Mdh 33-fold with a KD-value of 0.15 ± 0.03 µM,
3
-1 -1
because the association of the complex is faster (ka = 1.7 ± 0.7 x 10 M s ) and the dissociation is slower (kd =
-4 -1
2.6 ± 0.6 x 10 s ). Remarkably, the enzymatic activity of wildtype Icd doubled, if it was in complex with Mdh.
In contrast, the activity of Mdh was not affected in the presence of Icd or IcdS104P. The higher enzymatic
activity of Icd in the presence of Mdh leads to an overproduction of α-ketoglutarate, since the activity of Mdh
does not change. This might be a response to signal high anabolic demands triggered by high availability of
+
carbon sources and NADP . Excess of α-ketoglutarate can be applied to amino acid anabolism, since αketoglutarate is the precursor molecule of glutamate. No interaction was detected between Mdh and CitZ by
SPR even in the presence of the corresponding metabolites. This result was surprising, because this interaction
has already been characterized in other organisms. Moreover, the enzymatic reaction of Mdh, the endergonic
conversion of malate to oxaloacetate, is only driven by the fast conversion of oxaloacetate by CitZ. Since no
direct interaction between Mdh and CitZ was detected, other factors, e.g. other TCA cycle enzymes might
contribute to their complex formation. Therefore, a hypothetic model of a TCA cycle metabolon including all
TCA cycle enzymes was proposed in the end.
The second part of this study deals with the carbon catabolite regulation (CCR), a mechanism which enables
organisms the selective use of the carbon source, which allows the fastest growth. In B. subtilis, it is mediated
by binding of the catabolite control protein A (CcpA) in complex with its coeffector HPrSer46P to its operator
sites, the catabolite responsive elements (cres). Transcription of catabolic genes like gntR, xylA and xynP and of
genes involved in overflow metabolism, e.g. ackA is regulated by CcpA, however, the regulation factors vary. To
elucidate the impact of the cre-sequence on the regulation, in this study the kinetics and affinities of the
interaction between the CcpA-HPrSer46P complex and these cre-elements were analyzed by SPR. Although the
cre-elements have only small conserved parts, the CcpA-HPrSer46P complex bound to ackA-cre2, gntR-credown,
syn-cre and xylA-cre with almost the same affinity with a KD-value of 1.6-3.8 nM. Interestingly, the affinity of
the CcpA-HPrSer46P complex to xynP-cre is up to 19-fold higher with a KD of only 0.2 ± 0.1 nM. This higher
affinity explains the high regulation factor and the tighter regulation of xynP by CcpA in contrast to gntR, xylA
and ackA.
-2-
Introduction
3 Introduction
3.1 The Gram-positive model organism Bacillus subtilis
Bacillus subtilis is a Gram-positive rod shaped non-pathogenic soil bacterium which belongs to the
Firmicutes (Hoch et al., 1993). It is closely related to pathogenic Bacillus species and other Gram
positive human pathogens, e.g. Staphylococcus aureus or Listeria monocytogenes (Alcaraz et al.,
2010; Glaser et al., 2001; Kuroda et al., 2001). Therefore, it is an ideal model organism for molecular
biological and medical research. The bacterium is forced to adapt quickly to environmental changes,
e.g. heat stress, osmotic stress or availability of carbon sources (Görke & Stülke, 2008; Stülke &
Hillen, 2000). There are different strategies to master these challenges, e.g. formation of endospores
to survive unfavourable environmental conditions (Piggot & Hilbert, 2004) or synthesis of antibiotics
to hinder growth of competing microorganisms (Kleerebezem, 2004; Stein, 2005). The organization
of these biosyntheses demands tight regulation at genomic and proteomic level. One possibility of
organization of enzymes, the formation of metabolons will be introduced in the next chapters.
Hereinafter, the carbon catabolite regulation (CCR) will be presented as example for the regulation of
gene expression depending on varying carbon sources.
3.2 Metabolon formation in B. subtilis
Metabolic pathways represent series of reactions which either degrade molecules to gain energy,
e.g. glycolysis or the tricarboxylic acid cycle (TCA cycle) or construct molecules under ATP
consumption, e.g. the synthesis of amino acids. Until today, about 280 different pathways with up to
1300 reactions have been detected in B. subtilis, e.g. in central carbon metabolism, in nitrogen
metabolism or in nucleotide anabolism (Barbe et al., 2009; Caspi et al., 2012; Goelzer et al., 2008;
Lammers et al., 2010; Mäder et al., 2012). This high number of pathways suggests an organization of
associated enzymes in multienzyme complexes, which are named metabolons (Srere, 1985). The
advantage of a metabolon is that the interaction of enzymes catalyzing subsequent reactions allows
the fast transfer of their intermediates. In silico studies revealed an increased synthesis rate for
pyruvate, if glycolytic enzymes are organized in metabolons (Amar et al., 2008). A typical example of
a metabolon of B. subtilis is the multienzyme complex of the RNA degradosome. It comprises the
-3-
Introduction
helicase CshA to unwind secondary RNA structures, the RNAses J1 and J2 and the polynucleotide
phosphorylase PnpA for RNA degradation. The whole complex is anchored at the cytoplasmic
membrane by RNAse Y and, interestingly, this complex is also associated with the glycolytic enzymes
phosphofructokinase Pfka and the enolase Eno (Commichau et al., 2009; Lehnik-Habrink et al., 2012;
Lehnik-Habrink et al., 2010; Newman et al., 2012). A similar structure was determined in E. coli as
well (Carpousis, 2007; Nurmohamed et al., 2010). It is assumed, that enzymes of other metabolic
pathways are organized in metabolons as well. Recently, a multienzyme complex of TCA cycle
enzymes was detected in vivo (Meyer et al., 2011).
3.2.1 TCA cycle as central part of metabolism and anabolism
The TCA cycle is a series of eight reactions which oxidize the acetyl group of acetyl-CoA to CO2 and
transfer the electrons to NADH, NADPH and FADH2 which conserve the electrons at a high electron
transfer potential. These reducing equivalents are then reoxidized during the respiratory chain to
gain ATP. The cycle starts by formation of citrate (C6), from oxaloacetate (C4) and acetyl-CoA (C2).
Subsequently, acetyl-CoA is oxidized to two molecules of CO2, the remaining C4-unit Succinyl-CoA is
converted to oxaloacetate and the cycle is closed (Baldwin & Krebs, 1981; Krebs & Johnson, 1980).
An overview of all reactions is shown in Figure 3.1. In addition to catabolism of acetyl-CoA the TCA
cycle provides precursor molecules for anabolism, e.g. α-ketoglutarate for glutamate synthesis or
oxaloacetate which can be converted to amino acids of the aspartate family (Belitsky, 2002; Gunka &
Commichau, 2012; Owen et al., 2002; Sonenshein, 2007). Moreover, oxaloacetate is used during
gluconeogenesis to form glucose (Meyer & Stülke, 2012; Sauer & Eikmanns, 2005). Interestingly, in
vivo interaction analyses revealed that almost every TCA cycle enzyme interacts with at least one
other enzyme of this metabolic pathway (Meyer et al., 2011). The core complex of a TCA cycle
metabolon might be formed by the isocitrate dehydrogenase Icd, the malate dehydrogenase Mdh
and the citrate synthase CitZ, since their interaction was detected by various Strep protein
interaction experiments (SPINEs) and by bacterial two hybrid assays (Meyer et al., 2011).
-4-
Introduction
Figure 3.1: Overview of all TCA cycle reactions in B. subtilis. The metabolic intermediates are written in black.
The enzyme names are highlighted in green, the reducing equivalents in blue color. The B. subtilis specific
abbreviations of the enzyme names are marked with black boxes. Red arrows indicate the connections
between TCA cycle and amino acid and nucleotide anabolism.
3.2.2 Regulation of mdh, icd and citZ
In B. subtilis, the genes citZ, icd and mdh form an operon which encodes the citrate synthase (CitZ),
the isocitrate dehydrogenase (Icd) and the malate dehydrogenase (Mdh) (Figure 3.2). All three genes
are transcribed from the citZ promoter (Jin & Sonenshein, 1994b; Kim et al., 2002). If glucose or
citrate are available as carbon sources, the expression of the whole operon is repressed by CcpA and
CcpC (Jourlin-Castelli et al., 2000; Kim et al., 2002). Nevertheless, the basal activity of the citZ
promoter is quite high in comparison to promoters which are stronger repressed by CcpA, e.g. the
xynP promoter (Fischer, 2008). This might be due to the central CA pair in the citZ-cre-element which
is not optimal for recognition by the CcpA-HPrSer46P complex (Kim et al., 2002; Schumacher et al.,
2011). Since all three genes can be co-transcribed, they might form a complex during co-translation
-5-
Introduction
(Jin et al., 1996; Jin & Sonenshein, 1994a, 1994b). Interestingly, transcription of icd is also controlled
by a gene specific promoter which is not regulated by CcpA or CcpC (Jin et al., 1996; Jin &
Sonenshein, 1994b; Kim et al., 2002). In exponential growth phase, equal amounts of full length
transcript and of the shorter icd transcript were detected (Jin & Sonenshein, 1994b). The higher icd
transcript levels correlate with the intracellular Icd protein amounts, because during exponential
growth, the amounts of Icd and Mdh are twofold higher than the amount of CitZ (Maass et al., 2011).
These data suggest, that CitZ might be uncoupled of the Mdh-Icd complex formation or that CitZ is
not complexed in a 1:1 stoichiometry.
Figure 3.2: Organization of citZ, icd and mdh in an operon. The genes are depicted by red arrows. Promoter
sites (-35/-10) are shown in blue. The binding site of the transcriptional regulators CcpA (cre) or CcpC are
highlighted in green or yellow, respectively. The ribosomal binding sites (RBS) are indicated in orange. (Picture
based on the following references: (Jin & Sonenshein, 1994b; Jourlin-Castelli et al., 2000; Kim et al., 2002)).
-6-
Introduction
3.2.3 The NADP+ dependent isocitrate dehydrogenase Icd
Icd (EC 1.1.1.42) belongs to the metal-dependent decarboxylating dehydrogenases and catalyzes the
conversion of isocitrate to oxalsuccinate and finally to α-ketoglutarate (Figure 3.3) (Aktas & Cook,
2009; Singh et al., 2001).
0
0
NADP+
isocitrate
CO2
NADPH
oxalsuccinate
α-ketoglutarate
Figure 3.3: Icd catalyzes the oxidative decarboxylation of isocitrate. The enzymatic reaction is a two-step
process comprising the oxidation of isocitrate to oxalsuccinate followed by the decarboxylation of
oxalsuccinate to form α-ketoglutarate.
The protein consists of 423 amino acids and has a molecular mass of 46.3 kDa. The active enzyme is
organized as a homodimer like the almost structurally identical E. coli enzyme (Hurley et al., 1991;
Singh et al., 2001). The Icd monomer is subdivided in three subdomains: the large domain containing
N- and C-terminus and the small domain. The clasp domain is only formed in the dimer and serves as
connection between the two monomers via hydrophobic interaction (Singh et al., 2001). The active
site is formed by residues of both subunits and located at the cleft between large and small domain
(see Figure 3.4). In the corresponding E. coli enzyme, Ser113, Asn115, Lys100 and Gln336 anchor
NADP+ and isocitrate at the active site via H-bonds (Gonçalves et al., 2012; Singh et al., 2001). The
activity of the enzyme is dependent on a bivalent cation, usually Mg2+ or Mn2+, in contrast, Ca2+
arrests Icd in its active conformation by blocking the active site (O'Leary & Limburg, 1977; Stoddard
et al., 1993; Yasutake et al., 2003).
As a consequence of the high structural identity, the E. coli and the B. subtilis enzyme reveal almost
the same enzymatic kinetics with a Michaelis-Menten constant (Km) of 5.9 ± 0.9 µM (B. subtilis) and
4.9 ± 0.2 µM (E. coli) for isocitrate and a Km value of 14.5 ± 2.2 µM (B. subtilis) and 19.6 ± 3.7 µM (E.
coli) for NADP+. The maximal velocity (vmax) of both enzymes is almost identical as well with
107 ± 7 nmol/min/mg enzyme (B. subtilis) or 135 ± 7 nmol/min/mg enzyme (E. coli), respectively
(Singh et al., 2002).
-7-
Introduction
Figure 3.4: Crystal structure of B. subtilis Icd dimer (Singh et al., 2001). The Icd monomers are depicted in
yellow and blue. The active site of each monomer is located in the cleft between large and small domains
(RCSB code: 1HQS).
The enzymatic activity of the E. coli enzyme is regulated by phosphorylation of serine residue 113 by
the isocitrate dehydrogenase kinase/phosphatase AceK, whereas the phosphorylated form is
catalytically inactive (Borthwick et al., 1984; Cozzone & El-Mansi, 2005; Dean et al., 1989; LaPorte &
Koshland, 1982). There is no AceK homologue in B. subtilis (Singh et al., 2001; Singh et al., 2002), but
it was shown, that the enzyme can be phosphorylated by the B. subtilis protein kinase PrkC.
However, the mechanism of this regulation is not completely characterized (Eymann et al., 2007;
Lévine et al., 2006; Pietack et al., 2010).
3.2.4 The malate dehydrogenase Mdh
As mentioned above, Icd is co-expressed together with the malate dehydrogenase Mdh (EC 1.1.1.37).
The latter enzyme catalyzes the last reaction of the TCA cycle, the conversion of malate to
oxaloacetate (Figure 3.5). It represents the only endergonic reaction of the TCA cycle and only the
immediate processing of oxaloacetate by the following citrate synthase CitZ enables this reaction
(Miller & Smith-Magowan, 1990; Ochoa, 1955). For malate as a substrate, the Michaelis-Menten
constant (Km) of 900 µM is 14.8-fold higher than the Km value for oxaloacetate. In addition, the Km
value for NAD+ (140 µM) as corresponding cofactor is also 5.1-fold higher than for NADH (27 µM)
(Yoshida, 1965). Therefore, the activity of the enzyme is determined frequently by analyzing the
backward reaction (Luo et al., 2006; Yin & Kirsch, 2007).
-8-
Introduction
0
NAD+
malate
NADH
oxaloacetate
+
Figure 3.5: Mdh catalyzes the NAD dependent oxidation of malate to oxaloacetate.
The enzyme consists of 312 amino acids and has a molecular weight of 33.5 kDa. Until today, the
crystal structure has not been solved. The structure of the corresponding E. coli enzyme shows that
the amino acid residues Arg87, Asn119 and Arg153 coordinate the substrate at the active site. These
residues are also conserved in the B. subtilis enzyme and therefore, its active site might be organized
in a similar way (Hall & Banaszak, 1993; Hall et al., 1992; Hall et al., 1991).
In addition, B. subtilis has four other malic enzymes, which catalyze the conversion of malate to
pyruvate: MaeA, MalS, MleA and YtsJ. However, Mdh is the only enzyme which is able to convert
malate to oxaloacetate. The conversion of oxaloacetate to phosphoenolpyruvate (PEP) is the entry of
the gluconeogenesis and, as a consequence, Mdh is essential for growth of cultures with malate as
sole carbon source (Lerondel et al., 2006; Meyer & Stülke, 2012).
3.2.5 The citrate synthase CitZ
After regeneration of oxaloacetate by Mdh, the TCA cycle starts again with the first reaction, the
condensation of oxaloacetate and acetyl-CoA to citrate catalyzed by CitZ (372 amino acids, 41.7 kDa)
(Jin & Sonenshein, 1996). The reaction is depicted in Figure 3.6. The Km value for acetyl-CoA is 622 µM and for oxaloacetate 7-15 µM. The high efficiency of CitZ and its high substrate specificity for
oxaloacetate and acetyl-CoA likely hinder the backward reaction of Mdh (Jin & Sonenshein, 1996;
Wiegand & Remington, 1986). Mdh and CitZ are co-expressed, when they are transcribed from the
same promoter and therefore, they might form a complex in situ nascendi (Jin & Sonenshein, 1994b).
For citrate synthases of other species, e.g. from pig heart mitochondria, the interaction with the
malate dehydrogenase was already detected and quantified (Datta et al., 1985; Halper & Srere, 1977;
Morgunov & Srere, 1998; Tompa et al., 1987b).
-9-
Introduction
+
0
H2O
CoA-SH
acetyl-CoA
citrate
oxaloacetate
Figure 3.6: CitZ catalyzes the condensation of acetyl-CoA and oxaloacetate to citrate.
Although this enzyme plays an important role in the TCA cycle, surprisingly less is known about its
structure which has not been solved until today. Surprisingly, Gram-positive citrate synthases share
high amino acid sequence identity with archaeal and eukaryotic citrate synthases, e.g. the citrate
binding amino acids His222, His262 and Asp317 of the thermophilic archeon Thermoplasma
acidophilum are conserved in the B. subtilis enzyme as well (Russell et al., 1994). Similar results were
obtained from alignments with the citrate synthase of the hyperthermophilic archeon Pyrococcus
furiosus and with the eukaryotic variant from chicken heart (Liao et al., 1991; Remington et al., 1982;
Russell et al., 1997). These amino acid homologies suggest that the active site of the B. subtilis
enzyme might be organized in a similar conformation.
In summary, the interaction between Icd, Mdh and CitZ was detected in vivo (Meyer et al., 2011).
However, nothing is known about the dynamics and the conditions of this complex formation and if
the interaction has an impact on the activity of the enzymes. Since all three genes are organized in
one operon, this complex might be formed during co-expression (Jin et al., 1996; Jin & Sonenshein,
1994b). The expression of this operon is repressed in the presence of glucose by the global regulator
CcpA (Kim et al., 2002). The general mechanism of CcpA dependent carbon catabolite regulation will
be presented in more detail in the following chapters.
- 10 -
Introduction
3.3 Regulation of carbon metabolism of B. subtilis
The carbon catabolite regulation (CCR) allows a bacterium selectively to use only the carbon sources
which allow the fastest growth. For B. subtilis, the most favored carbon sources are glucose and
malate (Kleijn et al., 2010; Stülke & Hillen, 2000). The presence of glucose leads to repression of
genes encoding enzymes involved in catabolism of secondary sugars. On the other hand, the
expression of enzymes which metabolize glucose is activated (Deutscher, 2008; Deutscher et al.,
2006; Gunnewijk et al., 2001). A central source for signaling in CCR is the phosphoenolpyruvate:
sugar phosphotransferase system (PEP:PTS) which will be introduced in more detail in the following
chapter.
3.3.1 The phosphoenolpyruvate: sugar phosphotransferase system
(PEP:PTS)
The PEP:PTS transports glucose and other so called “PTS-sugars”, e.g. fructose, mannose, maltose or
the sugar alcohols mannitol and glycerol into the cell (Cases et al., 2007; Deutscher et al., 2006;
Postma et al., 1993; Reizer et al., 1999; Singh et al., 2008). The dephosphorylation of the catabolic
intermediate phosphoenolpyruvate (PEP) delivers the energy for the uptake of the sugars. The
phosphoryl group is translocated to enzyme I (EI) and subsequently to the hisitidine containing
protein HPr, which is phosphorylated at the amino acid residue histidine 15. Finally, the phosphoryl
group is transferred to the sugar specific enzyme complex II (EIIA and EIIB) which leads to
phosphorylation of the uptaken sugar, e.g. glucose is taken up as glucose-6-phosphate (Glc-6-P)
which directly enters into the glycolysis allowing a fast gain of energy for the cell (Postma et al.,
1993; Stülke & Hillen, 2000).
- 11 -
Introduction
Figure 3.7: Scheme of the PEP:PTS in B. subtilis.
Dephosphorylation of Phoshoenolpyruvate (PEP) leads to
phosphorylation of Enzyme I (EI). Afterwards the
phosphoryl group (written in bold) is transferred to His15
Glc
of HPr which transfers it to Enzyme II domain A. (EIIA ).
Glc
This domain phosphorylates EII B (EIIB ) which passes
subsequently the phosphoryl group to glucose to the
glucose to form glucose-6-P. CM: cytoplasmic membrane.
Picture based on Stülke & Hillen (Stülke & Hillen, 2000).
3.3.2 The catabolite control protein A and CCR in B. subtilis
In B. subtilis and other Firmicutes, e.g. in the pathogens Bacillus anthracis, Clostridium difficile,
Clostridium perfringens or Staphylococcus aureus, the catabolite control protein A (CcpA) is the
central regulator of CCR (Antunes et al., 2012; Chiang et al., 2011; Fujita, 2009; Seidl et al., 2008;
Seidl et al., 2009; Stülke & Hillen, 2000; Varga et al., 2004; Varga et al., 2008). It regulates the
expression of approximately 10 % of genes whose gene products are involved in central physiological
processes, e.g. carbon metabolism, amino acid metabolism, sporulation and biofilm formation
(Chagneau & Saier Jr, 2004; Fujita, 2009; Lorca et al., 2005; Lulko et al., 2007; Sonenshein, 2007;
Stanley et al., 2003). In addition, CcpA regulates the expression of virulence factors in the pathogen
species, e.g. AtxA in B. antracis or SpeB in Streptococcus pyogenes (Chiang et al., 2011; Kietzman &
Caparon, 2010; Seidl et al., 2006; Shelburne et al., 2008).
CcpA belongs to the LacI/GalR family and is a 334 amino acids protein with a total molecular weight
of 36.9 kDa. (Chambliss, 1993; Hueck et al., 1995; Weickert & Adhya, 1992). The crystal structure
revealed two main domains of the protein: The core protein, which can be subdivided into an N- and
C-terminal subdomain, forms the dimerization domain and the corepressor binding domain and the
N-terminal DNA binding domain (Figure 3.8). Strikingly, the DNA binding domain is only in close
- 12 -
Introduction
contact with the N-terminal subdomain, if it is bound to its operator sequence. The core protein
exhibits an open conformation, if it does not interact with its operator DNA (Schumacher et al., 2004;
Schumacher et al., 2011; Singh et al., 2007).
Figure 3.8: Crystal structure of CcpA-(HPrSer46P)-syn cre ternary complex according to Schumacher
(Schumacher et al., 2011). The CcpA subunits are depicted in black and blue. The two molecules of HPrSer46P
are shown green and yellow. The synthetic cre-element (syn-cre) is represented in white. A: front view of the
complex, B: 90 rotated view. (RCSB code: 3OQO).
If a favoured carbon source, e.g. glucose, is available, it is metabolized via glycolysis and therefore,
the intracellular concentration of fructose-1.6-bisphosphate (FBP) is high. This stimulates the activity
of the HPr kinase/phosphorylase (HPrK/P) which phosphorylates HPr at serine 46, its second
phosphorylation site (Deutscher & Saier Jr, 2005; Galinier et al., 1998; Jault et al., 2000; Nessler et al.,
2003; Ramström et al., 2003). Under nutrient limiting conditions, HPrK/P changes its activity. If the
levels of FBP and Glc-6-P are low and the intracellular amount of inorganic phosphate (Pi) is high,
HPrK/P desphosphorylates HPrSer46P (Mijakovic et al., 2002). In addition to HPr, the catabolite
repression like HPr protein Crh is phosphorylated by HPrK/P as well (Galinier et al., 1997). This
protein has no function in the PEP:PTS, since it carries a glutamine in position 15 instead of a
histidine (Galinier et al., 1997). Although CrhSer46P is able to bind to CcpA (Schumacher et al., 2006),
the contribution to CCR might be only an additional function of Crh, since the unphosphorylated
protein binds to the methylglyoxylal synthase MgsA and inhibits its function in the methyl glyoxal
pathway (Landmann et al., 2011).
After phosphorylation at Ser46, two molecules of either HPrSer46P or CrhSer46P bind to a CcpA
dimer. The binding of the coeffectors induces several conformational changes which result in the
formation of the hinge helices and orientation of the HTHLH motifs in the DNA binding conformation
- 13 -
Introduction
(Schumacher et al., 2004; Schumacher et al., 2011). Moreover, the interaction between HPrSer46P
and CcpA is stimulated by the low molecular weight effectors FBP and Glc-6-P (Seidel et al., 2005). In
contrast to HPrSer46P, the interaction of CcpA and CrhSer46P is not stimulated by FBP and Glc-6-P
(Horstmann et al., 2007; Seidel et al., 2005). The CcpA-coeffector complex is able to bind to its
operator sequences, the catabolite responsive elements (cre) and regulate transcription of the
corresponding genes (Görke & Stülke, 2008; Titgemeyer & Hillen, 2002; Warner & Lolkema, 2003).
Figure 3.9: Carbon catabolite regulation (CCR) in B. subtilis. HPr (green circle) with its two phosphorylation
sites represents the link between glucose uptake and CCR. HPrHis15P is part of the PEP-PTS (depicted at the
top of the scheme). If glucose is available, it will be metabolized in glycolysis. As a consequence, the
intracellular amount of fructose-1,6-bisphosphate (FBP) rises, which leads to an activation of the HPr kinase
phosphorylase (HPrK/P, blue circle). HPrK/P phosphorylates HPr or Crh (orange rhomb) at serine 46. HPrSer46
or CrhSer46P, respectively, bind to CcpA (yellow) and this ternary complex binds its operator elements (cresites) in the genome. The binding of CcpA-HPrSer46 to the cre- element can cause either activation or
repression of transcription, depending on the location of the cre-element in reference to the promoter. HPrK/P
dephosphorylates HPrSer46P if (1) high amounts of inorganic phosphate (P i) and (2) low amounts of ATP are
available. CM: cytoplasmic membrane (picture based on Görke & Stülke (Görke & Stülke, 2008).
- 14 -
Introduction
3.3.3 The catabolite responsive element cre
CcpA-HPrSer46P regulates transcription of its target genes by binding to its operator sites, the creelements (Fujita, 2009). They are approximately 14-16 basepairs (bps) long and the sequence is
almost palindromic. Leu 56 of CcpA, the “leucine lever” interacts with the central CG in the minor
groove of the DNA and causes a kink of the DNA. As a consequence, the minor groove expands
around the central CG pair and allows the binding of CcpA (Schumacher et al., 2004; Schumacher et
al., 2011). Due to the high flexibility of the helix turn helix (HTH) motif of the DNA binding domain,
CcpA is able to recognize highly degenerated DNA motifs with only small conserved parts (Table 3.1).
Table 3.1: Comparison of cre consensus sequences
Reference
Consensus sequence (5’→3’)
(Weickert & Chambliss, 1989)
T G W N A N C G N T N W C A
(Hueck et al., 1994)
W G N A A S C G N W W N C A
(Miwa et al., 2000)
W W T G N A A R C G N W W W C A W W
W T G N A A R C G Y T T W W N
(Miwa & Fujita, 2001)
Conserved regions are written in bold, red letters.
W: A/T
R: G/A
S: C/G
Y: C/T
N: A/C/G/T
The position of the cre-site in reference to the promoter leads to either activation or repression of
transcription. Cre-sequences located downstream or within the promoter region mainly cause
repression of transcription, e.g. the cre-sequences of xylA, xynP or gntR-credown (Galinier et al., 1999;
Jacob et al., 1991; Kraus et al., 1994; Miwa & Fujita, 1990; Miwa et al., 1997). The cre-sequences of
ackA are located upstream of the promoter region and transcription is activated by CcpA (Grundy et
al., 1993; Moir-Blais et al., 2001). In the next chapters, the regulation of these four genes will be
introduced in more detail as these belong to three different groups of genes regulated by CcpA: (1)
genes whose transcription is activated in the presence of CcpA, e.g. ackA; (2) genes whose
transcription is repressed moderately by CcpA, e.g. gntR and (3) genes whose transcription is
repressed strongly by CcpA, e.g. xylA and xynP (Marciniak et al., 2012).
