Download Antibiotic Resistance in Wastewater

Linköping University Medical Dissertations No. 1128
Antibiotic Resistance in Wastewater
Methicillin-resistant Staphylococcus aureus (MRSA)
and antibiotic resistance genes
Stefan Börjesson
Division of Medical Microbiology
Department of Clinical and Experimental Medicine
Faculty of Health Sciences
Linköping University
SE-581 85 Linköping Sweden
Linköping 2009
Antibiotic Resistance in Wastewater
- Methicillin-resistant Staphylococcus aureus (MRSA) and antibiotic resistance genes
ISBN: 978-91-7393-629-3
ISSN: 0345-0082
© Stefan Börjesson
All previously published papers, figures, and tables are reprinted with the permission from the respective
publisher
Cover art: Trickling filters at Ryaverket, Göteborg, Sweden. Photo by: Stefan Börjesson.
The work in this thesis was financed by: The Swedish Research Council for Environment, Agriculture Science
and Spatial Planning, The Medical Research Council of South Eastern Sweden (FORSS) and County Council of
Östergötland, Sweden.
Printed by LiU-Tryck, Linköping, Sweden, 2009
“Don't make fun of graduate students. They just made a
terrible life choice”
-
Marge Simpson (The Simpsons)
Modified from the Cartoon by Nick D Kim
Till Far och Mor
Abstract
A large part of the antibiotics consumed ends up in wastewater, and in the wastewater the
antibiotics may exert selective pressure for or maintain resistance among microorganisms.
Antibiotic resistant bacteria and genes encoding antibiotic resistance are commonly detected
in wastewater, often at higher rates and concentrations compared to surface water.
Wastewater can also provide favourable conditions for the growth of a diverse bacterial
community, which constitutes a basis for the selection and spread of antibiotic resistance.
Therefore, wastewater treatment plants have been suggested to play a role in the
dissemination and development of antibiotic resistant bacteria. Methicillin-resistant
Staphylococcus aureus (MRSA) is a large problem worldwide as a nosocomial pathogen, but
knowledge is limited about occurrence in non-clinical environments, such as wastewater, and
what role wastewater plays in dissemination and development of MRSA.
In this thesis we investigated the occurrence of MRSA in a full-scale wastewater treatment
plant (WWTP). We also investigated the concentration of genes encoding resistance to
aminoglycosides (aac(6’)-Ie+aph(2’’)), β-lactam antibiotics (mecA) and tetracyclines (tetA
and tetB) in three wastewater-associated environments: (1) soil from an overland flow area
treating landfill leachates, (2) biofilm from a municipal wastewater treatment plant, and (3)
sludge from a hospital wastewater pipeline. In addition, concentrations of mecA, tetA and
tetB were investigated over the treatment process in the WWTP. These investigations were
performed to determine how the prevalence and concentration of MRSA and the antibiotic
resistence genes are affected in wastewater and wastewater treatment processes over time.
The occurrence of MRSA was investigated by cultivation and a commercially available realtime PCR assay. In order to determine concentrations of the genes aac(6’)-Ie+aph(2’’), mecA,
tetA and tetB in wastewater we developed a LUXTM real-time PCR assay for each gene.
Using cultivation and real-time PCR we could for the first time describe the occurrence of
MRSA in wastewater and show that it had a stable occurrence over time in a WWTP. MRSA
could mainly be detected in the early treatment steps in the WWTP, and the wastewater
treatment process reduced the number and diversity of cultivated MRSA. However, our
results also indicate that the treatment process selects for strains with more extensive
resistance and possibly higher virulence. The isolated wastewater MRSA strains were shown
to have a close genetic relationship to clinical isolates, and no specific wastewater lineages
V
could be detected, indicating that they are a reflection of carriage in the community. Taken
together, these data indicate that wastewater may be a potential reservoir for MRSA and that
MRSA are more prevalent in wastewater than was previously thought.
The real-time PCR assays, for aac(6’)-Ie+aph(2’’), mecA, tetA, and tetB that we developed,
were shown to be sensitive, fast, and reproducible methods for detection and quantification of
these genes in wastewater environments. The highest concentrations of all genes were
observed in the hospital pipeline, and the lowest in the overland flow system, with tetA and
aac(6´)-Ie+aph(2´´) detected in all three environments. In the full-scale WWTP, we
continuously detected mecA, tetA and tetB over the treatment process and over time. In
addition, it was shown that the treatment process reduces concentrations of all three genes.
