Download Real time PCR

Supplementary Methods
Khoo et al
Cell Culture
Rat neonatal ventricular cardiomyocytes were prepared from hearts of 24~36hour-old
Sprague–Dawley rats as described.(1) After separation from nonmyocyte fibroblasts
through preplating in complete medium (10%FBS, 10% HS, 40%DMEM, 40% Ham’s
F10), myocytes were replated at a density of approximately 3x105 to 35mm plates
(Becton Dickinson) precoated with 0.1mg/ml human fibronectin in Ham’s F10, and
12~24 hours later, these cells were grown in defined medium (1:1 DMEM-F10 mixture),
supplemented with 1μg/ml Insulin, 5μg/ml Transferring, 1nmol/L LiCl, lnmol/L NaSeO4,
0.25μg/ml Ascorbic acid, 1μg/ml Thyroxine, 100 units/ml penicillin, 100μg/ml
streptomycin, and 0.1 mmol/L BrdUrd. The inclusion of BrdUrd resulted in inhibition of
the growth of cardiac fibroblasts. These cells were seated in defined medium for 24 hours
before infection.
For Ad-mediated gene delivery, cells were infected with Ad5CMVeGFP or
AdCMVCnA-GFP (encoding constitutively active CAN) at 10 multiplicity of infection
each (MOI). After infection (12–16h), cells were washed three times and maintained in
defined medium. 48 hours post infection, the infected cells were fixed for microscopy, or
mRNA extraction and analyzed using real-time reverse transcription polymerase chain
reaction (RT-PCR). CAN over-expression was confirmed by immunoblot analysis with
anti- CAN antibody.
Analysis of BNP, alpha-MHC, and beta-MHC mRNA by Real-Time PCR
Total RNA from transgenic mice and control littermates was prepared from frozen heart
tissues using RNAwiz reagent (Ambion). Reverse transcription (RT) was performed
using the Taqman RT kit (Applied Biosystems) with 2 g total RNA and 2.5 M random
hexamer primers at 48 oC for 30 min. For CaMKII quantitative RT-PCR, total cellular
RNA from untreated, GFP, or CAN-GFP adenovirus-transduced rat neonatal
cardiomyocytes were isolated using RNeasy mini kit (Qiagen). RT was performed using
1.5 M oligo(dT)16 primers with 0.5 g total RNA at 42o C for 30 min using Multiscribe
reverse transcriptase enzyme (Roche). Quantitative PCR(qPCR) reactions were
performed using iQ SYBR Supermix and iCycler-IQ5 instrument (BioRad).
Real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad) and an iCycler (Bio-Rad). The reactions contained 2 L of cDNA, 500 nM sense and antisense
primers, and 1x iQ Sybr Green Supermix in a total volume of 50 L. The sequences of
the primers were as follows: BNP sense, ATGGATCTCCTGAAGGTGCTG; BNP
antisense, GTGCTGCCTTGAGACCGAA; -MHC sense, TGTGGTGCCTCGTTCCA;
-MHC antisense, TTTCGGAGGTACTGGGCTG; -MHC sense, GCATTCTCCTGCT
GTTTCCTT; -MHC antisense, TGGATTCTCAAACGTGTCTAGTGA; 28S RNA
sense, GTTCACCCACTAATAGGGAACGTGA; 28S RNA antisense,
GGATTCTGACTTAGAGGCGTTCAGT; CaMKII sense CTGGCACACCT
GGGTATCTT; CaMKII antisense ATCCCAGAAGGGTGGGTATC; Hprt sense
GGACCTCTCGAAGTGTTGGATAC; Hprt antisense GCTCATCTTAGGCTTTGTAT
TTGGCT (2,3). Real-time PCR for 28S, BNP, -MHC, and -MHC cDNAs was
performed according to the following conditions: 15 sec at 94oC for denaturation, 25 sec
at 58oC for annealing, and 40 sec72oC for extension. Gene specific standard curves were
generated using the cDNA of interest and serially diluting it to generate concentrations
ranging over two to four orders of magnitude. Data analysis was performed with i-Cycler
software (Bio Rad). BNP, -MHC, -MHC mRNA were normalized to 28S RNA,
whereas CaMKIId mRNA was normalized to HPRT mRNA. Data were then analyzed
using the 2-Ct method (4).