- 15 -
Introduction
3.3.4 The regulation of ackA, gntR, xylA and xynP
During overflow metabolism, AckA, the acetate kinase, converts glucose to acetate in combination
with the phosphotransacetylase Pta. This represents two advantages for the cell: Accumulation of
acetyl-CoA is prevented and the pH of the environment is lowered and therefore, the growth of
other bacteria is hindered (Grundy et al., 1993; Presecan-Siedel et al., 1999). The expression of ackA
is activated by several different regulators: The binding of the CcpA-HPrSer46P complex to ackAcre2,
located upstream of the promoter region, activates transcription of the gene 20-fold in the presence
of glucose (Sprehe et al., 2007; Turinsky et al., 1998). In addition, the transcriptional regulator CodY
cooperatively activates expression of ackA. The corresponding binding sites are located upstream of
ackA-cre2 (Belitsky & Sonenshein, 2008; Moir-Blais et al., 2001; Shivers et al., 2006). As both
regulators are able to interact with RpoA, the α-subunit of the RNA polymerase, they probably fix the
RNA polymerase in the optimal position to start the transcription (Wünsche et al., 2012).
GntR is the repressor of the gntRKPZ operon. This operon encodes the enzymes GntK (gluconate
kinase), GntP (gluconate permease) and GntZ (NAD+-6-phosphogluconate dehydrogenase) which
catalyze the uptake and metabolization of gluconate (Fujita et al., 1986; Miwa & Fujita, 1988; Reizer
et al., 1991). In the presence of gluconate, GntR is relieved from its operator binding site and the
operon is expressed (Dowds et al., 1978; Nihashi & Fujita, 1984; Yoshida et al., 1995). In presence of
glucose, the expression of these genes is repressed 11-fold by CcpA (Sprehe et al., 2007). The operon
contains two cre-elements, creup located within the -35 region and credown located within the coding
region of gntR. Only credown is bound by the CcpA-HPrSer46P complex. In contrast, creup is bound by
only by CcpA in combination with glucose-6-phosphate (Fujita & Miwa, 1994; Fujita et al., 1995;
Miwa & Fujita, 1990; Miwa et al., 1997). Additionally, CcpB regulates gntRKPZ expression instead of
CcpA under oxygen limited conditions (Chauvaux et al., 1998).
Xylan and xylose serve as secondary carbon sources. They are taken up by AraE (xylose) and XynP
(xylan) (Krispin & Allmansberger, 1998; Lindner et al., 1994) and are metabolized by the enzymes
encoded by the xylAB and xynPB operons. The expression of these two operons is induced in the
presence of xylose by the inactivation of the regulator XylR (Gärtner et al., 1992; Gärtner et al., 1988;
Lindner et al., 1994). If glucose is available, the expression of both operons is repressed by the CcpAHPrSer46P complex: The expression of xylAB is reduced 38-fold, the expression of xynPB 40 to 440fold depending on the utilized medium (Galinier et al., 1999; Jacob et al., 1991; Kraus et al., 1994;
Sprehe et al., 2007; Steinert, 2011). In addition, high intracellular amounts of glucose-6-phosphate
- 16 -
Introduction
have an anti-inducing effect on XylR. As a consequence, XylR is not released from its operator DNA
even if the inducer xylose is available, if the energy level of the cell is high (Dahl et al., 1995).
The transcription of all genes presented in this chapter is regulated by CcpA, however, the strength
of the regulation varies. The interaction between CcpA-HPrSer46P and xylA-cre of B. megaterium was
quantified already and revealed a KD-value of 0.6 ± 0.3 nM (Seidel et al., 2005). However, for B.
subtilis, the interaction of the CcpA-HPrSer46P complex with cres of strongly or moderately
repressed genes, e.g. xynP or gntR, respectively, or genes activated by CcpA, e.g. ackA has never
been characterized so far.
3.4 Scope of the thesis
(1) The interaction of the TCA cycle enzymes Mdh, Icd and CitZ has already been detected in
vivo. However, the dynamics of this complex formation remain unclear so far. This study
addresses the question, how this complex is formed in vitro and if its formation is influenced
by certain metabolites. Since the formation of a metabolon enables the direct contact of
particular enzymes and therefore, the fast transfer of their intermediates, the second part of
this study aims to elucidate the influence of the interaction partners on the enzymatic
activity of the single enzymes.
(2) The expression of ackA, gntR, xylA and xynP is regulated by CcpA, however, the strength of
this regulation varied. Since the cre-elements of these genes are highly degenerated
sequences which have only very small conserved parts, they might be bound with different
affinities by the CcpA-HPrSer46P complex. This part of the study aims to elucidate the impact
of the cre-sequences on the repression and activation of expression by determining the
kinetics of the CcpA-HPrSer46P interaction with various cre-elements in vitro.
- 17 -
Material and Methods
4 Material and Methods
4.1 Material
4.1.1 Chemicals
The chemicals used for this thesis were purchased from Merck (Darmstadt), Roth (Karlsruhe) or
Sigma (Munich) in p.a. quality. All chemicals are summarized in Table 4.1. The following tables
content the used auxiliary materials (Table 4.2), instruments (Table 4.3), reagent mixtures (Table
4.4), enzymes, proteins and standards (Table 4.5) and Oligonucleotides (Table 4.6).
Table 4.1: Chemicals
Chemical
Source
2-Nitrophenol-β-D-galactopyranosid (ONPG)
Acrylamide, Rotiphorese gel (19:1)
Acrylamide, Rotiphorese gel (37:1)
Adenosintriphosphate-Monohydrate (ATP)
Agar
Agarose
Ammoniumperoxodisulfate (APS)
Ampicillin
Bactotryptone
Boric acid
Bovine serum albumine
Bradford reagent
Bromphenolblue
Calciumchloride, Dihydrate
Casein acid hydrolysate (CAA)
Chloramphenicol
Chloroform
Complete-proteaseinhibitor, EDTA-free
Coomassie Brillant Blue
Applichem, Darmstadt
Roth, Karlsruhe
Roth, Karlsruhe
Roche, Mannheim
Merck, Darmstadt
Peqlab, Erlangen
Merck, Darmstadt
Roth, Karlsruhe
Oxoid, Hampshire, GB
Merck, Darmstadt
Roth, Karlsruhe
BioRad, Munich
Roth, Karlsruhe
Sigma, Steinheim
Sigma, Munich
Serva, Heidelberg
Roth, Karlsruhe
Roche, Mannheim
Amersham Pharmacia Biotech,
Sweden
Roth, Karlsruhe
Peqlab, Erlangen
Sigma, Steinheim
Sigma, Munich
Roth, Karlsruhe
Merck, Darmstadt
Roth, Karlsruhe
Roth, Karlsruhe
Sigma, Steinheim
D-(+)-Glucose, Monohydrate
Desoxynucleotidetriphosphates (dNTPs)
Desthiobiotin
Dimethylformamide
Dimethylsulfoxide (DMSO)
Dipotassiumhydrogenphosphate
Disodiumhydrogenphosphate
Dithiothreitol
DL-Isocitric acid trisodium salt hydrate
- 18 -
Material and Methods
Chemical
Source
Erythromycin
Ethanol, absolute
Ethanol, technical
Ethidium bromide
Ethylendiamintetraaceticacid-disodiumsalt, Dihydrate (EDTA)
Ferric-ammonium-citrate (CAF)
Formamid
Fructose-1,6-bisphosphate, Octahydrate
Glycerol
Glycerol
Glycine
HEPES
Hydrochloric acid
Imidazol
Iodonitrotetrazolium chloride
Isopropylalcohol
Isopropyl-β-D-galactopyranoside (IPTG)
Kanamycin
L-(-) Malic acid
L-Glutamate
L-Isoleucine
L-Leucine
L-Methionine
L-Tryptophan
L-Valine
Magnesium chloride, Hexahydrate
Magnesium sulfate
Manganese (II) sulfate, Monohydrate
Methanol
N,N,N’,N’- Tetramethylenediamine (TEMED)
NeutrAvidin TM
Oxaloacetic acid
Paraformaldehyde
Phenazine methosulfate
Phenazine methosulfate (PMS)
Phenylmethylsulfonyfluoride (PMSF)
p-Iodonitrotetrazolium-Violet (INT)
Polyethylenglycol (PEG) 6000
Potassium chloride
Potassium dihydrogen phosphate
Potassium hydroxide
Rotenone
Sodium acetate
Sodium carbonate
Sodium chloride
Sodium dihydrogenphosphate
Sodium dodecylsulfate
Sodium hydroxide
Succinic acid, sodium salt
Sigma, Steinheim
Roth, Karlsruhe
Roth, Karlsruhe
Roth, Karlsruhe
Roth, Karlsruhe
Sigma, Steinheim
Merck, Darmstadt
Sigma, Heidelberg
Fluka, CH
Roth, Karlsruhe
Roth, Karlsruhe
Roth, Karlsruhe
Roth, Karlsruhe
Merck, Darmstadt
Sigma, Steinheim
Merck, Darmstadt
Roth, Karlsruhe
Roth, Karlsruhe
Sigma, Steinheim
Sigma, Steinheim
Roth, Karlsruhe
Sigma, Steinheim
Sigma, Steinheim
Sigma, Steinheim
Sigma, Steinheim
Sigma, Steinheim
Roth, Karlsruhe
Fluka, CH
Merck, Darmstadt
Roth, Karlsruhe
Pierce, USA
Sigma, Steinheim
Roth, Karlsruhe
Sigma, Steinheim
Sigma, Steinheim
Roth, Karlsruhe
Sigma, Steinheim
Sigma, Munich
Merck, Darmstadt
Roth, Karlsruhe
Peqlab, Erlangen
Sigma, Steinheim
Merck, Darmstadt
Roth, Karlsruhe
Roth, Karlsruhe
Roth, Karlsruhe
Roth, Karlsruhe
Serva, Heidelberg
Serva, Heidelberg
- 19 -
Material and Methods
Chemical
Source
Tetracycline-Hydrochloride
Triethanolamine hydrochloride
Tris(hydroxymethyl)ammoniummethane (Tris)
Trisodiumcitrate, Dihydrate
TritonX-100
Tryptone
Tween 20
Xylene cyanol
Yeastextract
α-Ketoglutaric acid sodium salt
β-Mercaptoethanol
β-Nicotinamide adenine dinucleotide hydrate 2-phosphate,
reduced tetrasodium salt hydrate (NADPH)
β-Nicotinamide adenine dinucleotide hydrate from Yeast
(NAD+)
β-Nicotinamide adenine dinucleotide phosphate hydrate
(NADP+)
β-Nicotinamide adenine dinucleotide, reduced disodium salt
hydrate (NADH)
Merck, Darmstadt
Sigma, Steinheim
Roth, Karlsruhe
Sigma, Steinheim
Roth, Karlsruhe
Oxoid, GB
Sigma, Munich
Roth, Karlsruhe
Roth, Karlsruhe
Sigma, Steinheim
Merck, Darmstadt
Sigma, Steinheim
Sigma, Steinheim
Sigma, Steinheim
Sigma, Steinheim
4.1.2 Auxiliary Material
Table 4.2: Auxiliary Material
Material
Source
Amino coupling Kit for Biacore X
BIAmaintenance Kit for BiacoreX
Centriprep Centrifugal filter devices (MWCO 3, 10, 30,
50 kDa)
Chromatographypaper
Chromatograpy material DEAE – Sephacel
Chromatograpy material Fractogel EMD TMAE
Chromatograpy material POROS 20 MC
Chromatograpy material POROS HS/M
Electroporation cuvettes
Eppendorf reaction tubes
Gene Amp reaction tubes
Gilson tips
Glas pipettes
HBS-EP buffer
Hiprep QFF sepharose column
Hiprep SepharoseQ column
HisTrap FF, NiNTA column
Microliterpipets
Nitrocellulose filter (0.45 μm pore size)
GE Healthcare, Munich
GE Healthcare, Munich
- 20 -
Millipore, USA
Whatman, England
Pharmacia, Freiburg
Merck, Darmstadt
Applied Biosystems, Weiterstadt
Applied Biosystems, Weiterstadt
EQUIBIO, Great Britain
Greiner, Nürtingen
Perkin Elmer, Weiterstadt
Greiner, Nürtingen
Brand, Wertheim
GE Healthcare, Munich
GE Healthcare, Munich
Pharmacia, Freiburg
GE Healtcare, Munich
Gilson, Düsseldorf
Sartorius, Göttingen
Material and Methods
Material
Source
Petridishes
Polyvinylidenedifluoride (PVDF) membrane
Quartzglass cuvettes
Semi-micro cuvettes
Sensorchip CM5
Sensorchip SA
Size exclusion chromatography column Superdex G200
Size exclusion chromatography column Superdex G75
Slyde-A-Lyzer Dialysis Units
Sterile filter Minisart (0.2 µM pore size)
Superformance Glass column 150C-10
Ultrafiltration membranes MWCO 3 kDa
XK-column
Greiner, Nürtingen
Pall Filtron, USA
Hellma, Mühlheim
Greiner, Nürtingen
GE Healthcare, Munich
GE Healthcare, Munich
Amersham, Freiburg
Amersham, Freiburg
Pierce,
Schleicher & Schüll, Dassel
Merck, Darmstadt
Millipore, USA
Amersham, Freiburg
4.1.3 Instruments
Table 4.3: Instruments
Instrument
Source
Äkta FPLC
Äkta Prime
Analytical Balance
BIAcoreX
Biofuge A centrifuge
Biofuge Fresco
Branson Sonic Sonifier B12
Centrifuge J21B
DNA Thermo Cycler 2400
Electrophoresis/Electroblotunit Mini V8-10
Electroporation Device Gene Pulser + Puls Controller
FPLC chromatography system
Microprocessor pH-Meter calimatic
Mini-PROTEAN® Tetra Cell chamber
Novaspec III visible photometer
Rotary shaker G-25
Sequencer ABI 310 Genetic Analyzer
Speed Vac centrifuge
Stirred Ultrafiltration Cell
Ultracentrifuge L7-55
Ultrospec photometer 3000, Novaspec
Video documentation system VarioCam
Pharmacia, Freiburg
Pharmacia, Freiburg
Sartorius, Göttingen
BIAcore, Sweden
Heraeus Christ, Osterode
Heraeus Christ, Osterode
Braun, Melsungen
Beckmann, München
Perkin Elmer, USA
Gibco/BRL, Karlsruhe
Biorad, München
Pharmacia, Freiburg
Knick, Berlin
Biorad, Munich
Amersham, Freiburg
New Brunswick, Neu-Isenburg
PE Applied Biosystems, Freiburg
Bachofer, Reutlingen
Amicon, USA
Beckmann, München
Pharmacia, Freiburg
Biotec Fischer, Reiskirchen
- 21 -
Material and Methods
4.1.4 Reagent mixtures
Table 4.4: Reagent mixtures
Reagent Mixtures
Usage
Source
NucleoBond® AX100 & AX500
Preparation of plasmid DNA
Purification of DNA from agarose
gels and enzymatic reactions
Purification of plasmid DNA
Purification of chromosomal DNA
of B. subtilis
Macherey-Nagel, Düren
NucleoSpin® Gel and PCR clean up
NucleoSpin® Plasmid
QIamp DNA Mini Kit
Macherey-Nagel, Düren
Macherey-Nagel, Düren
QIAGEN, Hilden
4.1.5 Proteins, enzymes and standards
Table 4.5: Proteins, enzymes and standards
Enzymes, proteins and standards
Restriction endonucleases
AgeI
BamHI
BlpI
EcoRI
HindIII
NheI
PmeI
SacI
XbaI
XhoI
XmaI
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
Standards
PeqGold protein marker II
PeqGold DNA Leitermix
PeqGold DNA Leitermix I Ultra low range
Peqlab, Erlangen
Peqlab, Erlangen
Peqlab, Erlangen
Enzymes
Calf intestine phosphatase (CIP)
DNAseI
Phusion DNA-polymerase
Proteinase K
RNAse A
T4-DNA ligase
T4-DNA quickligase
TetR(B) and TetR(BD)
New England Biolabs, Schwalbach
Sigma, Steinheim
Finnzymes, Finland
Merck, Darmstadt
Sigma, Steinheim
New England Biolabs, Schwalbach
New England Biolabs, Schwalbach
Obtained from Stephanie Platzer and Dr. Gerald
Seidel, Erlangen
- 22 -
Material and Methods
4.1.6 Oligonucleotides
Table 4.6: Oligonucleotides
Oligonucleotide
citZfwNhe2
citZrevBam
Sequence (5’-3’)
Application
CAGTGGCTAGCATGACAGCGACACGCGGTCTT
GAAG
GACTGGATCCTTAGGCTCTTTCTTCAATCGGAA
CG
Forward primer for cloning
of citZ from B. subtilis
Reverse primer for cloning
of citZ from B. subtilis
5’ biotinylated for SPR
analysis
for SPR analysis
5’ biotinylated for SPR
analysis
for SPR analysis
5’ biotinylated for SPRanalysis
for SPR analysis
5’ biotinylated for SPR
analysis
for SPR analysis
5’ biotinylated for SPR
analysis
for SPR analysis
Sequencing primer for icd
from B. subtilis
Forward primer for cloning
of icd from B. subtilis
Sequencing primer for icd
from B. subtilis
Sequencing primer for icd
from B. subtilis
Reverse primer for cloning
of icd from B. subtilis
Sequencing primer for icd
from B. subtilis
Sequencing primer for mdh
from B. subtilis
Sequencing primer for mdh
from B. subtilis
Sequencing primer for mdh
from B. subtilis
Sequencing primer for mdh
from B. subtilis
5’ biotinylated for SPR
analysis
for SPR analysis
Forward sequencing primer
for pET28b-derivatives
Reverse sequencing primer
for pET28b-derivatives
cre2ackAfw
TTCTTATTGTAAGCGTTATCAATACG
cre2ackArev
CGTATTGATAACGCTTACAATAAGAA
cregntRfw
GTCTGATTGAAAGCGGTACCATTTTA
cregntRrev
TAAAATGGTACCGCTTTCAATCAGAC
creusfw26nt
AATCATTTATGGCATAGGCAACAAGT
creusrev26nt
ACTTGTTGCCTATGCCATAAATGATT
crexylAfw
ACTATTTGGAAGCGCAAACAAAGTG
crexylArev
CACTTTGTTTGCGCTTCCAAAATAGT
crexynPfw
ACTGTTTTGAAAGCGCTTTTATAAAA
crexynPrev
TTTTATAAAAGCGCTTTCAAAACAGT
Icdfw2781
GTTATTCTTTCAGGCGTTCTGC
IcdfwBam
IcdfwXho
Icdrev1911
IcdrevXho
IcdrevXma
MdhfwXho
MdhrevXma
ATCGTCGGATCCTATGGCACAAGGTGAAAAAA
TTACAGTC
ATCGTCCTCGAGGTGGCACAAGGTGAAAAAAT
TACAGTC
TATTCGCGGATCACATCTAATGTTTC
GTCCTGCTCGAGTTAGTCCATGTTTTTGATCAG
TTCTTC
GTCCTGCCCGGGTTAAGTCCATGTTTTTGATCA
GTTC
AGCGTACTCGAGCATGGGAAATACTCGTAAAA
AAG
TCTAGTGCCCGGGTTAGGATAATACTTTCATGA
CATTTTTG
MdhSeq3162rev
GCTTGCTTCAAGCATATC
Mdhseq3601
ATTCCGAAAGAACGGATTGA
syncrefw
TTCTTACTGTTAGCGCTTTCAGTACG
syncrerev
CGTACTGAAAGCGCTAACAGTAAGAA
T7 Promotorprimer
CGCGAAATTAATACGACTCACTATAGGG
T7 Terminatorprimer
GCTAGTTATTGCTCAGCGG
- 23 -
Material and Methods
4.2 Bacterial strains
Table 4.7: Bacterial strains
Strain
Genotype
Reference
Bacillus subtilis 168
E. coli DH5α
trp+
recA1 endA1 gyrA96 relA1 hsdR17(rkmk+) supE44 thiΦ80 ΔlacZΔM15
Δ(lacZYA-argF)U169
BL21(DE3) ΔptsH/crr/pLysS, KanR,
CamR
F- ompT hsdSB (rB-mB-) gal dcm (DE3)
pLysS (CamR)
(Zeigler et al., 2008)
(Hanahan, 1985)
E. coli FT1
E. coli BL21(DE3) pLysS
(Parche et al., 1999)
(Studier & Moffatt, 1986)
4.3 Plasmids
Table 4.8: Plasmids
Plasmid
Characteristics
Reference
p4813
pET-28b(+)
AmpR, ptsK
KanR, oripBR322, overexpression vector including
N-terminal His-tag
pWH844 derivative: AmpR, overexpression of B.
subtilis mdh with N-terminal His-tag
pWH844 derivative: AmpR, overexpression of B.
subtilis icdS104P mutant with N-terminal His-tag
pET3c ptsH (B. subtilis)
pET3c ccpAhis6
pET-28b(+), for overexpression of B. subtilis icd
with N-terminal His-tag
pET-28b(+), for overexpression of B. subtilis citZ
with N-terminal His-tag
(Reizer et al., 1998)
Novagen
pGP385
pGP389
pWH466
pWH653
pWH2410
pWH2421
- 24 -
Unpublished, obtained from
Jörg Stülke, Göttingen
Unpublished, obtained from
Jörg Stülke, Göttingen
(Seidel et al., 2005)
(Seidel, 2005)
This work
This work
Material and Methods
4.4 Buffer and media
If not stated differently, buffers, media and solutions were prepared with Millipore water or
deionized water and autoclaved for 20min at 121°C. Solutions containing heat labile ingredients were
filtered with a sterile filter (0.2 µM) and added to the autoclaved medium after cooling down to 50°C.
4.4.1 General buffers and solutions
TE buffer
SBT buffer
50 mM Tris/HCl pH 7.5
10 mM Tris/HCl pH 8
200 mM NaCl
0.1 mM EDTA
4.4.2 Buffers and solutions for protein purification
All buffers used for chromatography were sterile filtered (0.2 µM pore size) and stored at 4°C.
Buffers for anion exchange chromatography



Buffer A: 10 mM Tris/HCl, pH 7.5, 2 mM DTT
Puffer B: 10 mM Tris/HCl, pH 7.5, 2 mM DTT, 1 M NaCl
Regeneration buffers: 2 M NaCl, 30 % (v/v) isopropanol, 1 M NaOH
Buffers for NiNTA affinity chromatography




HisA buffer: 50 mM NaH2PO4, 300 mM NaCl, 50-75 mM Imidazole
HisB buffer: 50 mM NaH2PO4, 300 mM NaCl, 500 mM Imidazole
Stripping buffer: 20 mM NaH2PO4, 500 mM NaCl, 50 mM EDTA, pH 7.4
100 mM NiSO4 for recharging the column
Buffers for size exclusion chromatography


HBS-E buffer: 150 mM NaCl, 3 mM EDTA, 10 mM HEPES (pH 7.4)
0.5 mM NaOH for regeneration of the column
- 25 -
Material and Methods
4.4.3 DNA and protein gel electrophoresis
4.4.3.1 DNA gel electrophoresis
50x TAE
DNA loading dye
2M Tris
0.05 % (w/v) bromphenole blue
1 M NaOAc
0.05 % (w/v) xylene cyanole
62.5 mM EDTA
2 % (w/v) SDS
pH 8.3 (glacial acetic acid)
1 mM EDTA
50 % (v/v) glycerol
2 % (v/v) 50x TAE
DNA size standards:
Peqlab DNA “Leitermix”
10/8/6/4/3.5/3/2.5/2/1.5/1.2/1/0.9/0.8/0.7/0.6/0.5/0.4/0.3/0.2/0.1 kbps
Peqlab DNA “Leitermix I” Ultra low range
300/200/150/100/75/50/35/25/20/15/10 bps
4.4.3.2 Protein gel electrophoresis
SDS-PAGE
10x SDS running buffer
5x Protein loading dye
1.92 M glycine
20 % (w/v) SDS
0.5 M Tris
60 % (v/v) glycerol
10 % (w/v) SDS
250 mM Tris
pH 8.5-8.8
10 % (v/v) β-mercaptoethanol
0.05 % (w/v) Serva blue G-250
Protein size marker for SDS gel electrosphoresis: PeqGold protein marker II
200/150/120/100/85/70/60/50/40/30/25/20/15/10 kDa
- 26 -
Material and Methods
Stacking gel
Separation gel
4 % (v/v) acrylamide (37.5:1)
10 % (v/v) acrylamide (37.5:1)
85 mM Tris/HCl (pH 6.8)
85 mM Tris/HCl (pH 8.8)
0.1 % (w/v) SDS
100 mM Tris/ boric acid (pH 8.8)
With H2O ad 9.95 ml
0.1 % (v/v) SDS
50 µl 10 % (w/v) APS
With H2O ad 9.8 ml
9 µl TEMED
200 µl 10 % (w/v) APS
5 µl TEMED
Native Gelelectrophoresis
Separation gel
10x native protein PAGE buffer
7.5 % - 15 % (v/v) Acrylamide (37.5:1)
1.92 M glycine
85 mM Tris/HCl (pH 8.8)
0.5 M Tris
100 mM Tris/boric acid (pH 8.8)
pH 8.8
With sterile H2O ad 10.6 ml
200 μl APS
5x native protein loading dye
9 μl TEMED
50 % (v/v) Glycerol
1.5 % (v/v) Bromphenol blue
5x TBE
Native PAA gel (TBE)
450 mM Tris
4 % (v/v) Acrylamide (37.5:1/19:1)
450 mM boric acid
1x TBE
10 mM EDTA
With sterile H2O ad 9.7 ml
pH 8.3 boric acid
300 µl 10 % (w/v) APS
5 µl TEMED
- 27 -
Material and Methods
Washing solution
Staining solution
45 % (v/v) Methanol
0.5 % (w/v) Coomassie Brillant Blue
10 % (v/v) Acetic acid
10 % (v/v) Acetic acid
Destaining solution
10 % (v/v) Acetic acid
4.4.4 Media and supplements
LB-Medium
10 g/l tryptone
5 g/l yeast extract
10 g/l NaCl
Additionally 1.5 % (w/v) agar for solid medium
Antibiotics
Antibiotics were prepared as 1000x stock solutions. Ampicillin and Kanamycin were solved in
Millipore, Chloramphenicol was solved in 70 % (v/v) Ethanol. After filtration with a 0.2 µM filter, the
solutions were stored at -20°C. Freshly autoclaved media were cooled down to 50°C and afterwards
the antibiotics were added to their final concentrations:
Antibiotic
Ampicillin
Kanamycin
Chloramphenicol
Final concentration
100 µg/ml
100 µg/ml
25 µg/ml
Application
E. coli
E. coli
E. coli
IPTG
IPTG was prepared at 1000x stock solution and added to the medium to a final concentration at
1 mM.
28
Material and Methods
4.5 Methods
4.5.1 General methods
Table 4.9: General methods
Method
Determination of absorbtion of DNA solutions
Ethidium bromide staining of DNA
Gelelectrophoresis of DNA
Ligation of DNA fragments
Plasmid preparation from E. coli
DNA precipitation
DNA sequencing
Determination of protein concentrations
Denaturating gel electrophoresis of proteins
Preparation of CaCl2 competent E. coli cells
Reference
(Sambrook, 2012)
(Sambrook, 2012)
(Sambrook, 2012)
(Sambrook, 2012)
(Holmes & Quigley, 1981)
(Sambrook, 2012)
(Sanger et al., 1977)
(Bradford, 1976)
(Laemmli, 1970)
(Ausubel, 1987)
4.5.2 Growth of bacteria
If not stated differently, bacteria were grown in shaking flasks or glasses filled with the chosen
medium at 37°C by continuous shaking at 180-200 rpm till the desired OD600 was reached. Incubation
of overnight cultures longed for 16-18 hours.