The data presented in this thesis also indicate that the reduction for all three genes may be
connected to the removal of biomass, and in the reduction of tetA and tetB, sedimentation and
precipitation appear to play an important role.
VI
Populärvetenskaplig sammanfattning
Resistenta gula stafylokocker (MRSA) och antibiotikaresistensgener förekommer i
svenskt kommunalt avloppsvatten
Methicillinresistenta Staphylococcus aureus (MRSA), även kända som resistenta gula
stafylokocker, är en bakterieart som utvecklat resistens mot alla penicilliner och
penicillinliknande antibiotika (β-laktam antibiotika). Detta innebär stora problem inom
sjukvården eftersom β-laktamerna är den vanligast använda antibiotikaklassen. S. aureus
ingår ofta i normalfloran hos en stor del av befolkningen men är också en opportunistisk
patogen som kan orsaka en rad olika sjukdomar. Bland annat är S. aureus den främsta orsaken
till variga sårinfektioner men den kan också orsaka allvarligare sjukdomar som t ex
blodförgiftning, lung- och hjärnhinneinflammation. De vårdrelaterade sjukdomarna (populärt
kallad sjukdomssjukan) utgörs till stor del av S. aureus infektioner. I stora delar av världen
dominerar nu MRSA över de methicillinkänsliga S. aureus vid infektioner inom sjukvården,
vilket leder till längre sjukhusvistelser, högre dödlighet och högre kostnader för samhället.
MRSA i Sverige är fortfarande ganska ovanligt men trenden är här som i övriga världen en
ökning i antalet MRSA infektioner. Hur spridning och utveckling av MRSA sker i sjukvården
är utförligt studerat, men vilken roll andra miljöer har för spridning och utveckling av MRSA
är mindre känt.
I denna avhandling har vi försökt öka kunskapen om förekomst av MRSA i
ickekliniska miljöer. Syftet var att undersöka om MRSA kan förekomma i avloppsvatten och
hur MRSA och förekomsten av genen mecA (som ger methicillinresistensen hos
stafylokocker) påverkas av reningsprocesserna i ett kommunalt avloppsvattenreningsverk.
Dessutom ville vi bestämma släktskap mellan MRSA i avloppsvattnet och MRSA inom
sjukvården. För att kunna utföra projektet samlades vattenprover in från ett kommunalt
avloppsvattenreningsverk. I verket togs vattenprover från flera provpunkter som var utvalda
för att täcka upp de olika stegen i reningsprocessen. MRSA i avloppsvattnet identifierades
dels genom odling från vattnet men också genom identifiering av MRSA-DNA med hjälp av
en känslig molekylärbiologisk metodik, en så kallad realtids-PCR. För att identifiera och
koncentrationsbestämma mecA genen i avloppsvatten utvecklade vi en helt ny realtids-PCR.
Med hjälp av de utvalda metoderna kunde vi för första gången observera MRSA i
avloppsvatten. Våra resultat visar att MRSA främst förekommer under ett tidigt skede i
reningsprocessen och att det sker en minskning av MRSA i både antal och variationsrikedom.
Det finns en antydan till att det under reningsprocessen också sker ett urval mot MRSA med
VII
utvidgad antibiotikaresistens och möjligen högre virulens. När MRSA stammarna från
avloppsvattnet jämfördes med de 20 vanligaste inom sjukvården isolerade MRSA stammar i
Sverige 2007 – 2008 visade resultaten att samma MRSA stammar förekom i avloppsvattnet
eller att stammarna var närbesläktade med sjukvårdsstammarna. Våra resultat tyder därför på
att MRSA som hittats i avloppsvattnet är en spegling av bärandet i samhället. Resultatet av
projektet visar också att mecA koncentrationen varierar över året men att någon klar trend ej
kan ses. Vid en jämförelse mellan obehandlat och behandlat avloppsvatten kunde vi i de flesta
proverna observera en sänkning av mecA koncentrationen, sänkningen varierade mellan 3 och
300 ggr.
