* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Experimental Evidence for DNA
Survey
Document related concepts
Transcript
Experimental Evidence for DNA Evidence 1: This data shows the DNA base sequences in part of a gene that different species of whales and dolphins have in common: Fin whale Humpback whale Sperm whale Bottlenose dolphin Harbor porpoise TAAACCCCAATAGTCACAAAACAAGACTATTCGCCAGAGTACTACTAGCAAC TAAACCCTAATAGTCACAAAACAAGACTATTCGCCAGAGTACTACTAGCAAC TAAACCCAGGTAGTCATAAAACAAGACTATTCGCCAGAGTACTACTAGCAAC TAAACTTAAATAATCCCAAAACAAGATTATTCGCCAGAGTACTATCGGCAAC TAAACCTAAATAGTCCTAAAACAAGACTATTCGCCAGAGTACTATCGGCAAC Complete the table to show the number similarities between each of these sequences: Sperm Whale Bottlenose dolphin 43 Harbor porpoise 45 Fin whale Sperm whale 41 45 48 48 43 Humpback whale Bottlenose dolphin Harbor porpoise 40 Complete the phylogenetic tree for these whales: Common ancestor of all whales Explain how you came to these conclusions: ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… Evidence 2 DNA was extracted from 4 of the great ape species. They hybridized the human DNA with each of the other 3 species. Therefore, each sample had DNA with one human strand and a strand from the other species. Then, their DNA was heated to separate the DNA strands in the double helix. They measure the heat required to separate 50% of the DNA. Species from which hybrid DNA was produced Separation temperature / oC Human Chimpanzee 1.6 Human Gorilla 2.3 Human Orangutan 3.6 Complete the phylogenetic tree for these apes: Common ancestor of the 4 species Explain how you came to these conclusions: ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… ………………………………………………………………………………………………………… Evidence 3 The amino acid sequences of one of the polypeptide chains of hemoglobin from nine animals were determined. The results are shown in the table: Type of hemoglobin Human Gorilla Gibbon Rhesus monkey Horse Kangaroo Chicken Frog Sea slug Number of amino acids different from human hemoglobin 0 1 2 8 25 38 45 67 127 Construct a possible phylogenetic tree using this information: Evidence 4 A rabbit was injected with a sample of human blood. The rabbit’s serum was later mixed with samples of serum from a human, a chimpanzee, a gorilla, an orangutan, a gibbon and a rhesus monkey. Draw a graph to predict the relationship between each of these species and the degree of precipitation. Express the degree of precipitation as a percentage of the precipitation achieved by the human serum.