4.5.3 Transformation of E. coli
4.5.3.1 Preparation of CaCl2 competent E. coli cells
50 ml LB were inoculated with 500 µl of an overnight culture and grown at 37°C by continuously
shaking. Growth was stopped at an OD600 of 0.6 by incubation of the cells on ice for 10min. The cells
were harvested by centrifugation at 4000 x g for 10min at 4°C. After removal of the supernatant the
cell pellet was resuspended in 25 ml (half volume of the culture) cold 0.1 M CaCl2 solution, followed
by a second incubation step for 20min on ice. The cells were centrifuged once more at 4000 x g for
10min. The cells were resuspended in 5 ml ice-cold 0.1 M CaCl2 solution (1/10 culture volume) and
adjusted to 15 % (v/v) glycerol. Before utilization the cells were either incubated for at least one hour
on ice or aliquoted at 500 µl, quick frozen with liquid nitrogen and stored at -80°C.
- 29 -
Material and Methods
4.5.3.2 Transformation of E. coli
The competent cells were carefully thawed on ice and aliquots of 100 µl were added to 10-100 ng
DNA. After 20min incubation on ice the heatshock was carried out at 42°C for 90s followed by a
second incubation on ice for 10min. 1 ml LB medium was added and the mixture was shaken for at
least one hour at 37°C. Finally, the cells were spread on selective media and incubated over night at
37°C.
4.5.3.3 Long time storage of bacterial strains
600 µl of an overnight culture were mixed thoroughly with 300 µl 60 % (v/v) glycerol and frozen
immediately in liquid nitrogen. The cells were stored at -80°C.
4.5.4 Methods for purification and modification of nucleic acids
4.5.4.1 Hybridization of cre DNA
Equal amounts of complementary strands were mixed in PCR tubes and hybridized in a PCR program
by a first melting step at 98°C followed by heating and cooling the sample around the melting
temperature (Tm) several times. Finally, the samples were cooled down to room temperature and
stored after the hybridization at 4°C. The detailed program is shown below. The hybridized DNA
samples were used without further preparation steps.
1x
15x
1x
98°C melting
Tm-5°C
Tm
hybridization
Tm+5°C
Stepwise cooling down to room
temperature
5min
30s
30s
30s
3min/step
All 26 nt oligonucleotides were purchased at MWG Eurofins/Ebersberg, the forward strand was
biotinylated at the 5’ end.
- 30 -
Material and Methods
4.5.4.2 Isolation of chromosomal DNA from B. subtilis
A 4 ml overnight culture was harvested by centrifugation at 13000 x g /4°C, resuspended in 350 µl
lysis buffer and this mixture was incubated at 37°C for 120min.
Lysis buffer
100 mg lysozyme
100 μl 1 M Tris/HCl pH 8.0
20 μl 0.5 M EDTA pH 8.0
Ad 2.5 ml H2O
5 µl RNAseA (100 mg/ml) were added, the assays incubated for 2min and afterwards 50 µl Proteinase
K (20 mg/ml) were added. The following steps were carried out with the buffers of the QIAamp® DNA
Mini Kit from Qiagen. 400 µl ATL buffer were added to the samples and then incubated at 70°C for
30min. After an addition of 400 µl AL buffer the cell debris were precipitated by mixing the sample
with 700 µl ice cold 100 % (v/v) ethanol, subsequently incubated at room temperature for 5min. To
separate the cell debris from the DNA the samples were centrifuged at 11000 x g /4°C for 10min. The
supernatant was loaded to a column by centrifugation at 8000 x g /4°C for 1min. The samples were
washed twice with buffer AW and the chromosomal DNA was eluted in two steps with AE buffer
prewarmed to 70°C. The chromosomal DNA was stored at 4°C in the fridge.
4.5.4.3 Isolation of plasmid DNA from E. coli
Plasmid purifications of 100 ml and 500 ml overnight cultures were carried out with the NucleoBond®
AX100 and AX500 kit , for 4 ml overnight cultures the NucleoSpin® Plasmid kit was used according to
the manufacturer’s manual (Macherey-Nagel/Düren). The final DNA concentration was determined
either by usage of the Nanodrop™ spectrophotometer (Peqlab, Erlangen) or by estimation from a 1 %
agarose gel.
- 31 -
Material and Methods
4.5.4.4 Polymerase chain reaction (PCR)
For polymerase chain reactions either chromosomal or plasmid DNA was used as template. In
general the mixtures were composed as follows:
template DNA
5’ and 3’ oligonucleotide
HF buffer
dNTP mixture*
Taq or Phusion polymerase
H2O
0.1-1 µg
10 pmol
1x
0.5 mM
2 Units
Ad 20-100 µl
* dNTP mixture contained 10 mM dATP, 10 mM dTTP, 10 mM dCTP, 10 mM dGTP
General PCR setup:
1x
25-30x
1x
95-98°C (First initial denaturation)
95-98°C (Denaturation)
55-65°C (Annealing)
72°C (Polymerisation)
72°C
1min
30sec
30sec
2min
7min
After the reaction the samples were cooled down to 4°C. Annealing temperatures were calculated by
Clone Manager™ (Version 9) according to the hybridization temperatures.
4.5.4.5 Restriction of DNA
Restriction of DNA was carried out in the buffers and under the conditions recommended by the
manufacturer. The amount of DNA determined the amount of enzyme and the incubation time. If
necessary, enzymes were inactivated according to the manufacturer’s manual. The results were
checked by loading the samples on 1 % agarose gels.
- 32 -
Material and Methods
4.5.4.6 Dephosphorylation of DNA
To dephosphorylate the vector after restriction, the enzymes were inactivated by freezing the
samples for 20min at -20°C. Afterwards 1 U calf intestine phosphatase (CIP) was used per 50 ng DNA
in 1x CIP buffer (New England Biolabs, Bad Schwalbach) and the samples were incubated at 37°C for
one hour. The reaction was stopped by freezing the samples again at least for 30min at -20°C.
4.5.4.7 Ligation of DNA fragments
DNA fragments were ligated with the T4 DNA Quickligase™ in the recommended buffer. Inserts were
used in 2- to 5-fold excess in contrast to the vector. The samples were incubated at room
temperature for a maximum of 20min in the dark.
4.5.4.8 Elution of DNA from agarose gels
DNA fragments were separated by electrophoresis with 1 % agarose gels. These were stained in
ethidiumbromide for 5-10min and subsequently washed in H2O for 5-10min. The desired DNA bands
were cut out the gel using UV light and purified by usage of the NucleoSpin® Gel and PCR clean up kit
according to the manufacturer’s manual. The purification was checked on an agarose gel afterwards.
4.5.4.9 Sequencing of DNA
Sequencing of DNA was carried out by GATC Biotech AG (Konstanz). Samples were treated like
recommended by the company.
- 33 -
Material and Methods
4.5.5 Methods for purification and analysis of proteins
4.5.5.1 Denaturating protein gel electrophoresis (PAGE)
10 % PAA gels with a width of 1 mm were prepared like introduced by Laemmli (Laemmli, 1970). All
samples were mixed with loading dye, denaturated at 90°C for 5-10min and loaded. Afterwards the
gels were run at 80-200 V in a Mini-PROTEAN® Tetra Cell chamber (BioRad, Munich). After
electrophoresis the gels were fixed for 20min in washing solution, stained for 5-20min in staining
solution and destained in destaining solution until the optimal intensity of bands was reached
(compare to 4.4.3.2.)
4.5.5.2 Native PAGE
Native protein gels were prepared like stated in chapter 4.4.3.2. 15 µl samples were mixed with 5 µl
native loading dye and loaded directly to the gel. The gels were run at 80-100 V, the staining and
destaining procedure was identical to the SDS gels (compare to 4.5.5.1).
4.5.5.3 Cell cultivation for protein overexpression
1 l LB medium with the corresponding antibiotics was inoculated with a fresh 4 ml overnight culture
of the relevant strain. The cells were cultivated at 37°C and the OD600 was monitored until 0.4-0.6. At
this point the overexpression was induced by addition of 1 mM IPTG (final concentration). The cells
were grown for further three hours. Afterwards the culture was harvested at 5000 rpm/4°C for
10min and pellet stored at -20°C. Before induction and three hours after induction, 5OD equivalents
were taken as controls and treated like the main pellet.
4.5.5.4 Sonication
The cell pellets were resuspended in 30 ml chilled HisA buffer or Buffer A, respectively, the controls
were adjusted to 20 OD/ml and resuspended in HisA buffer/ Buffer A as well. The cells were ruptured
by the Labsonic Ultra sonifier, samples up to 2 ml were ruptured with the small, bigger samples with
- 34 -
Material and Methods
the big sonifier. 3-5 pulses at 30s at 45 W were carried out with permanent cooling of the samples,
breaks in between the pulses lasted at least 30s, while the sample was kept on ice all the time.
4.5.5.5 Overexpression test
The overexpression of the proteins Mdh(His)6, Icd(His)6, IcdS104P(His)6 and CitZ(His)6 was examined
by growing and inducing the relevant strains like described in chapters 4.5.5.3 and 4.5.5.4. Before
induction, 90min and 180min after induction 5 OD equivalents were taken, harvested by
centrifugation at 5000 x g/4°C for 10min and the pellets were stored at -20°C. The cells were
adjusted at 20 OD/ml with HisA buffer, ruptured by sonication and the supernatant was removed. To
discover misfolded proteins in inclusion bodies the pellet with the cell debris was treated as follows.
The pellets were resupended again in the same volume of HisA buffer with 2 % Triton X 100,
incubated on ice for 30min and centrifuged for 20min at 13000 x g /4°C. The supernatant was
removed and the pellets were washed twice with SBT buffer. Finally the pellets were resuspended in
HisA buffer containing 8 M Urea to finally solve the pellet. The samples were warmed at 37°C, mixed
with SDS PAGE loading dye and 0.25 OD equivalents of supernatant and pellet fraction were analyzed
on an SDS PAGE.
4.5.5.6 Purification of CcpA(His)6, Mdh(His)6, Icd(His)6, IcdS104P(His)6 and
CitZ(His)6 from Bacillus subtilis
To purify CcpA(His)6, Mdh(His)6, Icd(His)6, IcdS104P(His)6 and CitZ(His)6 E. coli BL21(DE3)/pLysS or E.
coli FT1/pLysS cells with the corresponding plasmids pWH653, pGP385, pWH2410, pGP389 and
pWH2421 were grown like described above (see points 4.5.5.3 and 4.5.5.4). As overexpression of
citZ(His)6 at 37°C lead to formation of inclusion bodies, the overexpression was carried out at 20°C
after the induction with IPTG and the cells were shaken over night for approximately 18h. The pellets
were resuspended in 30 ml HisA buffer with 1x Complete® protease inhibitor (Roche) and ruptured
by sonication. Afterwards 30 µl 10 mg/ml DNAse I and 30 µl 5 mg/ml RNAseA were added to the
sample and the mixtures were kept on ice for at least 20min. Subsequently, the cell debris were
removed by centrifugation at 20000 rpm/4°C for at least 45min and the supernatant was decanted
immediately afterwards.
- 35 -
Material and Methods
The purification was carried out with an Äkta Prime™ chromatography system, as first purification
step the proteins were purified by a 5 ml NiNTA column. After a washing step with 15 column
volumes (CV) of HisA buffer the protein was eluted with a linear gradient of 15 %, 30 %, 50 %, 70 %
and finally 100 % HisB buffer. Protein containing fractions were analyzed by SDS-PAGE and merged
afterwards. To reduce the volume to 5 ml the protein solution was condensed via centrifugation with
Centriprep filters (MWCO 10 or 30 kDa) at 1500 x g/4°C. The condensed sample was loaded on the
Superdex G75 size exclusion chromatography column for further purification and transfer to the HBSE storage buffer. Pure protein fractions were further concentrated and stored in HBS-E buffer at 4°C
for approximately 4 weeks or in HBS-E with 50 %(v/v) glycerol at-20°C.
4.5.5.7 Preparation of E. coli DH5α p4813/ HPr kinase extract
E. coli DH5α p4813 cells were grown in 100 ml LB medium to an OD600 of 2.0-2.5 and harvested by
centrifugation at 5000 rpm/4°C for 5min. The pellet was washed in 40 ml DTT washing buffer,
centrifuged once more and resolved in 10 ml DTT lysis buffer. After sonication the cell extracts were
mixed with glycerol (final concentration: 10 % (v/v)), aliquoted at 800 µl and stored at -20°C.
DTT washing buffer
DTT lysis buffer
20 mM Tris/HCl pH 7.6
0.2 mM Tris/HCl pH 7.6
3 mM DTT
0.03 mM DTT
0.5 mM PMSF
4.5.5.8 Purification of HPrSer46P
For purification of HPrSer46P, E. coli FT1/pLysS/pWH466 was grown and induced like described
above. The cell pellets were solved in 30 ml Buffer A containing 1x Complete® protease inhibitor
(Roche) and ruptured (compare to chapter 4.5.5.4). The cell debris were removed by centrifugation
at 20000 rpm/4°C for at least 30min. 30 µl 10 mg/ml DNAse I and 30 µl 5 mg/ml RNAse A were added
to the supernatant and the samples were incubated on ice afterwards for 20min. To remove heat
instable proteins, the samples were heat up to 70°C for 20min and subsequently centrifuged once
more at 20000 rpm/4°C for at least 30min. The supernatant was decanted immediately afterwards.
- 36 -
Material and Methods
HPr was phosphorylated at Serine 46 by usage of the HPr kinase extract (compare to chapter 4.5.5.7).
The components listed below were mixed thoroughly and incubated for 20min at 37°C.
HPr crude lysate:
500 mM ATP
1 M FBP
10x R-Mix
Kinase extract
H2O
25-29 ml
340 µl
340 µl
3.4 ml
800 µl
Ad 35 ml
10x R-Mix
1 M Tris/HCl pH 7.5
1 M MgCl2
1 M DTT
H2O
2 ml
500 µl
100 µl
Ad 10 ml
The complete phosphorylation assay was loaded onto the QFF sepharose column. After a washing
step with Buffer A the proteins were eluted by a linear gradient (50 ml, 0-50 % Buffer B) followed by
a final elution step with 30 ml of 100 % Buffer B. Fractions containing HPrSer46P were condensed to
a final volume of 5 ml and finally transferred to the storage buffer HBS-E by size exclusion
chromatography with a Superdex G75 column. HPrSer46P was condensed to the final concentration
and stored in the fridge for approximately 4 weeks.
4.5.5.9 Dialysis of protein solutions
As glycerol disturbs surface plasmon resonance measurements, it was removed via dialysis in SlydeA-Lyzer dialysis cups with a maximal volume of 100 µl against a 1000-fold volume of HBS-E buffer at
4°C by slight stirring. Buffers were exchanged after one hour and two hours followed by al final
dialysis overnight.
4.5.5.10 Surface plasmon resonance (SPR) analysis
All SPR measurements were carried out on a BiacoreX instrument at 25°C. For all kinds of
measurements the carboxylated dextran matrix of the CM5 chips was activated by injection of a 35 µl
mixture of 50 mM N-hydroxysuccinimide (NHS) and 200 mM N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) solved in H2O. After coupling of the relevant ligand the remaining
activated carboxyl groups were deactivated by injection of 35 µl 1 M ethanolamine hydrochlorideNaOH pH 8.5. HBS-EP purchased by Biacore (GE Healthcare, Munich) served as running buffer for all
kinds of measurements. The optimal pH for coupling of ligand proteins was examined by the
- 37 -
Material and Methods
“immobilization pH scouting protocol” by Biacore/GE Healthcare and was based on the natural
isolelectric point of each protein. The different assays were realized as follows:
CcpA(His)6 – HPrSer46P: 500 nM CcpA(His)6 and as reference TetR(BD) from E.coli were solved in
10 mM sodium acetate pH 5. Around 3000 RU of CcpA(His)6 was coupled in flowcell (FC) 2, the same
amount of TetR(BD) was coupled in the reference cell FC1 at a flowrate of 5 µl/min. As high amounts
of CcpA(His)6 dissociated from the chip after coupling, the chip bleeded overnight, until the amount
of CcpA(His)6 on the chip was stable. The amount of HPrSer46P of each sample was adjusted with
HBS-EP buffer and sensorgrams were recorded at a constant flowrate of 20 µl/min as stated before
(Seidel, 2005; Seidel et al., 2005).
CcpA(His)6 – HPrSer46P – cre-sites: To analyze the binding of the CcpA-HPrSer46P complex to various
cre-elements on the activated chip approximately 4000 RU of Neutravidin were coupled in each of
the flowcells. After deactivation with ethanolamine 100 RU of hybridized 26 nt cre DNA biotinylated
at the 5’ end was coupled to FC2 and the same amount of 26 nt reference DNA to FC1. For qualitative
analysis the DNA on the chip was titrated with 10 nM CcpA(His)6 and varying amounts HPrSer46P (1100 µM). Quantitative measurements were carried out with samples containing varying amounts of
CcpA(His)6 (2-100 nM) and 50 µM HPrSer46P adjusted with HBS-EP buffer. To analyze the binding of
the whole complex to the cre-element the running buffer had to be supplemented with 50 µM
HPrSer46P, in the case of gntR-credown with 75 µM HPrSer46P to saturate CcpA fully with HPrSer46P.
Minimal masstransport was revealed at a flowrate of 40 µl/min and therefore it was chosen for all
measurements (Schumacher et al., 2011; Seidel, 2005). To induce the dissociation of the complex
80 µl pure HBS-EP buffer were injected. All kinetic parameters were calculated by BIAEVALUATION
software 4.1 from the given sensorgrams using the 1:1 Langmuir binding fit. All kinetic data were
obtained from three independent measurements.
Mdh(His)6 –Icd(His)6/IcdS104P(His)6/CitZ(His)6: Mdh(His)6 was diluted to 500 nM in 10 mM sodium
acetate pH 4 and 3500 RU were coupled to FC2. As reference cell served the empty FC1, which was
only activated and deactivated immediately afterwards. Icd(His)6/IcdS104P(His)6 or CitZ(His)6 samples
were adjusted to the correct amount (1-100 µM) by diluting with HBS-EP buffer and titrated to
Mdh(His)6. Since no masstransport was detectable at a flowrate of 20 µl/min, this was chosen for all
measurements. To remove Icd and regenerate the chip after each cycle, 50 µl 0.05 % (v/v) SDS
dissolved in HBS-EP buffer were injected. For measurements with different metabolites and
cofactors, all samples and the HBS-EP running buffer were supplemented with the same amount of
metabolites, NADP(H), NAD(H) and MgCl2 from stock solutions to reduce bulk effects. The pH in all
stock solutions was adjusted to 7.4 with 5 % (v/v) NaOH. Samples containing mixtures of enzyme,
metabolites and cofactors were injected immediately after mixing of the components. Association
- 38 -
Material and Methods
and dissociation rate constants (ka and kd) and the resulting dissociation constant KD were calculated
from the sensorgrams using the 1:1 Langmuir binding fit from the BIAEVALUATION software 4.1. All
kinetic data were obtained from three independent measurements.
4.5.5.11 Icd activity assay
The activity of Icd was determined according to the protocol of Ellis & Goldberg (Ellis & Goldberg,
1971) with tripiclates and at least two biological replicates. Each sample contained the following
components which were all dissolved in 0.1 M triethanolamine pH 7.3:
MgCl2
NADP+
Icd/IcdS104P
100 mM triethanolamine
pH 7.3
1.7 mM
440 µM
1-2 µg/200 µg
Ad 900 µl
This mixture was pre-warmed at 37°C for 15min. To ensure a constant temperature of 37°C during
the whole measurement the Ultrospec photometer was placed in the 37°C incubator room. The
reaction was started by addition of 6.7 mM isocitrate and the increase in A340nm caused by the
formation of NADPH was followed for 5mins. A sample containing all components except the enzyme
served as blank control and was handled like the enzyme containing samples. The obtained values
were plotted against the time and the slope of the linear part of the curve was used to calculate the
enzyme turnover/min.
The activity of Icd per milligram protein was calculated with the following formula (compare to
(Bisswanger, 2004)
=U/mg
εmM(NADPH): 6.3 mM-1 cm-1, L (length of the cuvette): 1 cm,
- 39 -
Material and Methods
4.5.5.12 Mdh activity assay
To determine the activity of Mdh the protocol of Luo (Luo et al., 2006) was used. All measurements
were carried out at 37°C in the incubator room. One sample contained the following components:
Rotenon
BSA
PMS (Phenazine methosulfate)
INT (p-Iodonitrotetrazolium-Violet)
NAD+
Mdh
0.1 M KH2PO4/K2HPO4 buffer pH 7.8
3 µM
1 mg/ml
0.2 mM
0.6 mM
0.5 mM
100 ng
Ad 925 µl
Stock solutions of BSA, PMS and INT were dissolved in Millipore water, Rotenon in 100 %(v/v)
ethanol (Kuznetsov et al., 2008) and NAD+ and malate in 0.1 M KH2PO4/K2HPO4 buffer pH 7.8. Except
of BSA and Rotenon, all components were always prepared freshly before use. As PMS is highly light
sensitive, the samples were protected against light all the time. After thoroughly mixing the
components were incubated for exactly 10min at 37°C and the measurement started immediately
afterwards by addition of 15 mM malate. As blank control a sample containing everything except the
enzyme was measured as well. The increase in A500nm was followed for three minutes. A500nm was
plotted against the time and according to the slope of the linear part of the curve the turnover/min
was calculated.
=U/mg
εmM cm(INT): 12.4 mM-1 cm-1, L (length of the cuvette): 1 cm
All measurements were carried out with triplicates with at least two biological replicates.
4.5.5.13 CitZ activity assay
The activity of CitZ was determined with the commercial “Citrate Synthase Assay Kit” from SigmaAldrich according to the manufacturers’ manual. The analyzed samples contained 1-10 µg purified
CitZ(His)6.
- 40 -
Material and Methods
4.5.6 Computer programs, databases and online services
The computer programs, databases and online services used during this work are listed in the two
tables below.
4.5.6.1 Computer programs
Table 1.1: Computer programs
Program
Adobe® Photoshop® CS4
BIACORE X Software 2.2
BIAEVALUTION software 4.0
ChemBioDraw Ultra Version 12.0.2.1076
Clone manager 9 professional edition
DNASTAR SeqMan™ II
Endnote X.4.0.2
Microsoft® Office Home & Student 2010
Sigma Plot 9.0
Swiss Pdb viewer Version 4.0.4
Vector NTI Suite 8.0
Application
Image processing
SPR analysis
Evaluation and processing of SPR data, calculation of
kinetic constants
Drawing of chemical formulas
Processing of DNA sequence data, primer design and
administration of primer and vector database
Sequence alignment editor (ABI-files)
Generation of literature database
Generation of text documents, tables, diagrams and
presentations
Generation of scientific diagrams
Analysis of protein structures
Processing of DNA sequence data, primer design and
administration of primer and vector database
4.5.6.2 Databases and online services
Table 1.2: Online services and databases
URL
http://brenda-enzymes.org
http://dbtbs.hgc.jp/
http://genodb.pasteur.fr
http://rzblx1.uniregensburg.de/ezeit/
http://string.embl.de/
Provider
Technical university of Braunschweig
Human Genome Center, Inst. Med. Sci.,
Univ. Tokyo;
Institute Pasteur, Paris, France
University library of Regensburg
Centre of protein research, University of
Copenhagen, Denmark; Swiss institute
of Bioinformatics, Lausanne
Switzerland, Biotechnology Center, TU
Dresden, University of Zurich,
Switzerland
- 41 -
Application
Analysis of enzymes
Research in the genome
of B. subtilis
Genome database of B.
subtilis and E. coli
Research of literature
Analysis of protein
interaction networks
Material and Methods
URL
http://www.ncbi.nlm.nih.gov/
Provider
National Institutes of Health, USA
http://www.rcsb.org/
Rutgers, the State University of New
Jersey, San Diego Supercomputer
Center (SDSC) and Skaggs School of
Pharmacy and Pharmaceutical Sciences,
USA
The University of Manchester, HITS
gGmbH
https://seek.sysmo-db.org/
- 42 -
Application
Research of literature,
BLAST server, DNA and
protein sequences
Research of protein
structures
Database of the SysMO
consortium
Results
5 Results
5.1 Metabolite
dependent
interaction
of
Isocitrate
dehydrogenase with Malate dehydrogenase of Bacillus
subtilis
The interaction of the enzymes of the TCA cycle enables the cell to transport the metabolites
efficiently from one enzyme to the next without time consuming search of the next interaction
partner (Barnes & Weitzman, 1986; Mitchell et al., 1995; Ovádi & Srere, 1996). In preliminary studies,
the interaction of the malate dehydrogenase Mdh and the isocitrate dehydrogenase Icd were
detected for the first time in B. subtilis by SPINE and Bacterial-Two-Hybrid experiments (Meyer et al.,
2011). The aim of this project was to elucidate the conditions for these interactions in more detail
and see if they are influenced by the educts and products of both enzymes. This was approved by
surface plasmon resonance (SPR) with the proteins alone and the corresponding metabolites. In a
second step the influence on the activity of both proteins by the interaction partner was analyzed.
5.1.1 Purification of Mdh(His)6, Icd(His)6 and IcdS104P(His)6
To purify B. subtilis Icd with a N-terminal His6-tag, the gene was amplified via PCR from chromosomal
B. subtilis DNA with the primers IcdfwBam and IcdrevXho. The PCR product and the overexpression
vector pET28b(+) were cut with the restriction enzymes BamHI and XhoI and after a purification step
ligated with T4 DNA quickligase. The resulting vector was named pWH2410.
The overexpression vectors for Mdh(His)6 (pGP385) and the IcdS104P(His)6-mutant (pGP389) were
obtained from Jörg Stülke/Georg August University Göttingen. The genes were amplified via PCR with
chromosomal DNA as template, cut with the restriction enzymes BamHI and HindIII and ligated with
the vector pWH844 which was ligated with the same enzymes (Pietack et al., 2010).
E. coli BL21 (DE3)/pLysS or E. coli FT1/pLysS were used as overexpression strains. The detailed
procedure concerning overexpression and purification is described in chapter 4.5.5.6. The first
purification step was carried out via Ni2+ affinity chromatography on a NiNTA–column, subsequently
- 43 -
Results
the proteins were transferred via size exclusion chromatography to the HBS-E storage buffer. All
three proteins were purified successfully without any impurities. No degradation bands were visible.
The picture below (Figure 5.1) shows all three proteins after the purification, Icd(His)6 and
IcdS104P(His)6 with 49.7 kDa and Mdh(His)6 with 36.9 kDa.