Utöver undersökning av MRSA och mecA genen utvecklades i doktorandprojektet
realtids-PCR för att identifiera och kvantifiera gener som ger resistens mot aminoglykosider
och tetracykliner, vilka är två vanligt använda antibiotikaklasser. Målet var att använda
realtids-PCR för att undersöka förekomsten och koncentrationen av generna i olika miljöer
kopplade till avloppsvatten. Generna som undersöktes var aac(6’)-Ie+aph(2’’) som ger
bakterier resistens mot aminoglykosidantibiotika, samt generna tetA och tetB som ger
gramnegativa bakterier resistens mot tetracyklinantibiotika. Tillsammans med den utvecklade
metoden för kvantifiering av genen mecA, användes dessa fyra metoder på tre olika
avloppsvattenmiljöer: jordprov från en översilningsvåtmark behandlad med lakvatten,
biofilmprov från ett kommunalt reningsverk samt slamprov från ett sjukhusavlopp. De
utvecklade metoderna visade en hög tillförlitlighet för identifiering och kvantifiering av de
aktuella generna i avloppsvattenmiljöerna. De högsta koncentrationerna av alla gener kunde
detekteras i sjukhusavloppet och de lägsta koncentrationerna i översilningsvåtmarken.
Förekomst och koncentration av generna tetA och tetB undersöktes också i det kommunala
avloppsvattenreningsverket
och
hur
koncentrationerna
av
generna
påverkas
av
reningsprocessen. Våra mätningar visade att koncentrationen av de båda generna varierade
över året men utan tydlig trend. Precis som för genen mecA kunde en minskning av tetA och
tetB påvisas över reningsprocessen. När obehandlat och behandlat avloppsvatten jämfördes
varierade reduktionen av tetA mellan 4 och 300 ggr och för tetB mellan 3 och 40 ggr.
Minskningen av tetA och tetB koncentrationerna verkar delvis bero på utfällnings- och
sedimentationsprocesserna som utförs vid reningen av avloppsvattnet. Koncentrationerna av
de båda generna påverkas också starkt av mängd biomassa och borttagandet av biomassa i
reningsverket.
VIII
List of Papers
This doctoral thesis is based on the following papers. They are referred to in the text by their
Roman numerals
I.
Börjesson S., Dienus O., Jarnheimer PA., Olsen B., Matussek A. and
Lindgren PE. (2009) Quantification of genes encoding resistance to
aminoglycosides, ß-lactams and tetracyclines in wastewater environments
by real-time PCR. International Journal of Environmental Health
Research DOI: 10.1080/09603120802449593
II.
Börjesson S., Melin S., Matussek A. and Lindgren PE. (2009) A
seasonal study of the mecA gene and Staphylococcus aureus including
methicillin-resistant S. aureus in a municipal wastewater treatment plant.
Water Research 43:4 925-932
III.
Börjesson S., Matussek A., Melin S., Löfgren S. and Lindgren PE.
Methicillin-resistant Staphylococcus aureus (MRSA) in municipal
wastewater: An uncharted threat? Manuscript
IV.
Börjesson S., Mattsson A., and Lindgren PE. Genes encoding tetracycline
resistance in a full-scale municipal wastewater treatment plant
investigated during one year. Manuscript
Papers are reprinted with permission from the respective publisher
IX
X
Table of Contents
1.
2.
3.
Antibiotic resistance
Antibiotic resistance as an environmental problem
Wastewater treatment in Sweden
3.1.
3.2.
4.
Staphylococcus aureus
4.1.
4.2.
5.
12.
13.
14.
15.
16.
17.
18.
Tetracyclines in wastewater
Resistance to tetracyclines
Tetracycline resistance in wastewater and other environments
Polymerase chain reaction (PCR) and real-time PCR
8.1
9.
10.
11.
Aminoglycosides in wastewater
Resistance to aminoglycosides
Aminoglycoside resistance in wastewater and other environments
Tetracycline antibiotics
7.1.
7.2.
7.3.
8.
β-lactam antibiotics and resistance to β-lactams
The mecA gene and the staphylococcal cassette chromosome mec (SCCmec)
Hospital- and community-associated MRSA
MRSA in animals
β-lactam antibiotics in wastewater
Methicillin resistant staphylococci and other β-lactam resistance in wastewater
and other environments
Aminoglycoside antibiotics
6.1.