Arrhythmia scoring in ECG telemetered mice
Arrhythmias were analyzed over 30 min, categorized into 5 groups and assigned point
values for purposes of quantification and statistical comparison: no arrhythmias (0
points), premature atrial or ventricular contractions (1 point), supraventricular
tachycardia, paired premature ventricular contractions, or T wave alternans (2 points),
premature ventricular beats in a trigeminal or bigeminal pattern or non-sustained
ventricular tachycardia (defined as > 3 and < 10 consecutive premature ventricular
contractions) (3 points), sustained ventricular tachycardia (defined as > 10 consecutive
premature ventricular contractions) or polymorphic ventricular tachycardia or Torsade de
Pointes (4 points). The arrhythmia burden was defined as the number of scored
arrhythmia events telemetered in thirty minutes and the arrhythmia burden product was
determined by multiplying the arrhythmia score by the arrhythmia burden. Mice were
treated with the CaMKII inhibitory agent KN-93 (10 mol/kg, i.p.), the calmodulin
inhibitor W-7 (25 mol/kg, i.p.), or the inactive congener KN-92 (30 mol/kg, i.p.) 10
minutes prior to arrhythmia induction with isoproterenol (100 g, i.p.). KN-93 and KN-
92 were tested on each mouse on different days. ECGs were recorded from
unanesthetized and unrestrained mice with implanted telemeters for 30 min after
isoproterenol injection. Recordings were analyzed off line by blinded observers (MSCK
or PK).
Immunobloting studies
Whole heart extracts were subjected to immunoblot analysis using an affinity-purified
rabbit anti-CAN antibody (pan-A, Chemicon), a goat anti-CaMKII antibody, rabbit antiryanodine receptors (RyR, a gift from Dr. Andrew Marks), phospholamban (PLN,
Cylacel) and the sarcoplasmic endoplasmic reticulum ATPase (SERCA 2a, Santa Cruz),
as previously described (5). Heart extracts (10-50 g of protein/lane) were separated on
SDS-polyacrylamide gels (10%, except RyR on 6% SDS-PAGE) and electrophoretically
transferred to PVDF membrane (Immobilon P, Milipore) in 10 mM CAPS (pH 11)
containing 10% methanol (1 h at 25 volts). Proteins on the membrane were visualized
with Ponceau S, followed by washing in TBS-T (50 mM Tris-HCl, pH 7.6, 150 mM
NaCl, and 0.05% Tween 20). The membrane was blocked in TBS-T containing 10%
milk powder, followed by incubation with the primary antibody diluted in TBS-T/5%
milk powder. After washing, the membranes were incubated with Fluor- or horseradish
peroxidase (HRP)-conjugated secondary antibodies; bound antibodies for CAN and
CaMKII were visualized using the Odyssey Infrared Imaging system (LiCor) or the
SuperSignal chemiluminescence detection system (Pierce).
visualized using LumiLight ECL reagent (Roche).
Other antibodies were
TUNEL Staining
Tissue sections were permeated with proteinase K (20 g/ml in 10 mM Tris/Hcl, PH 7.4)
for 20 min (37 C) and stained with labeling solution (including rhodamine-labeled dNTP
and DNA polymerase).
The tissue sections were pre-treated with DNAse I (100
Units/ml) for 15 min for positive controls, while DNA polymerase was omitted for
negative controls. Dapi (Vector laboratory, 1 g/ml 4’, 6-diamidino-2-phenylindole) was
used for nuclear staining, and myocytes were identified by expression of eGFP.(5)
Tissue sections were examined with an epi-fluorescent microscope (Olympus BX41).
Only cells with TUNEL stained nuclei that were clearly identified as myocytes were
counted and expressed as the number of cells/transverse section of left ventricle.
References
1. Purcell NH, Tang G, Yu C, et al. Activation of NF-kappa B is required for
hypertrophic growth of primary rat neonatal ventricular cardiomyocytes. Proc Natl Acad
Sci U S A. Jun 5 2001;98(12):6668-6673.
2. LaPointe, Margot C., Mendez, Mariela, Leung, Alicia, Tao, Zhenyin, Yang, XiaoPing, Inhibition of cyclooxygenase-2 improves cardiac function after myocardial
infarction in the mouse. Am J Physiol Heart Circ Physiol 286: H1416-H1424, 2004.
3. Gaussin, Vinciane, Tomlinson, James E., Depre, Christophe, Engelhardt, Stefan,
Antos, Christopher, Takagi, Gen, Hein, Lutz, Topper, James N., Liggett, Stephen B.,
Olson, Eric N., Lohse, Martin J., Vatner, Stephen F., Vatner, Dorothy E., Common
genomic response in different mouse models of beta-adrenergic-induced cardiomyopathy.
Circulation 108: 2926-2933, 2003.
4. Livak, Kenneth J. and Schmittgen, Thomas D., Analysis of relative gene expression
data using real-time quantitative PCR and the 2-Ct method. Methods 25: 402-408, 2001.
5. Zhang R, Khoo MS, Wu Y et al. Calmodulin kinase II inhibition protects against
structural heart disease. Nat Med 2005;11:409-17.