1
2
3
4
Icd(His)6 : 49.7 kDa
Mdh(His)6 : 36.9 kDa
Figure
5.1:
Purified
Icd(His)6,
IcdS104P(His)6 and Mdh(His)6. This 10 %
SDS-PAGE was loaded with 2 µg of each
protein. The first lane contained the
PeqGold protein marker II, lane 2
Icd(His)6, lane 3 IcdS104P(His)6 and in
lane 4 Mdh(His)6
5.1.2 Interaction of Mdh(His)6 and Icd(His)6
To analyze the interaction of Mdh(His)6 and Icd(His)6 with SPR, 3500 RU of Mdh were coupled to a
CM5 chip via amide coupling in flowcell (FC) 2, as reference cell served the empty FC1. Despite of the
high amount of coupled Mdh(His)6 the titration of 10-70 µM Icd(His)6 caused only a very weak
binding signal which was too low to perform a quantitative analysis of the binding. To test for the
specificity of the signal of the Mdh-Icd interaction 1-30 µM of the Tet-Repressor variant TetR(B), a
protein not available in the B. subtilis cell under normal conditions, were titrated as well. Hereby no
interaction with Mdh(His)6 was detectable (Figure 5.2).
Figure 5.2: Interaction analysis of Mdh(His)6with Icd(His)6 or TetR(B). Sensorgrams from titrations of
Mdh(His)6 with Icd(His)6 (A)or TetR(B)(B) to Mdh(His)6. The sensorgrams correspond to the given
concentrations on the right from the bottom to the top. All sensorgrams were recorded from three biological
replicates. RU: Response Units, Resp. Diff. [RU]: signal difference from FC2 (Mdh(His) 6) and the empty
reference cell FC1.
- 44 -
Results
5.1.3 SPR analysis of the interaction of Icd(His)6 and Mdh(His)6 in the
presence of cofactors and substrates
To explore the influence of the metabolites on the binding of the two enzymes, their educts and
products as well as the reduction equivalents NADP+ or NAD+ and the metal ion cofactor of Icd Mg2+
(Hurley et al., 1991; Singh et al., 2001) were added separately and in combination to the sample. The
same amount of each supplement had to be added to the HBS-EP running buffer as well to reduce
bulk effects as discovered before in similar experimental setups (Seidel et al., 2005). The chosen
amounts of isocitrate, α-ketoglutarate, malate and oxaloacetate as well as NADP+/NADPH and
NAD+/NADH correspond to the known intracellular concentrations of B. subtilis or to those of E. coli,
respectively (Buescher et al., 2012; Chassagnole et al., 2002; Hurwitz & Rosano, 1967; Markuszewski
et al., 2003).
5.1.3.1 SPR analysis of Icd(His)6 binding to Mdh(His)6 in the presence of
isocitrate, α-ketoglutarate, malate and oxaloacetate
To investigate the influence of the four metabolites, subsequent titrations with 20 µM Icd(His)6 were
carried out and the samples contained the following components:
Metabolite
1 mM isocitrate (educt of Icd)
1 mM α-ketoglutarate (product of Icd)
1 mM malate (educt of Mdh)
1 mM oxaloacetate (product of Mdh)
Cofactor
0.5 mM NADP+
0.5 mM NADPH
0.5 mM NAD+
0.5 mM NADH
Metal ion cofactor
5 mM MgCl2
5 mM MgCl2
5 mM MgCl2
5 mM MgCl2
As described in chapter 5.1.3 the HBS-EP running buffer had to be supplemented with the
corresponding metabolite/cofactor mixture to reduce bulk effects (for more details see 4.5.5.10). All
components listed above were injected separately or in double or triple combination together with
20 µM Icd(His)6.
The SPR analysis revealed that neither 1 mM isocitrate nor 0.5 mM NADP+ nor 5 mM Mg2+ alone
changed the binding of Icd(His)6 to Mdh(His)6. Only the triple combination of 1 mM isocitrate,
0.5 mM NADP+ and 5 mM MgCl2 stimulated the binding of Icd(His)6 to Mdh(His)6 and resulted in a
7.5-fold higher signal in an endpoint assay, which is shown in Figure 5.3 A.
- 45 -
Results
The product of Icd, α-ketoglutarate, either alone or together with NADPH and MgCl2, did not alter
the binding to Mdh(His)6 (Figure 5.3 B). Neither did malate or oxaloacetate, the educt and product of
Mdh, alone or in combination with the appropriate reduction equivalents NAD+ or NADH influence
the binding of Icd(His)6 to Mdh(His)6 (Figure 5.3 C/D).
Figure 5.3: SPR analysis of Icd(His)6 binding to Mdh(His)6 with different metabolites and cofactors. The
diagram shows sensorgrams from subsequent injections of 20 µM Icd(His)6 (light green sensorgram) on a
Mdh(His)6 coated CM5-Chip. The running buffer and the samples were supplemented with the metabolite
mixtures written on the right side of the sensorgram, the color of the sensorgram corresponds to the color of
+
the legend. The interaction of the two enzymes is only stimulated by addition of isocitrate, MgCl2 and NADP
+
(A). Neither the combination of α-ketoglutarate and NADPH (B), nor malate/NAD (C), nor oxaloacetate in
combination with NADH did change the binding of Icd(His) 6 to Mdh(His)6. All measurements were reproduced
at least two times. RU: Response Units, Resp. Diff. [RU]: signal difference from FC2 (Mdh(His) 6) and the empty
reference cell FC1.
- 46 -
Results
5.1.3.2 Influence of the enzymatic activity of Icd(His)6 on the binding to Mdh(His)6
If the SPR samples contained besides Icd(His)6 isocitrate, NADP+ and Mg2+ the enzyme was in its
active conformation (Singh et al., 2001) and able to convert its substrate isocitrate to αketoglutarate. This affected the sensorgrams, because, as a consequence, the samples contained
then a mixture of isocitrate/α-ketoglutarate and NADP+/NADPH. This was in contrast to the HBS-EP
running buffer which was supplemented with 1 mM isocitrate, 0.5 mM NADP+ and 5 mM MgCl2. The
sensorgram of an injection of a mixture of 20 µM Icd(His)6, 1 mM isocitrate, 0.5 mM NADP+ and
5 mM MgCl2 in flowcell 1 (red curve, Figure 5.4) resembled more a sensorgram of an injection of
0.1 mM α-ketoglutarate, 50 µM NADPH and 5 mM MgCl2 (black curve, Figure 5.4) than pure HBS-EP
buffer supplemented with 1 mM isocitrate, 0.5 mM NADP+ and 5 mM MgCl2 (blue curve, Figure 5.4).
This was an evidence for the activity of the isocitrate dehydrogenase. Due to this activity of the
enzyme the stimulation effect of isocitrate, Mg2+ and NADP+ on the binding at Mdh(His)6 was reduced
because α-ketoglutarate and NADPH did not cause any stimulation on the binding (compare to
Figure 5.3 B). Therefore, the interaction of Mdh(His)6 and the wildtype protein could not be
quantified.
Figure 5.4: Effect of the activity of Icd on the sensorgram by injection together with isocitrate, MgCl 2 and
+
NADP . This diagram shows flowcell 1 of a CM5 Chip and its reaction to the titration of 20 µM Icd(His)6
+
(red curve) in comparison to pure HBS-EP running buffer with 1mM isocitrate and 0.5mM NADP (blue
curve) and an injection of 0.1mM α-ketoglutarate and 50 µM NADPH (black curve). Due to the activity of
the enzyme the sensorgram looks more like the one of the injection of α-ketoglutarate/NADPH then like
+
the injection of the HBS-EP buffer with 1mM isocitrate and 0.5mM NADP . All measurements were
reproduced at least two times.
- 47 -
Results
5.2 Interaction of Mdh(His)6 and IcdS104P(His)6
In addition to the wildtype protein, the IcdS104P mutant, which carries a proline at position 104
instead of a serine, was analyzed as well. In E. coli the corresponding serine residue 113 is
phosphorylated by AceK, the isocitrate dehydrogenase kinase/phosphatase, which regulates the
activity of the isocitrate dehydrogenase (LaPorte & Koshland, 1982; LaPorte et al., 1985). In B.
subtilis, the phosphorylation of the enzyme was shown in vitro by PrkC. However, if AceK can
phosphorylate the enzyme in vivo as well remained unclear so far (Pietack et al., 2010; Singh et al.,
2002; Zheng & Jia, 2010).
5.2.1 Activity of Icd(His)6 and IcdS104P(His)6
To determine the activity of Icd and the mutant IcdS104P the formation of NADPH was monitored
spectrophotometrically at A340nm for 5min at 37°C as described by Ellis & Goldberg (Ellis & Goldberg,
1971) (Figure 5.5). A sample containing all buffer components without enzyme served as blank
control. The absorption values were plotted against the time and from the linear part of the curve
the activity was calculated. For Icd(His)6 in four independent measurements an activity of
8.7 ± 2.9 U/mg protein was calculated, resulting from activity tests containing only 21.5 nM protein.
To obtain the activity of IcdS104P, 4.3 µM IcdS104P(His)6 were needed for a spectrophotometrically
detectable reaction. This resulted in three independent measurements in an activity of
0.05 ± 0.03 U/mg protein. In comparison to the wildtype enzyme the activity of the IcdS104P mutant
is reduced 174-fold. As the activity of wildtype Icd was problematic during the SPR analysis with Mdh,
this mutant was chosen to further investigate the interaction of the two enzymes.
- 48 -
Results
Figure 5.5: Determination of Icd activity by measuring formation of NADPH. The activity of Icd was measured
spectrophotometrically absorption at 340 nM (A340nm), shown at the y-axis, which corresponds to the formation
of NADPH. At the x-axis the time is shown in seconds (s). All measurements were carried out with triplicates,
the standard deviation is indicated by the black lines above and below the symbols. The black lines indicate the
linear regression of the corresponding data. The meanings of the symbols are indicated in the box above the
diagram.
5.2.2 SPR analysis of IcdS104P(His)6 binding to Mdh(His)6
To figure out the interaction of IcdS104P(His)6 3500 RU Mdh(His)6 were coupled to the CM5 like
stated before (refer to chapters 4.5.5.10 and 5.1.3.1). 10-70 µM IcdS104P(His)6 were titrated
subsequently to chip. In comparison to the wildtype enzyme, the binding signal was stronger which
enabled the quantification of the reaction. This was carried out with the BIAEVALUATION software
version 4.1 as 1:1 Langmuir binding fit. The quantification revealed the following data: an association
rate constant (ka) of 2.0 ± 0.2 x 102 M-1 s-1, a dissociation rate constant (kd) of 1.0 ± 0.07 x 10-3 s-1 and a
resulting dissociation constant (KD) of 5.0 ± 0.1 µM. The χ²-value which represented the average
deviation of the fit from the experimental data was 1.8-4.8.
- 49 -
Results
Figure 5.6: SPR analysis of IcdS104P(His)6 binding to Mdh(His)6. This sensorgram shows a titration of 10-70 µM
IcdS104P(His)6 to Mdh(His)6. The association and dissociation rate constant (ka and kd) and the resulting
dissociation constant (KD) were calculated as 1:1 Langmuir binding fit with BIAEVALUATION software version
4.1. Dotted lines represent the measurements, the bold black lines the best calculated fits for the association
rate constant. The kinetic constants were calculated from measurements with three biological replicates. RU:
response units, Resp. Diff. [RU]: signal difference from FC2 (Mdh(His)6) and the empty reference cell FC1.
5.2.3 SPR analysis of IcdS104P(His)6 binding to Mdh(His)6 in the
presence of isocitrate, α-ketoglutarate, malate and oxaloacetate
As the binding of Icd(His)6 wildtype to Mdh(His)6 was stimulated by 1 mM isocitrate, 0.5 mM NADP+
and 5 mM MgCl2, the same analysis was done for the IcdS104P mutant. The samples were treated as
already described in chapter 5.1.3.1.
The triple combination of 1 mM isocitrate, 0.5 mM NADP+ and 5 mM MgCl2 stimulated the binding of
the IcdS104P mutant to Mdh(His)6 as well. However, 5 mM MgCl2 added to 20 µM IcdS104P(His)6
already caused a doubling of the signal in comparison to the titration with pure 20 µM IcdS104P(His)6
(see Figure 5.7 light blue curve).
As already described for the wildtype strain, the combinations of α-ketoglutarate/NADPH,
malate/NAD+ and oxaloacetate/NADH added to subsequent titrations of 20 µM IcdS104P(His)6 had
no influence on the binding to Mdh(His)6 (Figure 5.7 B, C, D).
- 50 -
Results
Figure 5.7: SPR analysis of IcdS104P(His)6 binding to Mdh(His)6 with different metabolites and cofactors. The
diagram shows sensorgrams from subsequent injections of 20 µM IcdS104P(His)6 (red sensorgram) to Mdh(His)6
coupled to a CM5 chip. The running buffer and the samples were supplemented with the metabolite mixtures
written on the right side of the diagram, the color of the sensorgram corresponds to the color of the legend. The
interaction of the two enzymes is stimulated by addition of 5 mM MgCl2 (light blue sensorgram). The stimulation
+
increases after addition of isocitrate, MgCl2 and NADP to the sample (A). Neither the combination of α+
ketoglutarate and NADPH (B), nor malate/NAD (C), nor oxaloacetate in combination with NADH did change the
binding of Icd(His)6 to Mdh(His)6. All measurements were reproduced at least two times. RU: Response Units,
Resp. Diff. [RU]: signal difference from FC2 (Mdh(His)6) and the empty reference cell FC1.
- 51 -
Results
5.2.4 Quantification of the interaction between IcdS104P(His)6 and
Mdh(His)6 stimulated by isocitrate, NADP+ and MgCl2
The binding of wildtype Icd to Mdh was stimulated by Mg2+, isocitrate and NADP+. However, the
quantification of this interaction by SPR was impeded by the enzymatic activity of Icd. Wildtype Icd
converted isocitrate and NADP+ to α-ketoglutarate and NADPH which resulted in high bulk effects.
IcdS104P(His)6 showed 174-fold reduced enzymatic activity in comparison to the wildtype enzyme
and therefore the supplemented amounts of the cofactors in the sample remained almost constant.
Therefore, the mutated enzyme was used to quantify the interaction with Mdh(His)6 stimulated by
isocitrate, NADP+ and MgCl2 via SPR. The HBS-EP running buffer was supplemented with 1 mM
isocitrate, 0.5 mM NADP+ and 5 mM MgCl2. All measurements were carried out at least three times
with at least two biological replicates.
0.5 to 20 µM IcdS104P(His)6 were titrated subsequently to Mdh(His)6 coupled to the CM5 chip. The
sensorgrams were evaluated by an 1:1 Langmuir binding fit with the BIAEVALUATION software
version 4.1 and revealed the following data: an association rate constant (ka) of 1.7 ± 0.7 x 103 M-1 s-1 ,
a dissociation rate constant (kd) of 2.6 ± 0.6 x 10-4 s-1 and a resulting dissociation constant (KD) of
150 ± 0.3 nM. The average deviation between the fit and experimental data was given as a χ²- value
of 2.3-3.0 in three independent measurements.
Figure 5.8: Quantification of the
interaction between IcdS104P(His)6
and Mdh(His)6 stimulated by
+
isocitrate, NADP and MgCl2. The
diagram shows a titration of 0.520 µM IcdS104P(His)6 to Mdh(His)6
coupled on the CM5 chip. The
running buffer and each sample
were supplemented with 1 mM
+
isocitrate, 0.5 mM NADP and 5 mM
MgCl2 to reduce bulk effects. Dotted
lines represent the subsequent
injections of IcdS104P(His)6, bold
black lines the 1:1 Langmuir binding
fits
calculated
from
BIAEVALUATION, version 4.1. The
kinetic data were calculated from
measurements with two biological
replicates. RU: response units, Resp.
Diff. [RU]: signal difference from FC2
(Mdh(His)6)
and
the
empty
reference cell FC1.
- 52 -
Results
Compared to the interaction without isocitrate, NADP+ and MgCl2, the affinity of IcdS104P mutant to
Mdh(His)6 was therefore 33.3-fold higher (refer to Table 5.1).
Table 5.1: Comparison of the kinetic data obtained from the titration of IcdS104P(His) 6 to Mdh(His)6 in
+
presence and absence of isocitrate, NADP and MgCl2. All data were measured with at least three biological
replicates, the kinetic parameters were obtained by calculation with BIAEVALUATION, version 4.1 as 1:1
Langmuir binding fit.
IcdS104P(His)6
IcdS104P(His)6,
1mM isocitrate, 0.5 mM NADP+, 5 mM MgCl2
Factor (stimulated/not stimulated)
ka [M-1 s-1]
2.0 ± 0.2 x 102
kd [s-1]
1.0 ± 0.07 x 10-3
KD [µM]
5.0 ± 0.1
1.7 ± 0.7 x 103
2.6 ± 0.6x10-4
0.15 ± 0.03
8.5
0.26
33.3
5.3 Mutual influence of Icd and Mdh on their enzymatic
activity
SPR analysis revealed a weak interaction of Mdh with Icd. As their encoding genes mdh and icd are
organized in one operon and therefore they are always co-expressed, this weak interaction might
result from a complex formation in situ nascendi during co-translation of both enzymes (Jin et al.,
1996; Jin & Sonenshein, 1994b). However, the purpose of interaction of Mdh and Icd is not obvious,
because these enzymes do not catalyze subsequent reactions in the TCA cycle. Therefore, Mdh and
Icd might be parts of a higher organized enzyme complex of TCA cycle proteins to transfer the
product of one enzyme directly to the next enzyme. The existence of a so-called metabolon was
analyzed already not only for B. subtilis, but also for E. coli and Pseudomonas aeruginosa (Barnes &
Weitzman, 1986; Meyer et al., 2011; Mitchell et al., 1995). However, even without a bigger complex
of the TCA cycle enzymes, the activities of Mdh and Icd could be influenced by their interaction, as
isocitrate and NADP+, the substrates of Icd, lead to a 33-fold stimulation of the binding to Mdh in SPR
measurements.
First of all, the impact of the interaction on the enzymatic activity of Mdh had to be determined in
vitro alone and in combination with Icd and the mutant IcdS104P. Vice versa the activity of wildtype
Icd and the IcdS104P mutant should be investigated depending on Mdh.
- 53 -
Results
5.3.1 Influence of Icd and IcdS104P on Mdh activity
The conversion of malate to oxaloacetate is the only endergonic reaction during the citrate cycle with
ΔG of +30 kJ/mol (Campel, 2006), and therefore the activity of Mdh was determined using the
coloring agent “p-Iodonitrotetrazolium violet” (INT) according to the protocol of Luo (Luo et al.,
2006). The advantage of this method is the fast transfer of the electrons of NADH immediately after
formation via PMS (phenanzine methosulfate) to INT. This lead to the formation of a red formazan,
which was detected spectrophotometrically (refer to Figure 5.9). As PMS is highly light sensitive, the
samples were protected against light during the whole experimental process. The reference cuvette
contained all components except the enzyme (refer to chapter 4.5.5.12).
Figure 5.9: Comparison of blank control Mdh activity assay to
sample containing Mdh. This picture shows two cuvettes after
an Mdh activity assay according to Luo (Luo et al., 2006). The
cuvette on the left is the blank control containing all
components except the enzyme. The cuvette on the right
contained 3 nM Mdh(His)6 which led to the formation of the
red formazan from “p-iodonitrotetrazolium violet”. This was
quantified spectophotometrically at A500nm.
- Mdh(His)6 + Mdh(His)6
These analyses revealed an enzymatic activity of 98.4 ± 8.2 U/mg protein for pure Mdh(His)6 (Figure
5.10, blue circles), the addition of 43 nM Icd(His)6 decreased the enzymatic activity slighty to
82.3 ± 4.9 U/mg protein (Figure 5.10, dark green boxes). This fits the SPR data, as wildtype Icd
revealed only a weak interaction with Mdh without isocitrate and NADP+. However, as PMS would
transfer the electrons of either NADPH or NADH to INT, an experimental setup containing isocitrate
and NADP+ as substrates of Icd in addition to malate and NAD+ was not possible (Bériault et al.,
2005). As SPR analysis yielded a higher affinity of IcdS104P to Mdh than the wildtype protein even
without stimulation of isocitrate, Mg2+ and NADP+, mixtures of the Icd mutant with Mdh were
analyzed as well. No stimulation effect was detected and 4.3 µM IcdS104P even reduced Mdh activity
to 58.0 ± 13.7 U/mg protein.
- 54 -
Results
In summary the activity of Mdh was hardly influenced by wildtype Icd and even reduced by a factor
of 1.7 by IcdS104P. This correlated with the SPR data, as neither the binding of Icd nor the binding of
IcdS104P to Mdh was stimulated by malate and NAD+.
Figure 5.10: Activity test of Mdh(His)6 with or without Icd(His)6 or IcdS104P(His)6 respectively. This diagram
shows the activity of Mdh determined by following the formation of the red formazan from INT (piodonitrotetrazolium violet) spectophotometrically at 500 nm for 180s. The legend above the diagram shows
the meaning of the symbols. The straight lines represent the linear regression of the corresponding data. The
standard deviation of three independent samples is indicated by the lines above and below of each symbol.
The activity of Mdh was slightly decreased by addition of Icd, the mutant IcdS104P reduced the activity of Mdh
two-fold.
- 55 -
Results
5.3.2 Influence of Mdh on the enzymatic activity of Icd and IcdS104P
The enzymatic activity of Icd was determined by spectrophotometrical detection of formation of
NADPH at A340nm at 37°C. Therefore all components except isocitrate were mixed thoroughly and
after equilibration for 10min at 37°C, the increase of A340nm was recorded for 5min. Finally the activity
of the enzyme was calculated from the slope of the linear part of the curve (refer to chapter
4.5.5.11). Samples containing all components except isocitrate dehydrogenase served as blank
control (Figure 5.11 A&B, black crosses). This assay was highly specific for the activity of Icd, because
for samples with pure Mdh no formation of NADPH was observed (Figure 5.11 A&B, blue circles).
For Icd(His)6 an activity of 8.7 ± 2.9 U/mg protein was determined (Figure 5.11 A, red squares). The
addition of 300 nM Mdh(His)6 doubled the enzymatic activity to 17.3 ± 3.3 U/mg protein (Figure 5.11
A, green unfilled diamonds).
In contrast, the activity of the IcdS104P mutant was not affected by the addition of Mdh(His)6 (Figure
5.11 B, red filled triangles and stars, green boxes and diamonds). This might be due to reduced
flexibility of the active site in the isocitrate binding pocket of the IcdS104P mutant caused by the
fixed N-Cα-angle of proline. Moreover, crystal structures of B. subtilis Icd and the highly homologous
corresponding E. coli isocitrate dehydrogenase revealed that four amino acids, including serine
residue 104 in B. subtilis and the corresponding serine residue 113 in E. coli, anchor isocitrate and
NADP+ at the active site of the enzyme via H-bonds. The weaker fixation might initiate a quick release
of the substrate even without turnover (Gonçalves et al., 2012; Hurley et al., 1991; Singh et al.,
2001). This had probably a higher impact than the only slight stimulation of the activity caused by
Mdh.
In summary, the mixture of isocitrate, NADP+ and MgCl2 did not only stimulate the binding of Icd to
Mdh, but also doubled the activity of wildtype Icd, if Mdh was available.
- 56 -
Results
Figure 5.11: Activity test of Icd(His)6 and IcdS104P(His)6 with or without Mdh(His)6. Two plots of activity test of
Icd (A) and IcdS104P (B) are shown. The legend on the right side of each diagram depicts the contents of the
proteins of the samples. The activity of wildtype Icd (A) doubles after addition of Mdh(His) 6. This is not the case
for the mutant IcdS104P (B). The straight lines represent the linear regression of the corresponding data. As the
linear regression of 4.3 µM IcdS104P and 4.3 µM IcdS104P together with 300 nM Mdh was identical, the line
representing the linear regression of 4.3 µM IcdS104P was dashed. The standard deviation of three independent
samples is indicated by the lines above and below of each symbol.
- 57 -
Results
5.4 Interaction analysis of Malate dehydrogenase and Citrate
synthase
Mdh catalyzes the final reaction step of the TCA cycle, the oxidation of malate to oxaloacetate.
Interestingly, this reaction is highly endergonic and therefore, it is driven by the subsequent
exergonic conversion of oxaloacetate to citrate (Miller & Smith-Magowan, 1990; Ochoa, 1955). This
reaction is catalyzed by CitZ. The encoding genes citZ and mdh are always co-expressed, because
they are organized in an operon together with icd (Jin et al., 1996; Jin & Sonenshein, 1996). The in
vivo interaction of B. subtilis Mdh and CitZ was detected for the first time by SPINE experiments
(Meyer et al., 2011) and it was investigated in vitro by SPR measurements in this study.
5.4.1 Purification of CitZ(His)6
To purify CitZ(His)6, the promotorless citZ gene was amplified from chromosomal B. subtilis 168 DNA
via PCR with the oligonucleotides citZfwNhe2 and citZrevBam. The PCR product was cloned in the
vector pET-28b(+) via the restriction sites NheI and BamHI. The resulting vector was named
pWH2421. Overexpression tests revealed formation of CitZ(His)6 inclusion bodies, if the cells were
grown at 37°C. To overcome this problem the cells were grown at 37°C to an OD600 of 0.5 and were
then shifted to 20°C. The overexpression was induced by addition of 1 mM IPTG and the cells were
grown for 18h overnight. CitZ(His)6 was purified via a 5 ml NiNTA column, the second purification
step transferred the protein to the HBS-E storage buffer via size exclusion chromatography. The
purification was successful and revealed a pure protein with 43.8 kDa without any degradation (see
Figure 5.12).
1
2
3
4
5
6
7 8 9 10 11 12 13 14 15
43.8 kDa
Figure 5.12: Analytical gel electrophoresis (10 % SDS PAGE) of 15 µl samples of His6-tagged CitZ after size
exclusion chromatography. Lane 1 contains the PeqGold protein standard, lane 2 the soluble fraction of the
pre-induction sample, lane 3 a control sample taken 18h after induction of overexpression. Lanes 7-15 contain
pure CitZ(His)6 after NiNTA and size exclusion chromatography. The molecular weight of the protein is 43.8 kDa.
- 58 -
Results
5.4.2 SPR analysis of CitZ(His)6 binding to Mdh(His)6
To analyze the interaction of CitZ(His)6 and Mdh(His)6, 3000 RU purified Mdh(His)6 were coupled to
flowcell 2 of a CM5-chip, the empty flowcell 1 served as reference cell. Rising concentrations of
CitZ(His)6 were titrated subsequently to Mdh at a flowrate of 20 µl/min. CitZ(His)6 precipitated at
concentrations above 35 µM, therefore it was not possible to analyze interaction with more than
14 µM CitZ(His)6. Three independent measurements revealed no binding of CitZ(His)6 to Mdh(His)6
(see Figure 5.13).
Figure 5.13: SPR analysis of Mdh(His)6 and CitZ(His)6. Sensorgrams from titrations of CitZ(His) 6 to Mdh(His)6.
The analyzed CitZ(His)6 concentrations are depicted at the right side of the diagram. All measurements were
reproduced three times with two biological replicates. RU: Response Units, Resp. Diff. [RU]: signal difference
from FC2 (Mdh(His)6) and the empty reference cell FC1.
5.4.3 SPR-analysis of CitZ(His)6 and Mdh(His)6 interaction in the
presence of malate and oxaloacetate
To explore the impact of the substrates of Mdh on the Mdh-CitZ interaction, 5-10 µM CitZ(His)6 were
titrated to Mdh(His)6 with various oxaloacetate and malate concentrations. The HBS-EP running
buffer was supplemented with the same amount of oxaloacetate and malate to reduce bulk effects.
Neither the addition of malate, nor the addition of oxaloacetate did stimulate the binding of CitZ to
Mdh. A weak SPR signal was detected after the injection of pure NADH. This signal did not change, if
mixtures of CitZ(His)6, oxaloacetate and NADH were injected (refer to Figure 5.14).