6.2.
6.3.
7.
Typing of S. aureus
4.1.1 Pulse field gel electrophoresis
4.1.2 Multilocus sequence typing
4.1.3 spa typing
S. aureus in wastewater and the environment
Methicillin resistant S. aureus (MRSA)
5.1.
5.2.
5.3.
5.4.
5.5.
5.6.
6.
The wastewater treatment plant Ryaverket, Gothenburg, Sweden
Bacterial communities and pathogens in municipal wastewater treatment plants
LUXTM real-time PCR
Aims of the thesis
Sampling sites
Design and evaluation of LUXTM real-time PCR assays for the mecA, tetA,
tetB and aac(6’)-Ie+aph(2’’) genes
Detection of the mecA gene, Staphylococcus aureus and MRSA in a full-scale
wastewater treatment plant
Cultivation and characterisation of MRSA from municipal wastewater
The effect of wastewater treatment on concentrations of mecA, tetA and tetB
Conclusions
Future work
Acknowledgements
References
XI
01
02
04
04
06
08
10
11
11
12
13
14
15
17
19
20
21
21
22
23
23
24
25
26
26
28
30
34
35
36
37
40
41
45
48
48
50
52
XII
Abbreviations
BURP
The algorithm based upon repeat patterns
BURST
The algorithm based upon related sequence types
CC
Clonal complex
CoNS
Coagulase-negative staphylococci
LUX
Light upon extension
MRSA
Methicillin resistant Staphylococcus aureus
CA-MRSA
Community associated MRSA
HA-MRSA
Hospital associated MRSA
MLST
Multilocus sequence typing
MSSA
Methicillin sensitive Staphylococcus aureus
otr-genes
Oxytetracycline resistance gene
PBP
Penicillin-binding protein
PCR
Polymerase chain reaction
PFGE
Pulse field gel electrophoresis
PVL
Panton Valentine leukocidin
RPP
Ribosomal protection proteins
SCCmec
Staphylococcal cassette chromosome mec
ST
Sequence type
tet-genes
Tetracycline genes
VRE
Vancomycin resistant enterococci
WWTP
Wastewater treatment plant
XIII
XIV
1.
Antibiotic resistance
Ever since the introduction of penicillin during the Second World War antibiotics have been
viewed as miracle drugs. After the introduction of penicillin, isolation of new antibiotics
proceeded quickly and most of the major classes were isolated during the 1940s to 1960s
(169). As a result of these “miracle drugs” an accelerated decline in deaths caused by
infections was seen. For example after the introduction of sulphadiazine, deaths from childbed
fever caused by Streptococcus pyogenes decreased by 50 % in England and Wales (28).
However, today the miracle may be over due to increasing antibiotic resistance in bacteria,
including multi-resistant bacteria, which threatens the earlier effective treatment of bacterial
infections. Antibiotic resistance has been given a lot of attention during the last two decades
both within the scientific community and in public media. However, the risk of development
of resistance was put forward already in the childhood of antibiotics, or to quote Sir
Alexander Fleming, the discoverer of penicillin, from his Noble lecture in 1945 (6):
“It is not difficult to make microbes resistant to penicillin in the laboratory by exposing them
to concentrations not sufficient to kill them, and the same thing has occasionally happened in
the body.”
Just a few years later more than 50 % of the Staphylococcus aureus isolates were resistant to
penicillin (8). The trend has not been stopped, and today more than 95 % of S. aureus are
resistant to penicillin (119). The fact is that there are almost daily reports of bacteria that have
developed resistance to common antibiotics, which they were previously susceptible to.
Furthermore, to all the different antibiotic classes available, there exists at least one
mechanism of resistance, and in most cases more than one (96). The biggest problem is the
emergence of multi-resistant bacteria, which make treatment especially difficult, costly, and
in the end maybe even impossible (170). The major reason for the increasing trend is the
ongoing overuse and misuse of antibiotics worldwide. Although resistance is mainly
considered to be a clinical problem the antibiotic use is not restricted to clinical settings. At
least half of all antibiotics are consumed in the farming and agriculture setting (178). This use
has certainly contributed to the spread and increase of antibiotic resistance.
