Download Supplementary Methods

Supplementary Methods
RNAi libraries. DNA templates for dsRNAs targeting Dacapo, dMyc, geminin, and
double parked were generated by amplifying approx. 500 bp fragments from Drosophila
melanogaster SD Schneider cell cDNA library (Berkeley Drosophila Genome Project)
with primers containing the 5' T7 RNA polymerase recognition sequence
gaattaatacgactcactatagggaga. The specific 3' forward and reverse sequences used were the
following: Dacapo: GTTCTGCAAGATGAGCAGCA,
CGCAGGACTATGGAGGATGT; dMyc: AGCATCACCACCAACAACAA,
TTGACTGCGAACTGGAACTG; geminin: GCAGCAGAGACAGACCCTGA,
TGTCCTCGTCACCCGTAGTG; double parked: CCAGTAAGCTGGACGAGGAG,
GCTTGGAGACGTCAGTGTGA.
Although current best statistical models estimate that Drosophila melanogaster has
14 000 protein coding genes, the transcripts corresponding to these genes are not all
known1, precluding genome-wide RNAi analyses. Currently, two gene collections are
available (DGC1 and DGC2), which cover 70% of annotated Drosophila genes. The
DGC2 was transcribed as follows. First, PCR products containing the full-length
sequences flanked with T7 polymerase sites were amplified from using primers
containing a high efficiency 5' T7 RNA polymerase recognition sequence
taatacgactcactatagggaga, and the following vector-specific 3' forward and reverse
sequences: pOT2: CCGACGTTAGAACGCGGCTACAATTAATAC,
GGCTGATATCATCGCCACTGTGCTGGG; pOTB7:
CCGTAAGGTAGCGAGGCCTGGGTGGC,
GGCTTTCTCCGCACCCGACATAGATGC; pFLC1:
CCGCCAAATCGGCCGAGCTCGAATTC,
GGCCGAAGGATCAGGCCCTTATGGCC; pBS:
CCGCGAATTGGGTACCGGGCCCCC, GGCCGCTCTAGAACTAGTGGATCC. The
PCR conditions were as follows: 1x AmpliTaq Gold reaction buffer, 1.5 µl bacterial
glycerol stock as template, 0.25 mM dNTP, 2.5 mM MgCl2, 2% DMSO, 0.6 U
AmpliTaq Gold Taq DNA polymerase, 0.06 U Phusion DNA polymerase, 62.5 nM
primers. Reactions were performed in 20 µl volume in 384 well plates, using initial
denaturation at 96°C for 5 min, followed by 32 cycles (denaturation at 96°C for 45 sec,
annealing at 60°C for 30 sec, elongation at 72°C for 7 min).
dsRNAs were generated using the Megascript kit (Ambion) according to
manufacturer’s instructions. dsRNA concentration was measured using PicoGreen
double-stranded nucleic acid specific probe, and concentrations adjusted using injectors
of BMG FluoStar Optima multilabel reader. Samples, which failed in PCR or in making
the dsRNA were omitted from analysis. dsRNA libraries targeting all protein and lipid
kinases (except 6 kinases: Gprk1, gskt, Gs2, Taf1, Dyrk3, CG5483) and phosphatases
and the Drosophila Gene Collection release 1 were a kind gift from Drs. Lawrence Lum
and Philip A. Beachy. The DGC libraries occasionally contain clones where sequences
from two genes are ligated during cDNA cloning. In such cases, both of the genes are
indicated separated by a plus-sign, as the dsRNA transcribed from such a clone will
target both genes.
The T7 RNA polymerase site -containing DNA products of an independent RNAi
library (Drosophila RNAi library, MRC Geneservice) were used for generation of
dsRNAs for re-testing and double RNAi analyses. Because of significant number of
wrong clones in the MRC library, all constructs were sequenced.
Antibodies and western blotting. Antibodies to p38MAPK (sc-15715), Cdc2 p34
(PSTAIRE; sc-53), CycD (sc-25765), CycB (sc-15872), CycE (sc-15905), p27 (sc-528)
and Rb (sc-50) were from Santa Cruz Biotechnology, anti-Cul-1 (cat.no. 71-8700) was
from Zymed, anti-phospho-MEK3/6 (cat.no. 9231) was from Cell Signaling Technology,
and FITC-conjugated anti--tubulin (cat.no. F2168) was from Sigma. Western blotting
was performed using biotinylated secondary antibodies and horseradish peroxidase
conjugated Streptavidin followed by enhanced chemiluminescence reaction (ECL+,
Amersham), essentially as described2.
Data analysis. Flow cytometry graphs were analyzed computationally using FACSDiva
(Beckton Dickinson, FACSArray; DGC screen) or ModFit (LSR; phospho screen)
software. To control for differences in culture conditions between batches of culture
plates and for the well-dependent drift caused by the instrument, we normalized all plate
averages to global average, and subsequently normalized intraplate data so that a least
squares fit across the plate yielded a horizontal line. Finally, the results from individual
wells were normalized to their row and column averages, respectively. Each step in this
normalization process significantly increased signal to noise ratio based on both internal
negative controls (cells incubated with transfection reagents with no dsRNA) and a
decrease in global average standard error. Similar results were observed using controls
targeting non-specific sequences or lacking dsRNA and the mean of controls lacking
dsRNA and all screened samples was similar, indicating that inclusion of non-specific
dsRNA did not result in any cell cycle or cell size phenotype. Both difference from the
mean and standard error of individual measurements were used in scoring; the averages
with standard errors for all samples and the specific criteria for scoring hits for the
different phenotypes are described in Tables S2 and S3, respectively. For hierarchical
clustering, the data was further mean-centered and the phenotypes normalized to the
same range (equal weight for each phenotype). The clustering (centroid linkage) was
performed using Pearson correlation distance metric with the program Cluster, and the
data was visualized using TreeView.
References
1.
2.
Yandell, M. et al. A computational and experimental approach to validating
annotations and gene predictions in the Drosophila melanogaster genome.
Proc Natl Acad Sci U S A 102, 1566-71 (2005).
Tsubari, M., Taipale, J., Tiihonen, E., Keski-Oja, J. & Laiho, M. Hepatocyte
growth factor releases mink epithelial cells from transforming growth factor
beta1-induced growth arrest by restoring Cdk6 expression and cyclin Eassociated Cdk2 activity. Mol Cell Biol 19, 3654-63 (1999).