- 59 -
Results
Figure 5.14: SPR analysis of the interaction between Mdh(His) 6 and CitZ(His)6 with different substrates and
cofactors. The diagram shows sensorgrams from subsequent injections of 5-10 µM CitZ(His)6 (black sensorgram) to
Mdh(His)6 coupled to a CM5 chip. The running buffer and the samples were supplemented with the depicted
oxaloacetate and malate concentrations written on the right side of the diagram, the color of the sensorgram
corresponds to the color of the legend. Neither pure oxaloacetate (A), nor oxaloacetate and NADH (B), nor malate
did influence the binding of CitZ(His) 6 to Mdh(His)6. All measurements were reproduced two times with two
biological replicates. RU: Response Units, Resp. Diff. [RU]: signal difference from FC2 (Mdh(His) 6) and the empty
reference cell FC1.
Neither another coupling method of Mdh to the CM5 chip nor the usage of Strep-tagged CitZ instead
of His-tagged revealed any binding between the two enzymes. In summary, it was not possible to
detect any interaction of these enzymes by SPR so far.
- 60 -
Results
5.5 Interaction of various cre-elements with the CcpAHPrSer46P complex
The central carbon and nitrogen metabolism, e.g. parts of the TCA cycle, carbon catabolite regulation
overflow metabolism and amino acid synthesis in B. subtilis is regulated by the global regulator CcpA
(Fujita, 2009; Henkin, 1996; Sonenshein, 2007). In complex with its coeffector HPrSer46P it is able to
recognize its binding sites, catabolite responsive elements (cre), 14bp long sequences with a highly
degenerate sequence and only very small conserved parts, e.g. the central CG pair (Fujita, 2009;
Hueck et al., 1994; Marciniak et al., 2012; Miwa et al., 2000; Weickert & Chambliss, 1990). In this
study, the binding of the CcpA-HPrSer46P complex to various cre-elements was analyzed and
quantified in vitro via SPR to see if these highly degenerate sequences are bound with different
affinities as this could represent an additional regulatory mechanism. This project was accompanied
by the crystallization of CcpA-HPrSer46P in complex with different cre-elements (Schumacher et al.,
2011).
5.5.1 Purification of CcpA(His)6 and HPrSer46P
5.5.1.1 Purification of CcpA(His)6
To purify CcpA(His)6, E. coli FT1/pLys cells containing pWH653 were grown, induced and harvested
like described earlier. The protein was purified in two steps: The first step was carried out on a 5 ml
NiNTA column to purify via the Histag. CcpA(His)6 containing fractions were condensed to 5 ml and
the protein was purified once again via size exclusion chromatography with a G200 column. This
transferred the protein to the HBS-E storage buffer. After condensing the protein to the desired
concentration, it was either stored at 4°C for up to four weeks or adjusted to 50 % (v/v) glycerol for
long time storage at -20°C. Purified CcpA(His)6 was analyzed via SDS-PAGE (Figure 5.15 A).
- 61 -
Results
5.5.1.2 Purification of HPrSer46P
Purification of HPrSer46P started with the overexpression of E. coli FT1/pLys pWH466 (ptsH). After
rupturing the cells by sonication and removal of the cell debris, as a first purification step the heat
instable proteins were removed by heating the samples to 70°C for 20min. HPr was phosphorylated
at serine residue 46 in vitro by the HPr kinase cell extract and the protein was purified via anion
exchange chromatography on a QFF-sepharose column. HPrSer46P containing fractions were
collected and condensed to a maximal volume of 5 ml and further purified via size exclusion
chromatography with a G75 column to transfer the protein to the HBS-E storage buffer. Purified
HPrSer46P was loaded on a 10 % native PAA gel in comparison to unphosphorylated HPr. HPrSer46
was running farther as HPr in the gel as the negative charge is higher (see Figure 5.15 B). Purified
HPrSer46P was condensed to the desired concentration and then stored at 4°C for approximately 8
weeks (refer to chapter 4.5.5.8).
Figure 5.15: Purified CcpA(His)6 and HPrSer46P. (A) 10 % SDS PAGE of CcpA(His)6, 0.5 and 1 µg were loaded in
lane 2 and 3. As control the Peqlab protein standard II is loaded in lane 1. (B) To investigate the success of the
in vitro phosphorylation at serine residue 46, HPrSer46P was loaded on a 10 % native polyacrylamide gel. As
control served unphosphorylated HPr in lane 1, lanes 2-4 contain 20, 2 and 1 µg of HPrSer46P which is running
farther in the native PAGE due to the higher negative charge of the protein.
- 62 -
Results
5.5.2 Qualitative and quantitative analysis of CcpA coeffector
complexes interacting with various cre-elements
5.5.2.1 Selection and preparation of the analyzed cre-elements
The analyzed cre-elements should represent a broad range of genes whose expression is typically
activated or repressed via CcpA. The cre2 element of ackA was chosen because the expression of
ackA is activated by CcpA during exponential growth (Grundy et al., 1993; Turinsky et al., 1998;
Wünsche, 2012). Representatives of genes, whose transcription is repressed by CcpA, are xynP, xylA
and gntR. XynP and xylA encode proteins for uptake and utilization of xylose and their transcription is
only regulated by one cre-element (Galinier et al., 1999; Kraus et al., 1994). However, gntR encoding
the repressor of the gntRKPZ operon, has besides the selected gntR-credown an additional HPrSer46P
independent cre-site (Fujita et al., 1995; Miwa et al., 1997). The synthetic cre-element syn-cre was
created for the first crystallization experiment of Bacillus megaterium CcpA and served as a linker
between B. megaterium and B. subtilis in crystallization and SPR (Schumacher et al., 2004;
Schumacher et al., 2011). The sequences of all selected cre-elements are shown in Table 5.2.
Table 5.2: Sequence of the cre-elements chosen for the binding analysis of the CcpA-HPrSer46P complex. The
highlighted red letters represent the parts of the consensus sequences (Hueck et al., 1994; Miwa & Fujita,
2001; Miwa et al., 2000; Weickert & Chambliss, 1989). Syn-cre is short for synthetic cre-site which enabled the
first crystallization of CcpA/HPrSer46P of Bacillus megaterium in complex with a cre-element (Schumacher et
al., 2004).
cre- element
ackA-cre2
gntR-credown
syn-cre
xylA-cre
xynP-cre
Sequence
T
T
C
T
T
T
T
T
T
T
G
G
G
G
G
T
A
T
G
A
A
A
T
A
A
A
A
A
A
A
G
G
G
G
G
C
C
C
C
C
G
G
G
G
G
T
G
C
C
C
T
T
T
A
T
A
A
T
A
T
T
C
T
A
T
C
C
C
C
T
A
A
A G
A
A
The complementary strands of the selected DNA fragments were ordered as separate forward and
backward oligonucleotides. Equal amounts of both oligonucleotides were mixed and hybridized via
heating up and carefully cooling down around the melting point several times in a PCR thermo cycler
(for more details refer to chapter 4.5.4.1). The success of the hybridization finally was checked on a
10 % polyacrylamide gel in comparison to the single-stranded non hybridized DNA oligonucleotides
(refer to Figure 5.16).
- 63 -
Results
1
2
3
4
26 bps
Figure 5.16: Hybridization of syn-cre. The 26nt long oligonucleotides were analyzed on a 10 % polyacrylamide
gel. Hereby as controls besides the Peqlab ultra low range DNA standard in lane 1, the single stranded forward
and backward oligonucleotides were loaded in lanes 2 and 3. The successfully hybridized samples are shown in
lanes 4 and 5.
5.5.2.2 Qualitative analysis of CcpA-HPrSer46P binding to xylA-cre
To analyze the binding of the CcpA-HPrSer46P heterotetramer to xylA-cre via SPR, approximately
4000 RU Neutravidin – a streptavidin analogue – were coupled on an activated CM5 Chip in both
flowcells. As the DNA of the forward oligonucleotide was biotinylated at the 5’ end, it was now
possible to couple the DNA to the Neutravidin-coated chip surface. 100 RU of xylA-cre DNA was
coupled in FC2, as reference served an unspecific 26nt DNA coupled in FC1 (Horstmann, 2006;
Horstmann et al., 2007; Schumacher et al., 2011). Flowrate tests revealed a no mass transport at a
flowrate of 40 µl/min, hence this flowrate was used for all measurements. Titrations of 10 nM
CcpA(His)6 and 1-75 µM HPrSer46P to xylA-cre revealed that rising concentrations of HPrSer46P
stimulated the binding of CcpA(His)6 to the cre-element. Saturation was reached at 50 µM HPrSer46P
like seen before for xylA-cre of B. megaterium (Seidel et al., 2005) (refer to Figure 5.17).
- 64 -
Results
Figure 5.17: Association of the CcpA(His)6/xylA-cre complex depending on the HPrSer46P concentration. This
diagram shows a titration of 10nM CcpA(His)6 and rising HPrSer46P concentrations to xylA cre. The HPrSer46P
concentrations are written on the right side of the diagram. All measurements were reproduced at least two
times. RU: Response Units, Resp. Diff. [RU]: signal difference from FC2 (xylA-cre) and an unspecific
oligonucleotide coupled to the reference cell FC1.
5.5.2.3 Quantification of the CcpA HPrSer46P xylA-cre interaction
The dissociation of the CcpA-HPrSer46P-cre complex is very fast due to the fast dissociation of the
CcpA-HPrSer46P complex. Therefore, the quantification of the interaction of the whole complex with
the cre was only possible, if CcpA was saturated with HPrSer46P all the time (Seidel et al., 2005). As
xylA-cre was saturated at 50 µM HPrSer46P, this amount was added to each sample and to the HBSEP running buffer as well. Subsequently, rising amounts of CcpA(His)6 were titrated to the creelement, afterwards the dissociation of the CcpA-HPrSer46P complex was induced by injection of
pure HBS-EP buffer.
The obtained sensorgrams were evaluated and fitted by the BIAEVALUATION software version 4.1
with the 1:1 Langmuir binding model with data from three independent measurements. It was
assumed, that one CcpA-HPrSer46P complex binds to one cre-element. The quantification revealed
an association rate constant (ka) of 1.1 ± 0.3 x 106 M-1s-1, a dissociation rate constant (kd) of
3.6 ± 1.5 x 10-3s-1 and a resulting dissociation constant KD of 3.3 ± 0.5 nM. The average deviation of
the calculated curves from the real experimental sensorgrams was given by the χ²-value of 0.5 – 2.1
(see Figure 5.18).
- 65 -
Results
Figure 5.18: Quantification of CcpA-HPrSer46P complexes interacting with xylA-cre. The two diagrams show
sensorgrams of titrations with 1-40 nM CcpA(His)6 and 50 µM HPrSer46P to xylA-cre. The HBS-EP running buffer
was supplemented with 50 µM HPrSer46P as well. Dashed lines represent the experimental data, bold black
lines the calculated 1:1 Langmuir binding fits. Association rate constant (A) and dissociation rate constant (B)
were calculated separately from the same sensorgram. The measurements were reproduced with two
biological replicates. RU: Response Units, Resp. Diff. [RU]: signal difference from FC2 (xylA-cre) and an
unspecific oligonucleotide coupled to the reference cell FC1.
5.5.2.4 Quantification of CcpA HPrSer46P complexes interacting with xynP-cre,
ackA-cre2, gntR-credown and syn-cre
The interaction of the CcpA HPrSer46P complex with xynP-cre, ackA-cre2, gntR-credown and syn-cre
was analyzed like described in the previous chapter. The qualitative measurement with 10 nM
CcpA(His)6 and titrations of 1-100 µM HPrSer46P were used to determine the HPrSer46P amount that
saturated the cre-element. The running buffer and every sample were then supplemented with the
determined amount of HPrSer46P, which were 50 µM HPrSer46P for all cre-elements except gntRcredown. For this cre-element the saturating concentration of HPrSer46P was determined at 75°µM.
The rate constants were obtained from titrations of 1-100 nM CcpA(His)6 to the cre-elements
coupled on the CM5-chip. AckA-cre2, the synthetic cre and gntR-credown were saturated with 100 nM
CcpA(His)6, in contrast, only 30 nM CcpA(His)6 were sufficient to saturate xynP-cre (see Figure 5.19).
- 66 -
Results
Figure 5.19: Kinetic analysis of CcpA-HPrSer46P interaction with various cre-elements via SPR. These
diagrams show titrations of 1-100 nM of CcpA(His)6 to ackA-cre2 (A), syn-cre (B), gntR-credown (C) and xynP-cre
(D). All samples and the HBS-EP running buffer were supplemented with 50 µM HPrSer46P, in the case of gntRcredown 75 µM HPrSer46P were used. The sensorgrams were obtained from SPR measurements with samples
containing the CcpA(His)6 concentrations listed at the right side of each diagram. Dotted lines represent the
real experimental data, bold black lines the calculated 1:1 Langmuir binding fits calculated by BIAEVALUATION,
version 4.1. All measurements were reproduced at least three times with two biological replicates. RU:
Response Units, Resp. Diff. [RU]: signal difference from FC2 (cre) and an unspecific oligonucleotide coupled to
the reference cell FC1.
- 67 -
Results
The resulting kinetic data from the 1:1 Langmuir binding fit with the corresponding χ2-values which
indicate the average deviation of the experimental data and the fits were given in Table 5.3.
Table 5.3: Kinetic data obtained from SPR measurements validating the interaction of CcpA-HPrSer46P with
different cre-elements. ka: association rate constant, kd: dissociation rate constant, KD: dissociation constant,
χ²: deviation between experimental data and calculated fits.
ackA-cre2
gnt-credown
syn-cre
xylA-cre
xynP-cre
ka [M-1s-1]
6.0 ± 1.9 x 105
6.0 ± 1.7 x 105
3.2 ± 0.6 x 105
1.1 ± 0.3 x 106
5.2 ± 1.0 x 106
kd [s-1]
9.5 ± 1.0 x 10-4
1.8 ± 0.3 x 10-3
1.2 ± 0.2 x 10-3
3.6 ± 1.5 x 10-3
1.2 ± 0.2 x 10-3
KD [nM]
1.6 ± 0.4
3.0 ± 0.4
3.8 ± 0.1
3.3 ± 0.5
0.2 ± 0.1
χ2
3.5-4.4
3.4-5.2
5.8
0.5-2.1
2.9-5.8
The kinetics of the interaction of CcpA-HPrSer46P with different cre-elements are very similar except
for the interaction with xynP-cre. In this case, the formation of the protein-DNA complex was up to
16.5 times faster and as a consequence, the KD-value was up to 19 times lower (compare to Figure
5.20).
Figure 5.20: Comparison of the ka- and KD-values obtained from the interaction analysis of CcpAHPrSer46P with various cre-elements. These graphics visualizes the differences of the association rate
constants (A) and the resulting dissociation constants (B) obtained from titrations of CcpA-HPrSer46P to
various cre-elements. The standard deviation is represented for ea The highest affinity of CcpA-HPrSer46P
to xynP-cre is caused by an up to 16.5-fold faster association of the complex.
- 68 -
Discussion
6 Discussion
6.1 Indications for the formation of a TCA cycle metabolon
The existence of a citrate cycle metabolon, a “supramolecular complex of sequential enzymes and
structural elements”, was proposed already in the 1980s (Srere, 1985). Mainly, four distinct methods
were used to prove the existence of such a multi-enzyme complex: Analysis of crude lysates of total
rat liver mitochondria (Robinson et al., 1987; Robinson & Srere, 1985), theoretical calculations and
bioinformatics (Elcock & McCammon, 1996; Lyubarev & Kurganov, 1989; Tompa et al., 1987a; Vélot
et al., 1997), in vivo analysis via FRAP, SPINE and bacterial-two-hybrid experiments (Haggie &
Verkman, 2002; Meyer et al., 2011) and protein-protein affinity gelelectrophoresis and analytical size
exclusion chromatography with purified proteins (Beeckmans & Kanarek, 1981; Beeckmans et al.,
1989; Datta et al., 1985; Morgunov & Srere, 1998). The interactions of some particular enzymes have
been examined so far, e.g. between malate dehydrogenase and citrate synthase in mitochondria of
Saccharomyces cerevisiae or pig heart (Grandier-Vazeille et al., 2001; Lindbladh et al., 1994;
Mattlasson et al., 1974; Morgunov & Srere, 1998), pig heart α-ketoglutarate dehydrogenase and
succinate thiokinase (Porpaczy et al., 1983) or E. coli aconitase and isocitrate dehydrogenase
(Tsuchiya et al., 2008). Moreover, the interaction between mitochondrial malate dehydrogenase and
citrate synthase from pig heart has been quantified already (Jameson & Seifried, 1999; Tompa et al.,
1987b). However, none of these studies reported an influence of the substrates together with the
corresponding cofactors on the interactions of TCA cycle proteins.
In this study, the interaction of B. subtilis malate dehydrogenase Mdh and isocitrate dehydrogenase
Icd was characterized in vitro via SPR because this technique allows not only the visualization and
precise kinetic analyses of protein interactions in real time but also the analysis of protein-protein
interactions with additional possible interactants like substrates or cofactors (Liedberg et al., 1995;
Mol & Fischer, 2010; Safina, 2012). Initially, the interaction between Mdh and Icd was analyzed
without any substrates and cofactors. These data revealed only a very weak interaction of the two
enzymes, a complex probably formed in situ nascendi caused by co-expression of the two enzymes as
their encoding genes mdh and icd are organized in one operon (Jin et al., 1996; Jin & Sonenshein,
1994b). As this interaction was so weak, an additional stimulation appeared to be reasonable. The
influence of the substrates and coeffectors on the formation of a metabolon has already been
postulated in literature (McKenna, 2011; Ovádi & Srere, 1996). However, it has never been detected
experimentally. Therefore, in this study, the interaction of Icd and Mdh was analyzed in the presence
- 69 -
Discussion
of their substrates and cofactors. Only isocitrate, the educt of Icd, in combination with the
corresponding cofactors NADP+ and Mg2+, stimulated the formation of an Mdh-Icd complex. Single
metabolites without the corresponding cofactors or combinations of malate and NAD+, oxaloacetate
and NADH and α-ketoglutarate and NADPH, did not influence the interaction. This analysis
demonstrated the Mdh-Icd complex for the first time in vitro and, additionally, the metabolic triggers
of this complex formation. A more detailed view of this interaction was obtained by the kinetic
analysis. Kinetic constants were not obtained from the interaction without any supplements, since
the interactions were too weak to perform a valid evaluation. The kinetic analysis in the presence of
isocitrate, NADP+ and Mg2+ turned out to be difficult as well, because Icd converted isocitrate and
NADP+ to α-ketoglutarate and NADPH even during the short time scale of a sensorgram. This
conversion was also visible in SPR, as these sensorgrams indicated almost the same bulk effects like
sensorgrams obtained from pure α-ketoglutarate/NADPH injections. In contrast to wildtype Icd,
measurements with the mutant IcdS104P indicated almost no bulk effect. This is in good agreement
with enzymatic activity assays, as this mutant is 174-fold less active in comparison to the wildtype
enzyme. This might be due to a reduced flexibility of the active site as serine 104 is exchanged to
proline and to an involvement of S104 in substrate binding. In E. coli, the corresponding residue
serine 113 is involved in the binding of isocitrate and its orientation towards NADP +. Additionally, it is
responsible for the substrate specificity of Icd, e.g. IcdS113E mutants recognize isopropylmalate as
substrate. However, there has been no indication so far, that serine 113 is directly involved in
catalysis (Dean & Koshland, 1993; Doyle et al., 2001; Doyle et al., 2000; Gonçalves et al., 2012).
IcdS104P bound Mdh with a higher affinity than wildtype Icd, so the proline mutation might fix the
substrate bound conformation which favors the interaction with Mdh. The quantification of their
interaction revealed a high dissociation constant (KD) with 5.0 ± 0.1 µM. The binding of the IcdS104P
mutant to Mdh was also stimulated by isocitrate, Mg2+ and NADP+. However, due to the reduced
enzymatic activity, the amounts of isocitrate and NADP+ remained almost constant which enabled
the kinetic analysis of the stimulated interaction between Mdh and Icd for the first time. The
resulting KD value was 150 ± 0.3 nM and was 33.3-fold lower than the non-stimulated interaction.
Interestingly, the dissociation rate constant (kd) was 3.8-fold slower if the substrates of Icd were
available. This indicates a stabilizing effect of the metabolites on the complex. Isocitrate, NADP+ and
Mg2+ stimulate the association of the Mdh-IcdS104P complex and as a consequence, the association
rate constant (ka) is 8.5-fold higher in comparison to the interaction without any metabolites. As the
interaction between wildtype Icd and Mdh without isocitrate, NADP+ and Mg2+ is weaker, an even
higher stimulation effect caused by the substrates is likely. Interestingly, recent studies revealed the
kinetics of the interactions between the glycolytic enzymes phosphofructokinase (PfkA) and enolase
(Eno) in B. subtilis (Newman et al., 2012). These two enzymes form a supramolecular complex
- 70 -
Discussion
together with some enzymes of the RNA degradasome (Commichau et al., 2009; Lehnik-Habrink et
al., 2010; Newman et al., 2011; Newman et al., 2012). In comparison to Mdh-Icd interaction, the
complex formation between PfkA and Eno is 10-fold faster even without any stimulation of
metabolites. As a consequence, the KD value is 3.8-fold lower with only 40 nM. However, the
influences of the metabolites on this interaction have not been investigated yet (Newman et al.,
2012).
Stimulation on metabolon formation has already been described for the E. coli and Salmonella
typhimurium tryptophan synthase. The two enzymes α2 and β2 synthesize L-tryptophan and are
connected via a tunnel structure which the intermediates have to pass during the synthesis. Similar
to the Mdh-Icd complex, the binding between α2- and β2- subunit is strongly influenced by the
intermediates of tryptophan synthesis. Structural analysis revealed a conformational change of the
two enzymes, as soon as the starter molecule 3-indole-D-glycerol 3’ phosphate (IGP) is bound to its
binding pocket. The enzyme complex enters the closed conformation which allows the synthesis of Ltryptophan. Nearly every intermediate of the biosynthesis causes a different conformation of the
complex of the two enzymes (Dunn, 2012; Dunn et al., 1990; Hyde et al., 1988). Another example is
the catabolism of branched-chain amino acids (BCAA) in human mitochondria. The branched-chain
aminotransferase (hBCATm) did not only interact with the E1-part of the branched-chain α-keto acid
dehydrogenase complex (BCKD), moreover, the interaction led to 5.9-fold increase of the kcat value of
E1 (Islam et al., 2007). In contrast to all the examples above, the stimulation of the interaction
between Mdh and Icd/IcdS104P in the presence of the substrates of Icd was unexpected as the two
enzymes do not catalyze subsequent reactions in the TCA cycle. Moreover, the enzymatic activity of
Icd doubled, if Mdh was available. In contrast to wildtype Icd, Mdh had no influence on the
enzymatic activity of IcdS104P. However, the fixed N-Cα angle of proline might obstruct
conformational changes during the formation of α-ketoglutarate and therefore, Mdh does not affect
the enzymatic activity of the IcdS104P mutant. In contrast, the enzymatic activity of Mdh is not
affected by Icd. This would imply an accumulation of intracellular α-ketoglutarate, if its increased
formation would only serve catabolism. Interestingly, the products of both Mdh and Icd serve as
precursor molecules for amino acid synthesis: on the one hand, α-ketoglutarate is the precursor
molecule for glutamate, glutamine, arginine and proline (Baumberg & Klingel, 1993; Brill et al., 2011;
Gunka & Commichau, 2012; O'Reilly & Devine, 1994; Utagawa, 2004). On the other hand,
oxaloacetate is needed for aspartate, asparagine, lysine, methionine and threonine biosynthesis (see
Figure 6.1) (Belitsky, 2002; Parsot, 1986; Paulus, 1993; Rodionov et al., 2003; Wu et al., 2011). The
metabolite α-ketoglutarate serves as linker between carbon and nitrogen metabolism because it
provides the carbon backbone of de novo synthesized glutamate and glutamine (Desphande et al.,
1980; Sonenshein, 2007). As the presence of Mdh doubles the enzymatic activity of Icd, this
- 71 -
Discussion
interaction might stimulate the de novo synthesis of glutamate which plays a major role in nitrogen
metabolism. In B. subtilis, in at least 37 transamination reactions glutamate serves as donor of the
amino group (Oh et al., 2007). During the exponential growth phase, flux analysis revealed that half
of the intracellular α-ketoglutarate is used for glutamate synthesis and as a consequence the
intracellular amounts of glutamate are high with 40-70 mM (Buescher et al., 2012; Rühl et al., 2012).
Similar data were obtained from E. coli (Bennett et al., 2009). The formation of the Mdh-Icd complex
depends on the availability of isocitrate and NADP+ in addition to Mg2+ as metal ion cofactor of Icd.
The intracellular amounts of isocitrate and NADP+ are high as long as favorable carbon sources like
glucose are available (Dauner et al., 2001a; Dauner et al., 2001b; Kleijn et al., 2010; Rühl et al., 2012;
Tännler et al., 2008). However, in the stationary phase, the analysis of the NADPH/NADP+ ratio of B.
megaterium revealed an increase of the intracellular NADPH amount because glucose limitation
leads to low NADPH consumption (Rühl et al., 2012; Sauer et al., 1997; Setlow & Setlow, 1977;
Tännler et al., 2008). Additionally, in stationary phase under nitrogen starving conditions, flux
analysis revealed no metabolic fluxes to serve amino acid anabolism. Likewise, in contrast to
exponential growth, the flux through the TCA cycle is reduced 2-3 times in stationary phase (Rühl et
al., 2012). In summary, these data suggest, that the interaction of Mdh with Icd and also the
increased α-ketoglutarate formation is stimulated by substrate and cofactor of Icd in response to
high carbon and NADP+ supply to enhance glutamate synthesis.
In contrast to the unexpected interaction between Mdh and Icd, the interaction between Mdh and
CitZ was presumed for quite some time because oxidation of malate to oxaloacetate is highly
endergonic (Miller & Smith-Magowan, 1990; Ochoa, 1955). The reaction is driven by the fast
conversion of oxaloacetate by CitZ and this demands a closed proximity of both enzymes.
Surprisingly, in B. subtilis, no interaction between Mdh and the subsequent enzyme CitZ was
detectable via SPR. However, this protein-protein interaction has been already proven and quantified
in other organisms, e.g. purified citrate synthase of pig heart mitochondria bound to malate
dehydrogenase which was covalently coupled to a sepharose 4B column (Beeckmans & Kanarek,
1981; Morgunov & Srere, 1998; Tompa et al., 1987b). Mainly, the interaction of both enzymes was
assumed from indirect evidences, e.g. in vitro trapping assays with mitochondrial malate
dehydrogenase and citrate synthase from pig hearts revealed no release of oxaloacetate to the
medium (Datta et al., 1985; Morgunov & Srere, 1998).
- 72 -
Discussion
Figure 6.1: Schematic overview of the TCA cycle in B. subtilis. The metabolic intermediates are written in
black. The enzyme names are highlighted in green, the reducing equivalents in blue color. The B. subtilis
specific abbreviations of the enzyme names are marked with black boxes. Red arrows indicate the
connections between TCA cycle and amino acid and nucleotide anabolism. The enzymes analyzed in this
study, Mdh, Icd and CitZ are highlighted in yellow. The blue arrow represents the interaction between Mdh
and Icd.
As the direct interaction between Mdh and CitZ was not detectable, a third enzyme might be needed
to facilitate complex formation in B. subtilis. In TCA cycle, aconitase (CitB) follows CitZ and it
represents one possible interaction partner. Computational models with the mitochondrial malate
dehydrogenase, citrate synthase and aconitase of yeast revealed theoretical structures, which allow
the interaction of the three enzymes (Vélot et al., 1997). Even more, there have been hints on the
existence of a supramolecular complex containing further TCA cycle enzymes. For E. coli and
Pseudomonas aeruginosa, size exclusion chromatography experiments with crude lysates revealed
always co-elution of citrate synthase and malate dehydrogenase together with several other TCA
cycle enzymes (Barnes & Weitzman, 1986; Mitchell et al., 1995). SPINE data revealed in vivo
interactions of several TCA cycles enzymes including Mdh and CitZ of B. subtilis as well (Meyer et al.,
2011). At the moment, there are two main hypotheses on the conformation of an enzymatic
complex: a ring structure with a kind of “substrate assembly line” or a higher organized complex with
an anchor enzyme that fixes the whole metabolon (Lyubarev & Kurganov, 1989). The Mdh-Icd
- 73 -
Discussion
complex supports the latter type of supramolecular organization, as these two enzymes do not
catalyze any subsequent interactions. Additionally, a ring structure has some disadvantages for the
cell: It is very big and a ring always has a reduced stability, as it only allows the interaction of two
neighboring enzymes (Figure 6.2 A). Until now, there are more evidences for a compact structure of
the TCA metabolon with one fixation of the complex at the cytoplasma membrane. The possible
anchor enzyme has been described recently. In B. subtilis the bifunctional succinate dehydrogenase
complex SdhABC is attached to the cytoplasmic membrane. It functions as fumarate reductase in the
aerobic respiratory chain and as succinate dehydrogenase in the Krebs cycle (García Montes de Oca
et al., 2012). In E. coli, the corresponding SdhABCD complex is anchored within the membrane by the
SdhCD subunits, while the subunits SdhA and B are oriented towards the cytoplasm. A similar
conformation is assumed for the B. subtilis enzyme as well (García Montes de Oca et al., 2012;
Schnorpfeil et al., 2001; Sousa et al., 2011; Sousa et al., 2012; Yankovskaya et al., 2003). A formation
of a supramolecular enzyme complex around these subunits might be possible. The arrangement of
the compact complex might enable more interactions between different enzymes than a defined ring
structure. Additionally, around this anchor enzyme, smaller subcomplexes can be formed depending
e.g. on the availability of metabolites, e.g. the analyzed Mdh-Icd complex in the presence of the
substrates of Icd during exponential growth (Figure 6.2 B).
Figure 6.2: Hypothetical models of a B. subtilis TCA metabolon. This scheme indicates two possible TCA
metabolon structures. A: the rigid “assembly line ring model” which allows only the interaction of subsequent
enzymes. B: the “compact complex model” which allows the interaction between more than just two enzymes.
Black arrows with question marks indicate possible, but experimentally unconfirmed interactions. The proven
interaction between Mdh and Icd is depicted with a green arrow and an exclamation mark. CM: cytoplasmic
membrane; CitB: aconitase, CitG: fumarase, Icd: isocitrate dehydrogenase, Mdh: malate dehydrogenase,
OdhAB, PdhD: α-ketoglutarate dehydrogenase complex, SdhABC: succinate dehydrogenase complex, SucCD:
succinate thiokinase.
- 74 -
Discussion
6.2 Structure and kinetics of the CcpA-HPrSer46P complex
interacting with various cre-elements
CcpA is the central regulator protein in B. subtilis, which controls e.g. carbon catabolite regulation
(Fujita, 2009), overflow metabolism (Grundy et al., 1993; Shivers et al., 2006), expression of some
TCA cycle enzymes (Blencke et al., 2006; Jin & Sonenshein, 1994b; Tobisch et al., 1999; Wünsche et
al., 2012), amino acid anabolism (Ludwig et al., 2002; Shivers & Sonenshein, 2005; Tojo et al., 2005),
sporulation (Piggot & Hilbert, 2004) and biofilm formation (Chagneau & Saier Jr, 2004; Stanley et al.,
2003). In complex with either HPrSer46P or CrhSer46P as coeffectors, CcpA contacts its operator
sequence cre and activates or represses gene expression (Deutscher, 2008; Deutscher et al., 1995;
Fujita, 2009; Titgemeyer & Hillen, 2002). In this study, the binding of the CcpA-HPrSer46P complex to
five different cre-elements was quantified in vitro via SPR measurements. Interestingly, the KD-values
did not differ significantly for four analyzed cre-elements, in particular ackA-cre2, gntR-credown, syncre and xylA-cre with approximately 3.0 nM. The affinity of the complex to ackA-cre2, gntR-credown
and syn-cre was analyzed as well by fluorescence polarization and revealed similar dissociation
constants (Schumacher et al., 2011). Other transcriptional regulators bind with similar affinities to
their operator sites, e.g. AbrB regulates gene expression at the transition from exponential to
stationary growth phase, and its affinity to its operator sites ranges from 6-40 nM (Strauch, 1995;
Strauch et al., 1989). However, the high similarity of the kinetics was unexpected, as the analyzed
cre-elements share only three highly conserved parts, in particular the CG-Pairs at position 2/14 and
8/9 and Thy2 and Ade15 at the 5’ and 3’ end of the cre-element (Miwa & Fujita, 2001; Miwa et al.,
2000; Schumacher et al., 2011; Weickert & Chambliss, 1989). Crystal structures of CcpA-HPrSer46P in
complex with ackA-cre2, gntR-credown and syn-cre revealed that these conserved regions are
recognized by the CcpA-DNA binding domain. The overall structure of all three complexes was highly
homologous with the earlier published structure of B. megaterium CcpA (Schumacher et al., 2004)
and unveiled only three important universal amino acid-DNA contacts (refer to Figure 6.3). As part of
the hinge helix, Leu56 interacts with the central CpG step in the minor groove of the DNA. Helix-turnhelix (HTH) residue Arg22 contacts Gua3 of the major groove (Schumacher et al., 2011). The same
contacts were detected for the corresponding residues Leu55 and Arg21 of B. megaterium CcpA and
these residues are highly conserved throughout many CcpA proteins from different species, e.g. of B.
anthracis, B. halodurans or Listeria monocytogenes (Schumacher et al., 2004). Even more, other
proteins of the LacI/GalR family, like LacR, GalR and PurR all share a highly conserved leucine residue
in their DNA binding domains (Lewis et al., 1996; Schumacher et al., 2004; Schumacher et al., 1994).
The importance of the interaction with the central CpG step is underlined as in all structures the
- 75 -
Discussion
hinge helix backbone atoms exhibited weak but specific hydrogen bonds to the nucleobases of the
central CpG step (Schumacher et al., 2011).
Figure 6.3: Crystal structure of the HTHLH domains and hinge helices, the two separable DNA-binding
modules of CcpA (Schumacher et al., 2011). Arg22 (blue) as part ot the HTHLH motifs (pink ribbons)
contacts Gua3 of the cre-site in the major groove of the DNA. The hinge helices (yellow ribbons) as second
DNA-binding module interact via Leu56 (blue) with the central CpG step with the minor groove of the DNA.
The two modules areconnected via flexible linkers which allow the optimal movement towards the
conserved sequences. This figure represents an overlay of the structure of the CcpA-HPrSer46P-ackA-cre2
and the syn-cre-complex as these two crystal structures show the highest deviations. The backbone of the
DNA is depicted in grey, the residues which have van der Waals contacts with the cre-element are presented
with blue dotted surfaces.
Besides the two CG-pairs, the borders of the cre-element, Thy2 and Ade15, are highly conserved
among the cre-elements analyzed so far (Miwa et al., 2000; Weickert & Chambliss, 1990). The Cβ
atom of residue Asn29 from each subunits contacts Thy2. This interaction was exclusively detected
for the B. subtilis CcpA-HPrSer46P-cre structures (Schumacher et al., 2011). So the interaction
between the CcpA-HPrSer46P-complex and the cre-sites mainly depends on three nucleobase-amino
acid interactions. This might explain why these highly degenerate sequences were bound with almost
the same affinity. However, besides the universal interactions between CcpA residues and
nucleotides of the cre-site, there are some cre-specific contacts as well, e.g. the interaction between
Thy11 of gntR-credown and Met17 of each CcpA half site. As in vivo analysis with CcpAM17R mutants
revealed a complete loss of repression of gntR expression, this represents a typical example of
differential regulation (Sprehe et al., 2007).
- 76 -
Discussion
Besides the same kinetics and the same overall structures of the analyzed CcpA-HPrSer46P
complexes, there was one significant difference between all structures. The bending angle of the creelements varied. CcpA is able to adjust the DNA conformation by the flexible linkers between the
helix-turn-helix-loop-helix (HTHLH) motif and the hinge helices. This leads to different bends of the
whole cre-site: syn-cre is bent by 31°, ackA-cre2 56° and gntR-credown by 41° (Schumacher et al.,
2011). The high plasticity of the molecule enables the recognition of the degenerate cre-sites with
the same affinity. This DNA kinking is typical for regulator proteins and was extensively studied for
the E. coli cAMP receptor protein CRP which is the main regulator of CCR in Gram-negative bacteria.
It activates transcription of more than 100 genes and thereby, it is able to bend its operator DNA by
approximately 80° (Busby & Ebright, 1999; Chen et al., 2001; de Crombrugghe et al., 1984; Lawson et
al., 2004). In contrast to the cre-sites, the eleven base pairs of the CAP regions are higher conserved
and show strong sequence preferences at position 1, 2 and 4-8 of each half-site (refer to Table 6.1)
(Dalma-Weiszhausz et al., 1991; Ebright et al., 1989; Gartenberg & Crothers, 1988; Gunasekera et al.,
1992). Like CcpA, CRP forms also a dimer which recognizes its perfect palindromic CAP-site
(Parkinson et al., 1996). The activated CcpA-complex contacts only 6 of 16 nucleotides of the cre-site,
while CRP interacts specifically with 14 of 22 of the CAP-site. This might be one reason, that the
affinity of CRP for the CAP binding site is 210-fold higher than of the CcpA-HPrSer46P complex to cre
(Gunasekera et al., 1992).
Table 6.1: Comparison of the consensus sequences of the E. coli CAP binding site and the B. subtilis cre-site.
Specifically bound nucleotides were highlighted in bold red letters
Sequence: 5‘ → 3‘
CAP binding
A A A T G T G A T C T A G A T C A C A T T T
site
(E. coli)
creconsensus
N T G W N A N C G N T N W C A N
sequence
(B. subtilis)
Reference
(Ebright et
al., 1989)
(Weickert &
Chambliss,
1990)
Similar to the CAP-site, the xynP-cre-site is besides one exception completely palindromic. In contrast
to the other analyzed cre-elements, the affinity of the CcpA-HPrSer46P complex to xynP-cre was up
to 19-fold higher with a KD value of 0.2 ± 0.1 nM. It was already stated that the functionality of a creelement depends on its palindromic nature (compare to Table 6.2), so this might be a reason that the
affinity of CcpA-HPrSer46P to xynP-cre is highest among all cre-sites analyzed in this study (Fujita,
- 77 -
Discussion
2009; Galinier et al., 1999; Marciniak et al., 2012). However, the xylA-cre of B. megaterium is bound
with a similar affinity of 0.6 ± 0.3 nM and in contrast to xynP-cre this cre-element has only 8 of 16
palindromic basepairs (Rygus & Hillen, 1992; Seidel et al., 2005).
Table 6.2: Palindromic nature of the B. subtilis xynP- and B. megaterium xylA-cre-sequence. Palindromic
bases are highlighted in the same color, non-palindromic parts of the cre-elements are written in black.
xynP-cre
(B. subtilis)
xylA-cre
(B. megaterium)
Sequence: 5‘ → 3‘
Reference
TGAAAGCGCTTTTA
(Galinier et al., 1999)
TGAAAGCGCAAACA
(Gösseringer et al., 1997)
In vivo analysis of the promoter strength of several CcpA regulated genes via lacZ-measurements
revealed an up to 44-fold higher repression of the expression of the xynP promoter in contrast to the
gntR promoter (Sprehe et al., 2007). As the affinity of the CcpA-HPrSer46P-complex to xynP-cre is 15fold higher in comparison to gntR-cre, this likely represents the reason for the better regulation. In
addition, the distance between cre-element and transcription start also influences the regulation by
CcpA: in the case of xynP, there is one full helix turn between transcription start and cre-element. If
the cre-element is located in close vicinity to the transcription start, the repression factor was lower,
e.g. in the case of gntR (Marciniak et al., 2012). However, although the affinity of the CcpAHPrSer46P complex to ackA-cre2 is 8-fold reduced in comparison to xynP-cre, the substitution of
ackA-cre2 by xynP-cre and vice versa did not improve or impair the regulation of xynP and ackA
expression (Sprehe, 2007). Additionally, fluorescence titrations of xylA-cre, xynP-cre, gntR-credown and
ackA-cre2 to a CcpA1W mutant and HPrSer46P revealed no significant differences of the affinity to
the analyzed cre-sites (Diel, 2005; Seidel et al., 2005). However, as until now the CcpA-HPrSer46PxynP-cre crystall structure has not been determined yet, a structural reason for this better affinity
remains unclear.
In summary, CcpA-HPrSer46P recognizes highly degenerated cre-elements with almost the same
affinity. This is achieved by the high plasticity of the protein due to the flexibility of the linker regions
between the two DNA binding domains, the HTHLH motifs and the hinge helices. As a consequence,
the global regulator CcpA binds universally to all analyzed cre-sites with Arg22 and Leu56 and is able
to interact with multiple sequences in the same way.
- 78 -
Discussion
6.3 Outlook
The determination of the conditions and kinetics of the Mdh-Icd interaction was the first step to
understand the formation of the TCA cycle metabolon. The next steps will be the purification of the
other TCA cycle enzymes and the analysis of their interaction in combination with the corresponding
metabolites via SPR. On main task is the question, if Mdh and CitZ interact in the presence of other
enzymes, e.g. the aconitase CitB. Another goal is the analysis of the crystal structure of complexes
comprising two or more proteins, e.g. the Mdh-Icd complex.
The data of the second project revealed that the affinity of the CcpA-HPrSer46P complex to various
cre-sites is independent of their sequence. However, xynP-cre was bound with an up to 19-fold
higher affinity. The next step is the crystallization of the CcpA-HPrSer46P-xynP-cre complex as well,
since there might be structural differences which can explain the higher affinity to xynP-cre.
- 79 -
Bibliography
7 Bibliography
Aktas, D. F., & Cook, P. F. (2009). A Lysine-Tyrosine Pair Carries Out Acid−Base Chemistry in the
Metal Ion-Dependent Pyridine Dinucleotide-Linked β-Hydroxyacid Oxidative Decarboxylases.
Biochemistry, 48(16), 3565-3577.
Alcaraz, L. D., Moreno-Hagelsieb, G., Eguiarte, L. E., Souza, V., Herrera-Estrella, L., & Olmedo, G.
(2010). Understanding the evolutionary relationships and major traits of Bacillus through
comparative genomics. BMC genomics, 11, 332.
Amar, P., Legent, G., Thellier, M., Ripoll, C., Bernot, G., Nystrom, T., Saier, M., & Norris, V. (2008). A
stochastic automaton shows how enzyme assemblies may contribute to metabolic efficiency.
BMC Systems Biology, 2(1), 27.
Antunes, A., Camiade, E., Monot, M., Courtois, E., Barbut, F., Sernova, N. V., Rodionov, D. A.,
Martin-Verstraete, I., & Dupuy, B. (2012). Global transcriptional control by glucose and
carbon regulator CcpA in Clostridium difficile. Nucleic Acids Res., 40(21), 10701-10718.
Ausubel, F., Brent, R., Kingston, R., More, D., Seidmann, J., Smith, J., and Struhl, K. (1987). Current
protocol in molecular biology New York: John Wiley & Sons.
Baldwin, J. E., & Krebs, H. (1981). The evolution of metabolic cycles. Nature, 291(5814), 381-382.
Barbe, V., Cruveiller, S., Kunst, F., Lenoble, P., Meurice, G., Sekowska, A., Vallenet, D., Wang, T.,
Moszer, I., Medigue, C., & Danchin, A. (2009). From a consortium sequence to a unified
sequence: The Bacillus subtilis 168 reference genome a decade later. Microbiology, 155,
1758-1775.
Barnes, S. J., & Weitzman, P. D. J. (1986). Organization of citric acid cycle enzymes into a
multienzyme cluster. FEBS Lett., 201(2), 267-270.
Baumberg, S., & Klingel, U. (1993). Biosynthesis of arginine, proline and related compounds. In J. A.
Hoch, A. L. Sonenshein & R. Losick (Eds.), Bacillus subtilis and other Gram positive Bacteria:
biochemistry, physiology, and molecular genetics. (pp. 299-306). Washington, D.C.: American
Society for Microbiology.
Beeckmans, S., & Kanarek, L. (1981). Demonstration of Physical Interactions between Consecutive
Enzymes of the Citric Acid Cycle and of the Aspartate-Malate Shuttle. FEBS J, 117(3), 527-535.
- 80 -
Bibliography
Beeckmans, S., Van Driessche, E., & Kanarek, L. (1989). The visualization by affinity electrophoresis
of a specific association between the consecutive citric acid cycle enzymes fumarase and
malate dehydrogenase. FEBS J, 183(2), 449-454.
Belitsky, B. R. (2002). Biosynthesis of amino acids of the glutamate and aspartate families, alanine,
and polyamines. In A. L. Sonenshein, R. Losick & J. A. Hoch (Eds.), Bacillus subtilis and Its
Closest Relatives: From Genes to Cells: ASM Press, Washington D.C.
Belitsky, B. R., & Sonenshein, A. L. (2008). Genetic and biochemical analysis of CodY-binding sites in
Bacillus subtilis. J Bacteriol, 190(4), 1224-1236.
Bennett, B. D., Kimball, E. H., Gao, M., Osterhout, R., Van Dien, S. J., & Rabinowitz, J. D. (2009).
Absolute metabolite concentrations and implied enzyme active site occupancy in Escherichia
coli. Nat Chem Biol, 5(8), 593-599.
Bériault, R., Chénier, D., Singh, R., Middaugh, J., Mailloux, R., & Appanna, V. (2005). Detection and
purification of glucose 6-phosphate dehydrogenase, malic enzyme, and NADP-dependent
isocitrate dehydrogenase by blue native polyacrylamide gel electrophoresis. Electrophoresis,
26(15), 2892-2897.
Bisswanger, H. (2004). Practical enzymology (1st ed.): Wiley-VCH Verlag GmbH & Co. KGaA.
Blencke, H. M., Reif, I., Commichau, F. M., Detsch, C., Wacker, I., Ludwig, H., & Stülke, J. (2006).
Regulation of citB expression in Bacillus subtilis: integration of multiple metabolic signals in
the citrate pool and by the general nitrogen regulatory system. Arch Microbiol, 185(2), 136146.
Borthwick, A. C., Holms, W. H., & Nimmo, H. G. (1984). The phosphorylation of Escherichia coli
isocitrate dehydrogenase in intact cells. Biochem J, 222(3), 797-804.
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities
of protein utilizing the principle of protein-dye binding. Anal Biochem, 72, 248-254.
Brill, J., Hoffmann, T., Putzer, H., & Bremer, E. (2011). T-box-mediated control of the anabolic
proline biosynthetic genes of Bacillus subtilis. Microbiology, 157(4), 977-987.
Buescher, J. M., Liebermeister, W., Jules, M., Uhr, M., Muntel, J., Botella, E., Hessling, B., Kleijn, R.
J., Le Chat, L., Lecointe, F., Mäder, U., Nicolas, P., Piersma, S., Rugheimer, F., Becher, D.,
Bessieres, P., Bidnenko, E., Denham, E. L., Dervyn, E., Devine, K. M., Doherty, G., Drulhe, S.,
Felicori, L., Fogg, M. J., Goelzer, A., Hansen, A., Harwood, C. R., Hecker, M., Hubner, S.,
Hultschig, C., Jarmer, H., Klipp, E., Leduc, A., Lewis, P., Molina, F., Noirot, P., Peres, S.,
Pigeonneau, N., Pohl, S., Rasmussen, S., Rinn, B., Schaffer, M., Schnidder, J., Schwikowski,
B., Van Dijl, J. M., Veiga, P., Walsh, S., Wilkinson, A. J., Stelling, J., Aymerich, S., & Sauer, U.
(2012). Global network reorganization during dynamic adaptations of Bacillus subtilis
metabolism. Science, 335(6072), 1099-1103.
- 81 -
Bibliography
Busby, S., & Ebright, R. H. (1999). Transcription activation by catabolite activator protein (CAP). J Mol
Biol, 293(2), 199-213.
Campel, M. K. F., Shawn O. (2006). Biochemistry, Fifth Edition (5th ed.): Thomas Brooks/Cole.
Carpousis, A. J. (2007). The RNA Degradosome of Escherichia coli: An mRNA-Degrading Machine
Assembled on RNase E. Annu Rev Microbiol, 61(1), 71-87.
Cases, I., Velazquez, F., & de Lorenzo, V. (2007). The ancestral role of the phosphoenolpyruvatecarbohydrate phosphotransferase system (PTS) as exposed by comparative genomics.
Research in microbiology, 158(8-9), 666-670.
Caspi, R., Altman, T., Dreher, K., Fulcher, C. A., Subhraveti, P., Keseler, I. M., Kothari, A.,
Krummenacker, M., Latendresse, M., Mueller, L. A., Ong, Q., Paley, S., Pujar, A., Shearer, A.
G., Travers, M., Weerasinghe, D., Zhang, P., & Karp, P. D. (2012). The MetaCyc database of
metabolic pathways and enzymes and the BioCyc collection of pathway/genome databases.
Nucleic Acids Res., 40(D1), D742-D753.
Chagneau, C., & Saier Jr, M. H. (2004). Biofilm-Defective Mutants of Bacillus subtilis. J Mol Microbiol
Biotechnol, 8(3), 177-188.
Chambliss, G. H. (1993). Carbon source-mediated catabolite repression. In J. A. Hoch, A. L.
Sonenshein & R. Losick (Eds.), Bacillus subtilis and other Gram positive bacteria (pp. 213218): Washington D.C.: American Society for Microbiology.
Chassagnole, C., Noisommit-Rizzi, N., Schmid, J. W., Mauch, K., & Reuss, M. (2002). Dynamic
modeling of the central carbon metabolism of Escherichia coli. Biotechnol Bioeng, 79(1), 5373.
Chauvaux, S., Paulsen, I. T., & Saier, M. H., Jr. (1998). CcpB, a novel transcription factor implicated in
catabolite repression in Bacillus subtilis. J Bacteriol, 180(3), 491-497.
Chen, S., Gunasekera, A., Zhang, X., Kunkel, T. A., Ebright, R. H., & Berman, H. M. (2001). Indirect
readout of DNA sequence at the primary-kink site in the CAP-DNA complex: alteration of
DNA binding specificity through alteration of DNA kinking. J Mol Biol, 314(1), 75-82.
Chiang, C., Bongiorni, C., & Perego, M. (2011). Glucose-Dependent Activation of Bacillus anthracis
Toxin Gene Expression and Virulence Requires the Carbon Catabolite Protein CcpA. J
Bacteriol, 193(1), 52-62.
Commichau, F. M., Rothe, F. M., Herzberg, C., Wagner, E., Hellwig, D., Lehnik-Habrink, M.,
Hammer, E., Völker, U., & Stülke, J. (2009). Novel activities of glycolytic enzymes in Bacillus
- 82 -
Bibliography
subtilis: interactions with essential proteins involved in mRNA processing. Mol Cell
Proteomics, 8(6), 1350-1360.
Cozzone, A. J., & El-Mansi, M. (2005). Control of isocitrate dehydrogenase catalytic activity by
protein phosphorylation in Escherichia coli. J Mol Microbiol Biotechnol, 9(3-4), 132-146.
Dahl, M. K., Schmiedel, D., & Hillen, W. (1995). Glucose and glucose-6-phosphate interaction with
Xyl repressor proteins from Bacillus spp. may contribute to regulation of xylose utilization. J
Bacteriol, 177(19), 5467-5472.
Dalma-Weiszhausz, D. D., Gartenberg, M. R., & Crothers, D. M. (1991). Sequence-dependent
contribution of distal binding domains to CAP protein-DNA binding affinity. Nucleic Acids
Res., 19(3), 611-616.
Datta, A., Merz, J. M., & Spivey, H. O. (1985). Substrate channeling of oxalacetate in solid-state
complexes of malate dehydrogenase and citrate synthase. J Biol Chem, 260(28), 1500815012.
Dauner, M., Bailey, J. E., & Sauer, U. (2001a). Metabolic flux analysis with a comprehensive
isotopomer model in Bacillus subtilis. Biotechnol Bioeng, 76(2), 144-156.
Dauner, M., Storni, T., & Sauer, U. (2001b). Bacillus subtilis metabolism and energetics in carbonlimited and excess-carbon chemostat culture. J Bacteriol, 183(24), 7308-7317.
de Crombrugghe, B., Busby, S., & Buc, H. (1984). Cyclic AMP receptor protein: role in transcription
activation. Science, 224(4651), 831-838.
Dean, A. M., & Koshland, D. E., Jr. (1993). Kinetic mechanism of Escherichia coli isocitrate
dehydrogenase. Biochemistry, 32(36), 9302-9309.
Dean, A. M., Lee, M. H., & Koshland, D. E. (1989). Phosphorylation inactivates Escherichia coli
isocitrate dehydrogenase by preventing isocitrate binding. J Biol Chem, 264(34), 2048220486.
Desphande, K. L., Katze, J. R., & Kane, J. F. (1980). Regulation of glutamate synthase from Bacillus
subtilis by Glutamine. Biochemical and Biophysical Research Communications, 95(1), 55-60.
Deutscher, J. (2008). The mechanisms of carbon catabolite repression in bacteria. Curr Opin
Microbiol, 11(2), 87-93.
Deutscher, J., Francke, C., & Postma, P. W. (2006). How phosphotransferase system-related protein
phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev,
70(4), 939-1031.
- 83 -
Bibliography
Deutscher, J., Küster, E., Bergstedt, U., Charrier, V., & Hillen, W. (1995). Protein kinase-dependent
HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive
bacteria. Mol Microbiol, 15(6), 1049-1053.
Deutscher, J., & Saier Jr, M. H. (2005). Ser/Thr/Tyr Protein Phosphorylation in Bacteria – For Long
Time Neglected, Now Well Established. J Mol Microbiol Biotechnol, 9(3-4), 125-131.
Diel,
M.
(2005).
Fluoreszenzspektroskopische
Analyse
der
Interaktionen
von
Einzeltryptophanmutanten des Katabolit-Kontrollproteins CcpA aus Bacillus subtilis mit
Cofaktoren und cre. Phd thesis, Friedrich-Alexander University Erlangen/Nürnberg, Erlangen.
Dowds, B., Baxter, L., & McKillen, M. (1978). Catabolite repression in Bacillus subtilis. Biochim
Biophys Acta, 541(1), 18-34.
Doyle, S. A., Beernink, P. T., & Koshland, D. E., Jr. (2001). Structural basis for a change in substrate
specificity: crystal structure of S113E isocitrate dehydrogenase in a complex with
isopropylmalate, Mg2+, and NADP. Biochemistry, 40(14), 4234-4241.
Doyle, S. A., Fung, S.-Y. F., & Koshland, D. E. (2000). Redesigning the Substrate Specificity of an
Enzyme: Isocitrate Dehydrogenase. Biochemistry, 39(46), 14348-14355.
Dunn, M. F. (2012). Allosteric regulation of substrate channeling and catalysis in the tryptophan
synthase bienzyme complex. Arch Biochem Biophys, 519(2), 154-166.
Dunn, M. F., Aguilar, V., Brzovic, P., Drewe, W. F., Jr., Houben, K. F., Leja, C. A., & Roy, M. (1990).
The tryptophan synthase bienzyme complex transfers indole between the alpha- and betasites via a 25-30 A long tunnel. Biochemistry, 29(37), 8598-8607.
Ebright, R. H., Ebright, Y. W., & Gunasekera, A. (1989). Consensus DNA site for the Escherichia coli
catabolite gene activator protein (CAP): CAP exhibits a 450-fold higher affinity for the
consensus DNA site than for the E. coli lac DNA site. Nucleic Acids Res, 17(24), 10295-10305.
Elcock, A. H., & McCammon, J. A. (1996). Evidence for Electrostatic Channeling in a Fusion Protein of
Malate Dehydrogenase and Citrate Synthase. Biochemistry, 35(39), 12652-12658.
Ellis, G., & Goldberg, D. M. (1971). An improved manual and semi-automatic assay for NADPdependent isocitrate dehydrogenase activity, with a description of some kinetic properties of
human liver and serum enzyme. Clin Biochem, 4(1–6), 175-185.
Eymann, C., Becher, D., Bernhardt, J., Gronau, K., Klutzny, A., & Hecker, M. (2007). Dynamics of
protein phosphorylation on Ser/Thr/Tyr in Bacillus subtilis. Proteomics, 7(19), 3509-3526.
- 84 -
Bibliography
Fischer, N. (2008). Response of Bacillus subtilis to glucose starvation. Master thesis, FriedrichAlexander University Erlangen/Nürnberg, Erlangen.
Fujita, Y. (2009). Carbon catabolite control of the metabolic network in Bacillus subtilis. Biosci
Biotechnol Biochem, 73(2), 245-259.
Fujita, Y., Fujita, T., Miwa, Y., Nihashi, J., & Aratani, Y. (1986). Organization and transcription of the
gluconate operon, gnt, of Bacillus subtilis. J Biol Chem, 261(29), 13744-13753.
Fujita, Y., & Miwa, Y. (1994). Catabolite repression of the Bacillus subtilis gnt operon mediated by
the CcpA protein. J Bacteriol, 176(2), 511-513.
Fujita, Y., Miwa, Y., Galinier, A., & Deutscher, J. (1995). Specific recognition of the Bacillus subtilis
gnt cis-acting catabolite-responsive element by a protein complex formed between CcpA and
seryl-phosphorylated HPr. Mol Microbiol, 17(5), 953-960.
Galinier, A., Deutscher, J., & Martin-Verstraete, I. (1999). Phosphorylation of either Crh or HPr
mediates binding of CcpA to the Bacillus subtilis xyn cre and catabolite repression of the xyn
operon. J Mol Biol, 286(2), 307-314.
Galinier, A., Haiech, J., Kilhoffer, M. C., Jaquinod, M., Stülke, J., Deutscher, J., & Martin-Verstraete,
I. (1997). The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon
catabolite repression. Proc Natl Acad Sci U S A, 94(16), 8439-8444.
Galinier, A., Kravanja, M., Engelmann, R., Hengstenberg, W., Kilhoffer, M. C., Deutscher, J., &
Haiech, J. (1998). New protein kinase and protein phosphatase families mediate signal
transduction in bacterial catabolite repression. Proc Natl Acad Sci U S A, 95(4), 1823-1828.
García Montes de Oca, L., Chagolla-López, A., González de la Vara, L., Cabellos-Avelar, T., GómezLojero, C., & Gutiérrez Cirlos, E. (2012). The composition of the Bacillus subtilis aerobic
respiratory chain supercomplexes. J Bioenerg Biomembr, 44(4), 473-486.
Gartenberg, M. R., & Crothers, D. M. (1988). DNA sequence determinants of CAP-induced bending
and protein binding affinity. Nature, 333(6176), 824-829.
Gärtner, D., Degenkolb, J., Ripperger, J. A., Allmansberger, R., & Hillen, W. (1992). Regulation of the
Bacillus subtilis W23 xylose utilization operon: interaction of the Xyl repressor with the xyl
operator and the inducer xylose. Molecular & general genetics : MGG, 232(3), 415-422.
Gärtner, D., Geissendorfer, M., & Hillen, W. (1988). Expression of the Bacillus subtilis xyl operon is
repressed at the level of transcription and is induced by xylose. J Bacteriol, 170(7), 31023109.
- 85 -
Bibliography
Glaser, P., Frangeul, L., Buchrieser, C., Rusniok, C., Amend, A., Baquero, F., Berche, P., Bloecker, H.,
Brandt, P., Chakraborty, T., Charbit, A., Chetouani, F., Couve, E., de Daruvar, A., Dehoux, P.,
Domann, E., Dominguez-Bernal, G., Duchaud, E., Durant, L., Dussurget, O., Entian, K. D.,
Fsihi, H., Garcia-del Portillo, F., Garrido, P., Gautier, L., Goebel, W., Gomez-Lopez, N., Hain,
T., Hauf, J., Jackson, D., Jones, L. M., Kaerst, U., Kreft, J., Kuhn, M., Kunst, F., Kurapkat, G.,
Madueno, E., Maitournam, A., Vicente, J. M., Ng, E., Nedjari, H., Nordsiek, G., Novella, S.,
de Pablos, B., Perez-Diaz, J. C., Purcell, R., Remmel, B., Rose, M., Schlueter, T., Simoes, N.,
Tierrez, A., Vazquez-Boland, J. A., Voss, H., Wehland, J., & Cossart, P. (2001). Comparative
genomics of Listeria species. Science, 294(5543), 849-852.
Goelzer, A., Bekkal Brikci, F., Martin-Verstraete, I., Noirot, P., Bessieres, P., Aymerich, S., &
Fromion, V. (2008). Reconstruction and analysis of the genetic and metabolic regulatory
networks of the central metabolism of Bacillus subtilis. BMC Syst Biol, 2, 20.
Gonçalves, S., Miller, S. P., Carrondo, M. A., Dean, A. M., & Matias, P. M. (2012). Induced Fit and
the Catalytic Mechanism of Isocitrate Dehydrogenase. Biochemistry, 51(36), 7098-7115.
Görke, B., & Stülke, J. (2008). Carbon catabolite repression in bacteria: many ways to make the most
out of nutrients. Nat Rev Microbiol, 6(8), 613-624.
Gösseringer, R., Küster, E., Galinier, A., Deutscher, J., & Hillen, W. (1997). Cooperative and noncooperative DNA binding modes of catabolite control protein CcpA from Bacillus megaterium
result from sensing two different signals. J Mol Biol, 266(4), 665-676.
Grandier-Vazeille, X., Bathany, K., Chaignepain, S., Camougrand, N., Manon, S., & Schmitter, J. M.
(2001). Yeast mitochondrial dehydrogenases are associated in a supramolecular complex.
Biochemistry, 40(33), 9758-9769.
Grundy, F. J., Waters, D. A., Allen, S. H., & Henkin, T. M. (1993). Regulation of the Bacillus subtilis
acetate kinase gene by CcpA. J Bacteriol, 175(22), 7348-7355.
Gunasekera, A., Ebright, Y. W., & Ebright, R. H. (1992). DNA sequence determinants for binding of
the Escherichia coli catabolite gene activator protein. J Biol Chem, 267(21), 14713-14720.
Gunka, K., & Commichau, F. M. (2012). Control of glutamate homeostasis in Bacillus subtilis: a
complex interplay between ammonium assimilation, glutamate biosynthesis and
degradation. Mol Microbiol, 85(2), 213-224.
Gunnewijk, M. G., van den Bogaard, P. T., Veenhoff, L. M., Heuberger, E. H., de Vos, W. M.,
Kleerebezem, M., Kuipers, O. P., & Poolman, B. (2001). Hierarchical control versus
autoregulation of carbohydrate utilization in bacteria. J Mol Microbiol Biotechnol, 3(3), 401413.
- 86 -
Bibliography
Haggie, P. M., & Verkman, A. S. (2002). Diffusion of Tricarboxylic Acid Cycle Enzymes in the
Mitochondrial Matrix in Vivo : EVIDENCE FOR RESTRICTED MOBILITY OF A MULTIENZYME
COMPLEX. J Biol Chem, 277(43), 40782-40788.
Hall, M. D., & Banaszak, L. J. (1993). Crystal Structure of a Ternary Complex of Escherichia coli Malate
Dehydrogenase Citrate and NAD at 1·9 Å Resolution. J Mol Biol, 232(1), 213-222.
Hall, M. D., Levitt, D. G., & Banaszak, L. J. (1992). Crystal structure of Escherichia coli malate
dehydrogenase: A complex of the apoenzyme and citrate at 1·87 Å resolution. J Mol Biol,
226(3), 867-882.
Hall, M. D., Levitt, D. G., McAllister-Henn, L., & Banaszak, L. J. (1991). Purification and crystallization
of recombinant Escherichia coli malate dehydrogenase. J Mol Biol, 220(3), 551-553.
Halper, L. A., & Srere, P. A. (1977). Interaction between citrate synthase and mitochondrial malate
dehydrogenase in the presence of polyethylene glycol. Arch Biochem Biophys, 184(2), 529534.
Hanahan, D. (1985). Techniques for transformation of E. coli. In: DNA cloning: a practical approach
(Vol. 1): Oxford, Washington DC:IRL Press.
Henkin, T. M. (1996). The role of CcpA transcriptional regulator in carbon metabolism in Bacillus
subtilis. FEMS Microbiol Lett, 135(1), 9-15.
Hoch, J. A., Losick, R., & Sonenshein, A. L. (Eds.). (1993). Bacillus subtilis and Other Gram-Positive
Bacteria: Biochemistry, Physiology, and Molecular Genetics Asm Press.
Holmes, D. S., & Quigley, M. (1981). A rapid boiling method for the preparation of bacterial
plasmids. Anal Biochem, 114(1), 193-197.
Horstmann, N. (2006). Influence of various coeffectors on differential carbon catabolite regulation
exerted by CcpA. Phd thesis, Friedrich-Alexander University Erlangen/Nürnberg.
Horstmann, N., Seidel, G., Aung-Hilbrich, L. M., & Hillen, W. (2007). Residues His-15 and Arg-17 of
HPr participate differently in catabolite signal processing via CcpA. J Biol Chem, 282(2), 11751182.
Hueck, C. J., Hillen, W., & Saier, M. H., Jr. (1994). Analysis of a cis-active sequence mediating
catabolite repression in gram-positive bacteria. Res Microbiol, 145(7), 503-518.
Hueck, C. J., Kraus, A., Schmiedel, D., & Hillen, W. (1995). Cloning, expression and functional
analyses of the catabolite control protein CcpA from Bacillus megaterium. Mol Microbiol,
16(5), 855-864.
- 87 -
Bibliography
Hurley, J. H., Dean, A. M., Koshland, D. E., & Stroud, R. M. (1991). Catalytic mechanism of NADP+dependent isocitrate dehydrogenase: implications from the structures of magnesiumisocitrate and NADP+ complexes. Biochemistry, 30(35), 8671-8678.
Hurwitz, C., & Rosano, C. L. (1967). The intracellular concentration of bound and unbound
magnesium ions in Escherichia coli. J Biol Chem, 242(16), 3719-3722.
Hyde, C. C., Ahmed, S. A., Padlan, E. A., Miles, E. W., & Davies, D. R. (1988). Three-dimensional
structure of the tryptophan synthase alpha 2 beta 2 multienzyme complex from Salmonella
typhimurium. J Biol Chem, 263(33), 17857-17871.
Islam, M. M., Wallin, R., Wynn, R. M., Conway, M., Fujii, H., Mobley, J. A., Chuang, D. T., & Hutson,
S. M. (2007). A Novel Branched-chain Amino Acid Metabolon: PROTEIN-PROTEIN
INTERACTIONS IN A SUPRAMOLECULAR COMPLEX. J Biol Chem, 282(16), 11893-11903.
Jacob, S., Allmansberger, R., Gartner, D., & Hillen, W. (1991). Catabolite repression of the operon for
xylose utilization from Bacillus subtilis W23 is mediated at the level of transcription and
depends on a cis site in the xylA reading frame. Molecular & general genetics : MGG, 229(2),
189-196.
Jameson, D. M., & Seifried, S. E. (1999). Quantification of protein-protein interactions using
fluorescence polarization. Methods, 19(2), 222-233.
Jault, J. M., Fieulaine, S., Nessler, S., Gonzalo, P., Di Pietro, A., Deutscher, J., & Galinier, A. (2000).
The HPr kinase from Bacillus subtilis is a homo-oligomeric enzyme which exhibits strong
positive cooperativity for nucleotide and fructose 1,6-bisphosphate binding. J Biol Chem,
275(3), 1773-1780.
Jin, S., De Jesus-Berrios, M., & Sonenshein, A. L. (1996). A Bacillus subtilis malate dehydrogenase
gene. J Bacteriol, 178(2), 560-563.
Jin, S., & Sonenshein, A. L. (1994a). Identification of two distinct Bacillus subtilis citrate synthase
genes. J Bacteriol, 176(15), 4669-4679.
Jin, S., & Sonenshein, A. L. (1994b). Transcriptional regulation of Bacillus subtilis citrate synthase
genes. J Bacteriol, 176(15), 4680-4690.
Jin, S., & Sonenshein, A. L. (1996). Characterization of the major citrate synthase of Bacillus subtilis. J
Bacteriol, 178(12), 3658-3660.
Jourlin-Castelli, C., Mani, N., Nakano, M. M., & Sonenshein, A. L. (2000). CcpC, a novel regulator of
the LysR family required for glucose repression of the citB gene in Bacillus subtilis. J Mol Biol,
295(4), 865-878.
- 88 -
Bibliography
Kietzman, C. C., & Caparon, M. G. (2010). CcpA and LacD.1 Affect Temporal Regulation of
Streptococcus pyogenes Virulence Genes. Infect Immun, 78(1), 241-252.
Kim, H. J., Roux, A., & Sonenshein, A. L. (2002). Direct and indirect roles of CcpA in regulation of
Bacillus subtilis Krebs cycle genes. Mol Microbiol, 45(1), 179-190.
Kleerebezem, M. (2004). Quorum sensing control of lantibiotic production; nisin and subtilin
autoregulate their own biosynthesis. Peptides, 25(9), 1405-1414.
Kleijn, R. J., Buescher, J. M., Le Chat, L., Jules, M., Aymerich, S., & Sauer, U. (2010). Metabolic fluxes
during strong carbon catabolite repression by malate in Bacillus subtilis. J Biol Chem, 285(3),
1587-1596.
Kraus, A., Hueck, C., Gartner, D., & Hillen, W. (1994). Catabolite repression of the Bacillus subtilis xyl
operon involves a cis element functional in the context of an unrelated sequence, and
glucose exerts additional xylR-dependent repression. J Bacteriol, 176(6), 1738-1745.
Krebs, H. A., & Johnson, W. A. (1980). The role of citric acid in intermediate metabolism in animal
tissues. FEBS Letters, 117, Supplement 1(0), K2-K10.
Krispin, O., & Allmansberger, R. (1998). The Bacillus subtilis AraE Protein Displays a Broad Substrate
Specificity for Several Different Sugars. J Bacteriol, 180(12), 3250-3252.
Kuroda, M., Ohta, T., Uchiyama, I., Baba, T., Yuzawa, H., Kobayashi, I., Cui, L., Oguchi, A., Aoki, K.-i.,
Nagai, Y., Lian, J., Ito, T., Kanamori, M., Matsumaru, H., Maruyama, A., Murakami, H.,
Hosoyama, A., Mizutani-Ui, Y., Takahashi, N. K., Sawano, T., Inoue, R.-i., Kaito, C., Sekimizu,
K., Hirakawa, H., Kuhara, S., Goto, S., Yabuzaki, J., Kanehisa, M., Yamashita, A., Oshima, K.,
Furuya, K., Yoshino, C., Shiba, T., Hattori, M., Ogasawara, N., Hayashi, H., & Hiramatsu, K.
(2001). Whole genome sequencing of meticillin-resistant Staphylococcus aureus. The Lancet,
357(9264), 1225-1240.
Kuznetsov, A. V., Veksler, V., Gellerich, F. N., Saks, V., Margreiter, R., & Kunz, W. S. (2008). Analysis
of mitochondrial function in situ in permeabilized muscle fibers, tissues and cells. Nat.
Protocols, 3(6), 965-976.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature, 227(5259), 680-685.
Lammers, C. R., Flórez, L. A., Schmeisky, A. G., Roppel, S. F., Mäder, U., Hamoen, L., & Stülke, J.
(2010). Connecting parts with processes: SubtiWiki and SubtiPathways integrate gene and
pathway annotation for Bacillus subtilis. Microbiology, 156(Pt 3), 849-859.
- 89 -
Bibliography
Landmann, J. J., Busse, R. A., Latz, J.-H., Singh, K. D., Stülke, J., & Görke, B. (2011). Crh, the
paralogue of the phosphocarrier protein HPr, controls the methylglyoxal bypass of glycolysis
in Bacillus subtilis. Mol Microbiol, 82(3), 770-787.
LaPorte, D. C., & Koshland, D. E. (1982). A protein with kinase and phosphatase activities involved in
regulation of tricarboxylic acid cycle. Nature, 300(5891), 458-460.
LaPorte, D. C., Thorsness, P. E., & Koshland, D. E. (1985). Compensatory phosphorylation of
isocitrate dehydrogenase. A mechanism for adaptation to the intracellular environment. J
Biol Chem, 260(19), 10563-10568.
Lawson, C. L., Swigon, D., Murakami, K. S., Darst, S. A., Berman, H. M., & Ebright, R. H. (2004).
Catabolite activator protein: DNA binding and transcription activation. Curr Opin Struc Biol,
14(1), 10-20.
Lehnik-Habrink, M., Lewis, R. J., Mäder, U., & Stülke, J. (2012). RNA degradation in Bacillus subtilis:
an interplay of essential endo- and exoribonucleases. Mol Microbiol, 84(6), 1005-1017.
Lehnik-Habrink, M., Pfortner, H., Rempeters, L., Pietack, N., Herzberg, C., & Stülke, J. (2010). The
RNA degradosome in Bacillus subtilis: identification of CshA as the major RNA helicase in the
multiprotein complex. Mol Microbiol, 77(4), 958-971.
Lerondel, G., Doan, T., Zamboni, N., Sauer, U., & Aymerich, S. (2006). YtsJ has the major
physiological role of the four paralogous malic enzyme isoforms in Bacillus subtilis. J
Bacteriol, 188(13), 4727-4736.
Lévine, A., Vannier, F., Absalon, C., Kuhn, L., Jackson, P., Scrivener, E., Labas, V., Vinh, J., Courtney,
P., Garin, J., & Séror, S. J. (2006). Analysis of the dynamic Bacillus subtilis Ser/Thr/Tyr
phosphoproteome implicated in a wide variety of cellular processes. Proteomics, 6(7), 21572173.
Lewis, M., Chang, G., Horton, N. C., Kercher, M. A., Pace, H. C., Schumacher, M. A., Brennan, R. G.,
& Lu, P. (1996). Crystal structure of the lactose operon repressor and its complexes with DNA
and inducer. Science, 271(5253), 1247-1254.
Liao, D. I., Karpusas, M., & Remington, S. J. (1991). Crystal structure of an open conformation of
citrate synthase from chicken heart at 2.8-.ANG. resolution. Biochemistry, 30(24), 6031-6036.
Liedberg, B., Nylander, C., & Lundström, I. (1995). Biosensing with surface plasmon resonance —
how it all started. Biosensors and Bioelectronics, 10(8), i-ix.
Lindbladh, C., Brodeur, R. D., Lilius, G., Buelow, L., Mosbach, K., & Srere, P. A. (1994). Metabolic
studies on Saccharomyces cerevisiae containing fused citrate synthase/malate
dehydrogenase. Biochemistry, 33(39), 11684-11691.
- 90 -
Bibliography
Lindner, C., Stülke, J., & Hecker, M. (1994). Regulation of xylanolytic enzymes in Bacillus subtilis.
Microbiology, 140 ( Pt 4), 753-757.
Lorca, G. L., Chung, Y. J., Barabote, R. D., Weyler, W., Schilling, C. H., & Saier, M. H., Jr. (2005).
Catabolite repression and activation in Bacillus subtilis: dependency on CcpA, HPr, and HprK.
J Bacteriol, 187(22), 7826-7839.
Ludwig, H., Meinken, C., Matin, A., & Stülke, J. (2002). Insufficient Expression of the ilv-leu Operon
Encoding Enzymes of Branched-Chain Amino Acid Biosynthesis Limits Growth of a Bacillus
subtilis ccpA Mutant. J Bacteriol, 184(18), 5174-5178.
Lulko, A. T., Buist, G., Kok, J., & Kuipers, O. P. (2007). Transcriptome analysis of temporal regulation
of carbon metabolism by CcpA in Bacillus subtilis reveals additional target genes. J Mol
Microbiol Biotechnol, 12(1-2), 82-95.
Luo, C., Wang, X., Long, J., & Liu, J. (2006). An NADH-tetrazolium-coupled sensitive assay for malate
dehydrogenase in mitochondria and crude tissue homogenates. J. Biochem Biophys Methods,
68(2), 101-111.
Lyubarev, A. E., & Kurganov, B. I. (1989). Supramolecular organization of tricarboxylic acid cycle
enzymes. Biosystems, 22(2), 91-102.
aa
ie er
l e D
in i
a a P
ntel
e ling
ern ar t r
ietmann
l er U
e er
e er D r (2011). Efficient, Global-Scale
Quantification of Absolute Protein Amounts by Integration of Targeted Mass Spectrometry
and Two-Dimensional Gel-Based Proteomics. Analytical Chemistry, 83(7), 2677-2684.
Mäder, U., Schmeisky, A. G., Flórez, L. A., & Stülke, J. (2012). SubtiWiki—a comprehensive
community resource for the model organism Bacillus subtilis. Nucleic Acids Res., 40(D1),
D1278-D1287.
Marciniak, B., Pabijaniak, M., de Jong, A., Duhring, R., Seidel, G., Hillen, W., & Kuipers, O. (2012).
High- and low-affinity cre boxes for CcpA binding in Bacillus subtilis revealed by genome-wide
analysis. BMC Genomics, 13(1), 401.
Markuszewski, M. J., Otsuka, K., Terabe, S., Matsuda, K., & Nishioka, T. (2003). Analysis of
carboxylic acid metabolites from the tricarboxylic acid cycle in Bacillus subtilis cell extract by
capillary electrophoresis using an indirect photometric detection method. Journal of
chromatography. A, 1010(1), 113-121.
Mattlasson, B., Johansson, A.-C., & Mosbach, K. (1974). Preparation of a Soluble, Bifunctional
Enzyme Aggregate and Studies on Its IGnetic Behaviour in Polymer Media. FEBS J, 46(2), 341349.
- 91 -
Bibliography
McKenna, M. C. (2011). Glutamate dehydrogenase in brain mitochondria: do lipid modifications and
transient metabolon formation influence enzyme activity? Neurochem Int, 59(4), 525-533.
Meyer, F. M., Gerwig, J., Hammer, E., Herzberg, C., Commichau, F. M., Völker, U., & Stülke, J.
(2011). Physical interactions between tricarboxylic acid cycle enzymes in Bacillus subtilis:
evidence for a metabolon. Metab Eng, 13(1), 18-27.
Meyer, F. M., & Stülke, J. (2012). Malate metabolism in Bacillus subtilis: Distinct roles for three
classes of malate-oxidizing enzymes. FEMS Microbiology Letters, n/a-n/a.
Mijakovic, I., Poncet, S., Galinier, A., Monedero, V., Fieulaine, S., Janin, J., Nessler, S., Marquez, J.
A., Scheffzek, K., Hasenbein, S., Hengstenberg, W., & Deutscher, J. (2002). Pyrophosphateproducing protein dephosphorylation by HPr kinase/phosphorylase: A relic of early life?
Proceedings of the National Academy of Sciences, 99(21), 13442-13447.
Miller, S. L., & Smith-Magowan, D. (1990). The Thermodynamics of the Krebs Cycle and Related
Compounds. J Phys Chem Ref Data, 19(4), 1049-1073.
Mitchell, C. G., Anderson, S. C., & el-Mansi, E. M. (1995). Purification and characterization of citrate
synthase isoenzymes from Pseudomonas aeruginosa. Biochem J, 309 ( Pt 2), 507-511.
Miwa, Y., & Fujita, Y. (1988). Purification and characterization of a repressor for the Bacillus subtilis
gnt operon. J Biol Chem, 263(26), 13252-13257.
Miwa, Y., & Fujita, Y. (1990). Determination of the cis sequence involved in catabolite repression of
the Bacillus subtilis gnt operon; implication of a consensus sequence in catabolite repression
in the genus Bacillus. Nucleic Acids Res, 18(23), 7049-7053.
Miwa, Y., & Fujita, Y. (2001). Involvement of two distinct catabolite-responsive elements in
catabolite repression of the Bacillus subtilis myo-inositol (iol) operon. J Bacteriol, 183(20),
5877-5884.
Miwa, Y., Nagura, K., Eguchi, S., Fukuda, H., Deutscher, J., & Fujita, Y. (1997). Catabolite repression
of the Bacillus subtilis gnt operon exerted by two catabolite-responsive elements. Mol
Microbiol, 23(6), 1203-1213.
Miwa, Y., Nakata, A., Ogiwara, A., Yamamoto, M., & Fujita, Y. (2000). Evaluation and
characterization of catabolite-responsive elements (cre) of Bacillus subtilis. Nucleic Acids Res,
28(5), 1206-1210.
Moir-Blais, T. R., Grundy, F. J., & Henkin, T. M. (2001). Transcriptional activation of the Bacillus
subtilis ackA promoter requires sequences upstream of the CcpA binding site. J Bacteriol,
183(7), 2389-2393.
- 92 -
Bibliography
Mol, N., & Fischer, M. E. (2010). Surface Plasmon Resonance: A General Introduction. In N. J. Mol &
M. J. E. Fischer (Eds.), Surface Plasmon Resonance (Vol. 627, pp. 1-14): Humana Press.
Morgunov, I., & Srere, P. A. (1998). Interaction between citrate synthase and malate dehydrogenase.
Substrate channeling of oxaloacetate. J Biol Chem, 273(45), 29540-29544.
Nessler, S., Fieulaine, S., Poncet, S., Galinier, A., Deutscher, J., & Janin, J. (2003). HPr
Kinase/Phosphorylase, the Sensor Enzyme of Catabolite Repression in Gram-Positive
Bacteria: Structural Aspects of the Enzyme and the Complex with Its Protein Substrate. J
Bacteriol, 185(14), 4003-4010.
Newman, J. A., Hewitt, L., Rodrigues, C., Solovyova, A., Harwood, C. R., & Lewis, R. J. (2011).
Unusual, Dual Endo- and Exonuclease Activity in the Degradosome Explained by Crystal
Structure Analysis of RNase J1. Structure, 19(9), 1241-1251.
Newman, J. A., Hewitt, L., Rodrigues, C., Solovyova, A. S., Harwood, C. R., & Lewis, R. J. (2012).
Dissection of the Network of Interactions That Links RNA Processing with Glycolysis in the
Bacillus subtilis Degradosome. J Mol Biol, 416(1), 121-136.
Nihashi, J.-I., & Fujita, Y. (1984). Catabolite repression of inositol dehydrogenase and gluconate
kinase syntheses in Bacillus subtilis. Biochim Biophys Acta, 798(1), 88-95.
Nurmohamed, S., McKay, A. R., Robinson, C. V., & Luisi, B. F. (2010). Molecular recognition between
Escherichia coli enolase and ribonuclease E. Acta Crystallogr D Biol Crystallogr, 66(Pt 9),
1036-1040.
O'Leary, M. H., & Limburg, J. A. (1977). Isotope effect studies of the role of the metal ions in
isocitrate dehydrogenase. Biochemistry, 16(6), 1129-1135.
O'Reilly, M., & Devine, K. M. (1994). Sequence and analysis of the citrulline biosynthetic operon
argC–F from Bacillus subtilis. Microbiology, 140(5), 1023-1025.
Ochoa, S. (1955). Malic Dehydrogenase from Pig Heart. In S. P. Colowick & N. O. Kaplan (Eds.),
Methods in Enzymology (Vol. 1, pp. 735-739). New York: Academic Press, New York.
Oh, Y.-K., Palsson, B. O., Park, S. M., Schilling, C. H., & Mahadevan, R. (2007). Genome-scale
Reconstruction of Metabolic Network in Bacillus subtilis Based on High-throughput
Phenotyping and Gene Essentiality Data. J Biol Chem, 282(39), 28791-28799.
Ovádi, J., & Srere, P. A. (1996). Metabolic consequences of enzyme interactions. Cell Biochem Funct,
14(4), 249-258.
- 93 -
Bibliography
Owen, O. E., Kalhan, S. C., & Hanson, R. W. (2002). The Key Role of Anaplerosis and Cataplerosis for
Citric Acid Cycle Function. J Biol Chem, 277(34), 30409-30412.
Parche, S., Schmid, R., & Titgemeyer, F. (1999). The phosphotransferase system (PTS) of
Streptomyces coelicolor identification and biochemical analysis of a histidine phosphocarrier
protein HPr encoded by the gene ptsH. Eur J Biochem, 265(1), 308-317.
Parkinson, G., Wilson, C., Gunasekera, A., Ebright, Y. W., Ebright, R. E., & Berman, H. M. (1996).
Structure of the CAP-DNA Complex at 2.5 Å Resolution: A Complete Picture of the ProteinDNA Interface. J Mol Biol, 260(3), 395-408.
Parsot, C. (1986). Evolution of biosynthetic pathways: a common ancestor for threonine synthase,
threonine dehydratase and D-serine dehydratase. EMBO J, 5(11), 3013-3019.
Paulus, H. (1993). Biosynthesis of the aspartate family of amino acids. In J. A. Hoch, R. Losick & A. L.
Sonenshein (Eds.), Bacillus subtilis and other gram-positive bacteria: biochemistry,
physiology, and molecular genetics. (pp. 237-267). Washington, D.C.: American Society for
Microbiology.
Pietack, N., Becher, D., Schmidl, S. R., Saier, M. H., Hecker, M., Commichau, F. M., & Stulke, J.
(2010). In vitro Phosphorylation of Key Metabolic Enzymes from Bacillus subtilis: PrkC
Phosphorylates Enzymes from Different Branches of Basic Metabolism. J Mol Microbiol
Biotechnol, 18(3), 129-140.
Piggot, P. J., & Hilbert, D. W. (2004). Sporulation of Bacillus subtilis. Curr Opin Microbiol, 7(6), 579586.
Porpaczy, Z., Sümegi, B., & Alkonyi, I. (1983). Association between the α-ketoglutarate
dehydrogenase complex and succinate thiokinase. Biochim Biophys Acta, 749(2), 172-179.
Postma, P. W., Lengeler, J. W., & Jacobson, G. R. (1993). Phosphoenolpyruvate:carbohydrate
phosphotransferase systems of bacteria. Microbiol Rev, 57(3), 543-594.
Presecan-Siedel, E., Galinier, A., Longin, R., Deutscher, J., Danchin, A., Glaser, P., & MartinVerstraete, I. (1999). Catabolite regulation of the pta gene as part of carbon flow pathways
in Bacillus subtilis. J Bacteriol, 181(22), 6889-6897.
Ramström, H., Sanglier, S., Leize-Wagner, E., Philippe, C., Van Dorsselaer, A., & Haiech, J. (2003).
Properties and regulation of the bifunctional enzyme HPr kinase/phosphatase in Bacillus
subtilis. J Biol Chem, 278(2), 1174-1185.
Reizer, A., Deutscher, J., Saier, M. H., Jr., & Reizer, J. (1991). Analysis of the gluconate (gnt) operon
of Bacillus subtilis. Mol Microbiol, 5(5), 1081-1089.
- 94 -
Bibliography
Reizer, J., Bachem, S., Reizer, A., Arnaud, M., Saier, M. H., Jr., & Stülke, J. (1999). Novel
phosphotransferase system genes revealed by genome analysis - the complete complement
of PTS proteins encoded within the genome of Bacillus subtilis. Microbiology, 145 ( Pt 12),
3419-3429.
Reizer, J., Hoischen, C., Titgemeyer, F., Rivolta, C., Rabus, R., Stülke, J., Karamata, D., Saier, M. H.,
Jr., & Hillen, W. (1998). A novel protein kinase that controls carbon catabolite repression in
bacteria. Mol Microbiol, 27(6), 1157-1169.
Remington, S., Wiegand, G., & Huber, R. (1982). Crystallographic refinement and atomic models of
two different forms of citrate synthase at 2·7 and 1·7 Å resolution. J Mol Biol, 158(1), 111152.
Robinson, J. B., Inman, L., Sumegi, B., & Srere, P. A. (1987). Further characterization of the Krebs
tricarboxylic acid cycle metabolon. J Biol Chem, 262(4), 1786-1790.
Robinson, J. B., & Srere, P. A. (1985). Organization of Krebs tricarboxylic acid cycle enzymes in
mitochondria. J Biol Chem, 260(19), 10800-10805.
Rodionov, D. A., Vitreschak, A. G., Mironov, A. A., & Gelfand, M. S. (2003). Regulation of lysine
biosynthesis and transport genes in bacteria: yet another RNA riboswitch? Nucleic Acids Res.,
31(23), 6748-6757.
Rühl, M., Le Coq, D., Aymerich, S., & Sauer, U. (2012). 13C-flux Analysis Reveals NADPH-balancing
Transhydrogenation Cycles in Stationary Phase of Nitrogen-starving Bacillus subtilis. J Biol
Chem, 287(33), 27959-27970.
Russell, R. J. M., Ferguson, J. M. C., Hough, D. W., Danson, M. J., & Taylor, G. L. (1997). The Crystal
Structure of Citrate Synthase from the Hyperthermophilic Archaeon Pyrococcus furiosus at
1.9 Å Resolution. Biochemistry, 36(33), 9983-9994.
Russell, R. J. M., Hough, D. W., Danson, M. J., & Taylor, G. L. (1994). The crystal structure of citrate
synthase from the thermophilic Archaeon, Thermoplasma acidophilum. Structure, 2(12),
1157-1167.
Rygus, T., & Hillen, W. (1992). Catabolite repression of the xyl operon in Bacillus megaterium. J
Bacteriol, 174(9), 3049-3055.
Safina, G. (2012). Application of surface plasmon resonance for the detection of carbohydrates,
glycoconjugates, and measurement of the carbohydrate-specific interactions: A comparison
with conventional analytical techniques. A critical review. Anal Chim Acta, 712(0), 9-29.
- 95 -
Bibliography
Sambrook, J. G., Michael. (2012). Molecular Cloning: A Laboratory Manual (Vol. 4): Cold Spring
Harbor Laboratory.
Sanger, F., Nicklen, S., & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors.
Proceedings of the National Academy of Sciences of the United States of America, 74(12),
5463-5467.
Sauer, U., & Eikmanns, B. J. (2005). The PEP–pyruvate–oxaloacetate node as the switch point for
carbon flux distribution in bacteria. FEMS Microbiology Reviews, 29(4), 765-794.
Sauer, U., Hatzimanikatis, V., Bailey, J. E., Hochuli, M., Szyperski, T., & Wuthrich, K. (1997).
Metabolic fluxes in riboflavin-producing Bacillus subtilis. Nat Biotech, 15(5), 448-452.
Schnorpfeil, M., Janausch, I. G., Biel, S., Kröger, A., & Unden, G. (2001). Generation of a proton
potential by succinate dehydrogenase of Bacillus subtilis functioning as a fumarate
reductase. FEBS J, 268(10), 3069-3074.
Schumacher, M. A., Allen, G. S., Diel, M., Seidel, G., Hillen, W., & Brennan, R. G. (2004). Structural
basis for allosteric control of the transcription regulator CcpA by the phosphoprotein HPrSer46-P. Cell, 118(6), 731-741.
Schumacher, M. A., Choi, K. Y., Zalkin, H., & Brennan, R. G. (1994). Crystal structure of LacI member,
PurR, bound to DNA: minor groove binding by alpha helices. Science, 266(5186), 763-770.
Schumacher, M. A., Seidel, G., Hillen, W., & Brennan, R. G. (2006). Phosphoprotein Crh-Ser46-P
displays altered binding to CcpA to effect carbon catabolite regulation. J Biol Chem, 281(10),
6793-6800.
Schumacher, M. A., Sprehe, M., Bartholomae, M., Hillen, W., & Brennan, R. G. (2011). Structures of
carbon catabolite protein A-(HPr-Ser46-P) bound to diverse catabolite response element
sites reveal the basis for high-affinity binding to degenerate DNA operators. Nucleic Acids
Res., 39(7), 2931-2942.
Seidel, G. (2005). Interactions and molecular function of the transcriptional regulator CcpA from
Bacillus subtilis and B. megaterium. Phd thesis, Friedrich-Alexander University
Erlangen/Nürnberg, Erlangen.
Seidel, G., Diel, M., Fuchsbauer, N., & Hillen, W. (2005). Quantitative interdependence of
coeffectors, CcpA and cre in carbon catabolite regulation of Bacillus subtilis. FEBS J, 272(10),
2566-2577.
Seidl, K., Bischoff, M., & Berger-Bachi, B. (2008). CcpA mediates the catabolite repression of tst in
Staphylococcus aureus. Infect Immun, 76(11), 5093-5099.
- 96 -
Bibliography
Seidl, K., Muller, S., Francois, P., Kriebitzsch, C., Schrenzel, J., Engelmann, S., Bischoff, M., & BergerBachi, B. (2009). Effect of a glucose impulse on the CcpA regulon in Staphylococcus aureus.
BMC Microbiol, 9, 95.
Seidl, K., Stucki, M., Ruegg, M., Goerke, C., Wolz, C., Harris, L., Berger-Bachi, B., & Bischoff, M.
(2006). Staphylococcus aureus CcpA affects virulence determinant production and antibiotic
resistance. Antimicrob Agents Chemother, 50(4), 1183-1194.
Setlow, B., & Setlow, P. (1977). Levels of oxidized and reduced pyridine nucleotides in dormant
spores and during growth, sporulation, and spore germination of Bacillus megaterium. J
Bacteriol, 129(2), 857-865.
Shelburne, S. A., 3rd, Keith, D., Horstmann, N., Sumby, P., Davenport, M. T., Graviss, E. A., Brennan,
R. G., & Musser, J. M. (2008). A direct link between carbohydrate utilization and virulence in
the major human pathogen group A Streptococcus. Proc Natl Acad Sci U S A, 105(5), 16981703.
Shivers, R. P., Dineen, S. S., & Sonenshein, A. L. (2006). Positive regulation of Bacillus subtilis ackA by
CodY and CcpA: establishing a potential hierarchy in carbon flow. Mol Microbiol, 62(3), 811822.
Shivers, R. P., & Sonenshein, A. L. (2005). Bacillus subtilis ilvB operon: an intersection of global
regulons. Mol Microbiol, 56(6), 1549-1559.
Singh, K. D., Schmalisch, M. H., Stülke, J., & Görke, B. (2008). Carbon catabolite repression in
Bacillus subtilis: quantitative analysis of repression exerted by different carbon sources. J
Bacteriol, 190(21), 7275-7284.
Singh, R. K., Palm, G. J., Panjikar, S., & Hinrichs, W. (2007). Structure of the apo form of the
catabolite control protein A (CcpA) from Bacillus megaterium with a DNA-binding domain.
Acta Crystallogr Sect F Struct Biol Cryst Commun, 63(Pt 4), 253-257.
Singh, S. K., Matsuno, K., LaPorte, D. C., & Banaszak, L. J. (2001). Crystal structure of Bacillus subtilis
isocitrate dehydrogenase at 1.55 A. Insights into the nature of substrate specificity exhibited
by Escherichia coli isocitrate dehydrogenase kinase/phosphatase. J Biol Chem, 276(28),
26154-26163.
Singh, S. K., Miller, S. P., Dean, A., Banaszak, L. J., & LaPorte, D. C. (2002). Bacillus subtilis isocitrate
dehydrogenase. A substrate analogue for Escherichia coli isocitrate dehydrogenase
kinase/phosphatase. J Biol Chem, 277(9), 7567-7573.
Sonenshein, A. L. (2007). Control of key metabolic intersections in Bacillus subtilis. Nat Rev Microbiol,
5(12), 917-927.
- 97 -
Bibliography
Sousa, P. M. F., Silva, S. T. N., Hood, B. L., Charro, N., Carita, J. N., Vaz, F., Penque, D., Conrads, T.
P., & Melo, A. M. P. (2011). Supramolecular organizations in the aerobic respiratory chain of
Escherichia coli. Biochimie, 93(3), 418-425.
Sousa, P. M. F., Videira, M. A. M., Bohn, A., Hood, B. L., Conrads, T. P., Goulao, L. F., & Melo, A. M.
P. (2012). The aerobic respiratory chain of Escherichia coli: from genes to supercomplexes.
Microbiology, 158(Pt 9), 2408-2418.
Sprehe, M. (2007). Mechanismen der Katabolitenregulation in Bacilli. Phd thesis, Friedrich-Alexander
University Erlangen/Nürnberg, Erlangen.
Sprehe, M., Seidel, G., Diel, M., & Hillen, W. (2007). CcpA mutants with differential activities in
Bacillus subtilis. J Mol Microbiol Biotechnol, 12(1-2), 96-105.
Srere, P. A. (1985). The Metabolon. Trends Biochem Sci, 10(3), 109-110.
Stanley, N. R., Britton, R. A., Grossman, A. D., & Lazazzera, B. A. (2003). Identification of Catabolite
Repression as a Physiological Regulator of Biofilm Formation by Bacillus subtilis by Use of
DNA Microarrays. J Bacteriol, 185(6), 1951-1957.
Stein, T. (2005). Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol
Microbiol, 56(4), 845-857.
Steinert, N. (2011). Quantitative und qualitative Analyse der Transkription CcpA-regulierter Gene.
Phd thesis, University of Erlangen/Nürnberg, Erlangen.
Stoddard, B. L., Dean, A., & Koshland, D. E., Jr. (1993). Structure of isocitrate dehydrogenase with
isocitrate, nicotinamide adenine dinucleotide phosphate, and calcium at 2.5-A resolution: a
pseudo-Michaelis ternary complex. Biochemistry, 32(36), 9310-9316.
Strauch, M. A. (1995). In vitro binding affinity of the Bacillus subtilis AbrB protein to six different DNA
target regions. J Bacteriol, 177(15), 4532-4536.
Strauch, M. A., Spiegelman, G. B., Perego, M., Johnson, W. C., Burbulys, D., & Hoch, J. A. (1989).
The transition state transcription regulator abrB of Bacillus subtilis is a DNA binding protein.
EMBO J, 8(5), 1615-1621.
Studier, F. W., & Moffatt, B. A. (1986). Use of bacteriophage T7 RNA polymerase to direct selective
high-level expression of cloned genes. J Mol Biol, 189(1), 113-130.
Stülke, J., & Hillen, W. (2000). Regulation of carbon catabolism in Bacillus species. Annu Rev
Microbiol, 54, 849-880.
- 98 -
Bibliography
Tännler, S., Decasper, S., & Sauer, U. (2008). Maintenance metabolism and carbon fluxes in Bacillus
species. Microb Cell Fact, 7, 19.
Titgemeyer, F., & Hillen, W. (2002). Global control of sugar metabolism: a gram-positive solution.
Antonie Van Leeuwenhoek, 82(1-4), 59-71.
Tobisch, S., Zuhlke, D., Bernhardt, J., Stülke, J., & Hecker, M. (1999). Role of CcpA in regulation of
the central pathways of carbon catabolism in Bacillus subtilis. J Bacteriol, 181(22), 69967004.
Tojo, S., Satomura, T., Morisaki, K., Deutscher, J., Hirooka, K., & Fujita, Y. (2005). Elaborate
transcription regulation of the Bacillus subtilis ilv-leu operon involved in the biosynthesis of
branched-chain amino acids through global regulators of CcpA, CodY and TnrA. Mol
Microbiol, 56(6), 1560-1573.
Tompa, P., Batke, J., & Ovadi, J. (1987a). How to determine the efficiency of intermediate transfer in
an interacting enzyme system? FEBS letters, 214(2), 244-248.
Tompa, P., Batke, J., Ovadi, J., Welch, G. R., & Srere, P. A. (1987b). Quantitation of the interaction
between citrate synthase and malate dehydrogenase. J Biol Chem, 262(13), 6089-6092.
Tsuchiya, D., Shimizu, N., & Tomita, M. (2008). Versatile architecture of a bacterial aconitase B and
its catalytic performance in the sequential reaction coupled with isocitrate dehydrogenase.
Biochim Biophys Acta, 1784(11), 1847-1856.
Turinsky, A. J., Grundy, F. J., Kim, J. H., Chambliss, G. H., & Henkin, T. M. (1998). Transcriptional
activation of the Bacillus subtilis ackA gene requires sequences upstream of the promoter.
Cell, 180(22), 5961-5967.
Utagawa, T. (2004). Production of Arginine by Fermentation. J. Nutr., 134(10), 2854S-2857S.
Varga, J., Stirewalt, V. L., & Melville, S. B. (2004). The CcpA Protein Is Necessary for Efficient
Sporulation and Enterotoxin Gene (cpe) Regulation in Clostridium perfringens. J Bacteriol,
186(16), 5221-5229.
Varga, J. J., Therit, B., & Melville, S. B. (2008). Type IV Pili and the CcpA Protein Are Needed for
Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium
perfringens. Infect Immun, 76(11), 4944-4951.
Vélot, C., Mixon, M. B., Teige, M., & Srere, P. A. (1997). Model of a Quinary Structure between Krebs
TCA Cycle Enzymes: A Model for the Metabolon. Biochemistry, 36(47), 14271-14276.
- 99 -
Bibliography
Warner, J. B., & Lolkema, J. S. (2003). CcpA-dependent carbon catabolite repression in bacteria.
Microbiol Mol Biol R, 67(4), 475-490.
Weickert, M. J., & Adhya, S. (1992). A family of bacterial regulators homologous to Gal and Lac
repressors. J Biol Chem, 267(22), 15869-15874.
Weickert, M. J., & Chambliss, G. H. (1989). Genetic analysis of the promoter region of the Bacillus
subtilis alpha-amylase gene. J Bacteriol, 171(7), 3656-3666.
Weickert, M. J., & Chambliss, G. H. (1990). Site-directed mutagenesis of a catabolite repression
operator sequence in Bacillus subtilis. Proc Natl Acad Sci U S A, 87(16), 6238-6242.
Wiegand, G., & Remington, S. J. (1986). Citrate Synthase: Structure, Control, and Mechanism. Annu
Rev Biophys Biophys Chem, 15(1), 97-117.
Wu, H.-J., Yang, Y., Wang, S., Qiao, J.-Q., Xia, Y.-F., Wang, Y., Wang, W.-D., Gao, S.-F., Liu, J., Xue,
P.-Q., & Gao, X.-W. (2011). Cloning, expression and characterization of a new aspartate
aminotransferase from Bacillus subtilis B3. FEBS J, 278(8), 1345-1357.
Wünsche, A. (2012). Identification and characterization of novel interaction partners of CcpA in
Bacillus subtilis. Phd-thesis, Friedrich-Alexander University Erlangen/Nürnberg, Erlangen.
Wünsche, A., Hammer, E., Bartholomae, M., Völker, U., Burkovski, A., Seidel, G., & Hillen, W.
(2012). CcpA forms complexes with CodY and RpoA in Bacillus subtilis. FEBS J, 279(12), 22012214.
Yankovskaya, V., Horsefield, R., Törnroth, S., Luna-Chavez, C., Miyoshi, H., Léger, C., Byrne, B.,
Cecchini, G., & Iwata, S. (2003). Architecture of Succinate Dehydrogenase and Reactive
Oxygen Species Generation. Science, 299(5607), 700-704.
Yasutake, Y., Watanabe, S., Yao, M., Takada, Y., Fukunaga, N., & Tanaka, I. (2003). Crystal Structure
of the Monomeric Isocitrate Dehydrogenase in the Presence of NADP+. J Biol Chem, 278(38),
36897-36904.
Yin, Y., & Kirsch, J. F. (2007). Identification of functional paralog shift mutations: conversion of
Escherichia coli malate dehydrogenase to a lactate dehydrogenase. Proc Natl Acad Sci U S A,
104(44), 17353-17357.
Yoshida, A. (1965). Enzymic Properties of Malate Dehydrogenase of Bacillus subtilis. J Biol Chem, 240,
1118-1124.
- 100 -
Bibliography
Yoshida, K., Miwa, Y., Ohmori, H., & Fujita, Y. (1995). Analysis of an insertional operator mutation
(gntOi) that affects the expression level of the Bacillus subtilis gnt operon, and
characterization of gntOi suppressor mutations. Mol Gen Genet, 248(5), 583-591.
Zeigler, D. R., Pragai, Z., Rodriguez, S., Chevreux, B., Muffler, A., Albert, T., Bai, R., Wyss, M., &
Perkins, J. B. (2008). The origins of 168, W23, and other Bacillus subtilis legacy strains. J
Bacteriol, 190(21), 6983-6995.
Zheng,
J., & Jia, Z. (2010). Structure of the bifunctional isocitrate
kinase/phosphatase. Nature, 465(7300), 961-965.
- 101 -
dehydrogenase
Abbreviation index
8 Abbreviation index
% (v/v)
% (w/v)
APS
ATP
Axnm
B.
bp
BSA
Cam
cAMP
CAP
CcpA
CCR
CitB
CitZ
CRP
DNA
DNaseI
DTT
E.
EDTA
et al.
EtOH
F-6-P
FBP
Fig.
g
Glc-6-P
HEPES
HPr
HPrSer46P
HTHLH
Icd
IcdS104P
IPTG
ka
Kam
KD
kd
LB
Mdh
Mg
NAD(P)H
% (volume/volume)
% (weight/volume)
Ammonium peroxodisulfate
Adenosine triphosphate
Absorption at λ=x nm
Bacillus
base pairs
bovine serum albumin
Chloramphenicol
cyclic Adenosinemonophosphate
Catabolite activator protein
Catabolite control protein A
carbon catabolite regulation
Aconitase
Citrate synthase
cAMP receptor protein
Desoxyribonucleic acid
Desoxyribonuclease I
dithiothreitol
Escherichia
Ethylendiamin tetraacetate
„et alii“ (and others)
Ethanol
fructose-6-phosphate
fructose-1,6-bisphosphate
figure
gravity (9.81 m/s2)
glucose-6-phosphate
4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid
Histidin containing protein
histidine containg protein phosphorylated at serine 46 residue
Helix-turn-helix-loop-helix
Isocitrate dehydrogenase
Isocitrate dehydrogenase mutant with serine 104 exchange to
proline
Isopropyl β-D thiogalactopyranoside
Association rate constant
Kanamycin
Dissociation constant
Dissociation rate constant
Luria-Bertani (broth)
Malate dehydrogenase
Magnesium
β Nicotinamide adenine dinucleotide hydrate (2-phosphate)
- 102 -
Abbreviation index
NTA
ODx
P
p. a.
PAA
PAGE
PCR
PEP
PMSF
PTS
R
RNase A
rpm
RT
RU
SDS
SPR
TAE
TBE
TCA cycle
TE
TEMED
Tris
Tris
v
w
wt
β-ME
Nitrilotetraacidic acid
Optical density at λ=x nm
phosphate
„pro analysi“
polyacrylamide
polyacrylamide gel electrophoresis
polymerase chain reaction
phosphoenolpyruvate
Phenylmethylsulfonylfluorid
phosphoenolpyruvate:sugar phosphotransferase system
resistance
ribonuclease A
revolutions per minute
room temperature
reponse units
sodiumdocecylsulfate
Surface plasmon resonance
Tris-acetate-EDTA buffer
Tris-borate-EDTA buffer
tricarboxylic acid cycle
Tris-EDTA
N,N,N’,N’-Tetramethylethylendiamine
Tris-(hydroxymehtyl)-aminomethan
2-Amino-Hydroxymethylpropan-1,3-diol
Volume
weight
wild-type
β-mercaptoethanol
Units
‘
°C
Da
g
h
l
M
m
min
s
T
t
U
V
W
minute
Degree Celsius
Dalton (g/mol)
gram
hour
liter
mol/liter
meter
minute
second
temperature
time
Units of enzymatic activity
volt
watt
- 103 -
Abbreviation index
Dimensions
3
k
kilo (10 )
m
milli (10 )
μ
micro (10 )
n
nano (10 )
p
pico (10 )
f
femto (10 )
-3
-6
-9
-12
-15
Nucleotides
A
C
G
T
N
R
S
Y
W
Adenosine
Cytidine
Guanosine
Thymidine
A, C, G, T
G, A
C, G
C, T
A, T
Amino acid nomenclature (according to IUPAC, 1969)
A
C
D
E
F
G
H
I
K
L
M
N
P
Q
R
S
T
V
W
Y
Ala
Cys
Asp
Glu
Phe
Gly
His
Ile
Lys
Leu
Met
Asn
Pro
Gln
Arg
Ser
Thr
Val
Trp
Tyr
Alanine
Cysteine
Aspartate
Glutamate
Phenylalanine
glycine
Histidine
Isoleucine
Lysine
Leucine
Methionine
Asparagine
Proline
Glutamine
Arginine
Serine
Threonine
Valine
Tryptophan
Tyrosine
- 104 -
- 105 -
Publications
Publications
Schumacher, M. A., Sprehe, M., Bartholomae, M., Hillen, W., & Brennan, R. G. (2011). Structures of
carbon catabolite protein A-(HPr-Ser46-P) bound to diverse catabolite response element sites reveal
the basis for high-affinity binding to degenerate DNA operators. Nucleic Acids Res., 39(7), 2931-2942.
Wünsche, A., Hammer, E., Bartholomae, M., Völker, U., Burkovski, A., Seidel, G., & Hillen, W.
(2012). CcpA forms complexes with CodY and RpoA in Bacillus subtilis. FEBS J, 279(12), 2201-2214.
- 106 -
Versicherung an Eides statt
Versicherung an Eides statt
Hiermit erkläre ich an Eides statt, dass ich diese Arbeit selbstständig verfasst und keine
anderen als die von mir angegebenen Quellen und Hilfsmittel verwendet habe.
Erlangen, den 04.02.2013
- 107 -