1
2.
Antibiotic resistance as an environmental problem
The use of antibiotics and spread of antibiotic resistance in clinical settings is a wellrecognised problem, but antibiotics and antibiotic resistance as environmental problems and
pollutants have largely been overlooked. This is probably due to the fact that antibiotics in
non-clinical settings are generally found in concentrations well below those used
therapeutically (77;81;140). However, even low levels can sustain and/or favour development
and spread of antibiotic resistance in microbial communities. It is also important to realise that
antibiotics and antibiotic resistance are naturally occurring and play a vital role as regulatory
factors in all microbial ecosystems. In addition, several of the antibiotic resistance
determinants have primary physiological roles other than giving resistance. This means that
even introduction of a low concentration of antibiotics in an environment can have significant
effects on the stability of the ecosystem and select for antibiotic resistance. During the last
decade there has been an increasing number of reports both of antibiotic and antibiotic
resistance genes in different environmental settings. It has also been described that transfer of
antibiotic resistance genes can occur between bacterial strains that are unrelated evolutionary
and ecologically, even in the absence of antibiotics (88). The view of the role of introduced
antibiotics, antibiotic resistant bacteria and genes encoding antibiotic resistance in nature is
changing. Among others, the United Nations states in their System-wide Earthwatch that
research into how dispersal of antibiotics affects the natural bacterial community in nonclinical settings is essential and urgent (3). The reason is that these settings can be a potential
source for spread and development of antibiotic resistance, which may find its way back into
the human population.
Antibiotics are mainly introduced into the environment through two routes, human or animal
treatment. However, it is important to realise that the same or similar antibiotics can be used
in both human and animal treatment. Figure 1 shows anticipated routes of antibiotics and
antibiotic resistance genes to the environment and potential routes back to the populations.
The antibiotics are dispersed in two ways, (1) urine and faeces, or (2) direct disposal. A
substantial part of all antibiotics consumed are not absorbed or metabolised by the body, but
excreted in their active form in the urine and faeces. The urine and faeces are transported to
wastewater treatment plants or can be used directly as manure. Direct disposal includes
addition of food additives directly to the water in fish farms or treatment of crops. One large
source is probably the disposal of outdated or remainders of antibiotics in household and farm
2
Figure 1. Potential routes for introduction of antibiotics and genes encoding antibiotics in the
environment
drains. In Germany it has been estimated that 20 - 40 % of all administered antibiotics are
disposed of in this way (90). In most industrialised countries a majority of households are
connected to municipal sewers; in Sweden around 85 % and in The United States about 75 %
(2;5). Wastewater treatment plants (WWTP) are therefore probably primary routes of entry
for antibiotics into the environment. Several studies have also described the occurrence of
different antibiotics in both untreated and treated water (81). The majority of the studies
describe lower concentrations in treated water, suggesting a partial removal in WWTPs.
However, it has been indicated that biodegradation does not occur for all antibiotics in the
WWTPs (90). Thus, a main removal mechanism is probably through sorption to sludge (140).
In most modern wastewater treatment facilities, the sludge is processed to biosolids or applied
directly as fertilisers. In both treated and untreated wastewaters there are higher numbers of
resistant bacteria and genes encoding antibiotic resistance compared to surface water (81).
The occurrence of multiresistant bacteria, e.g. vancomycin resistant enterococci (VRE), has
also been described in WWTPs (73;111). One study performed on Swedish sewage showed
relatively high prevalence of VRE, which was unexpected due to the low prevalence of VRE
in the human and animal population in Sweden (73). Several studies have pointed out that
WWTPs can have favourable environmental conditions that increase the likelihood of
3
antibiotic resistance gene transfer. The potential spread of specific genes encoding antibiotic
resistance in wastewater by horisontal gene transfer has also been shown (54;122;139). It is
therefore essential to perform more extensive studies concerning the occurrence of antibiotic
resistance and how it is affected over time and by different treatment steps in WWTPs.
3.
Wastewater treatment in Sweden
Sweden was early in implementing wastewater treatment, and there was a large production
boom during the 1960 - 1970s because wastewater emission into freshwaters was causing
eutrophication, mainly due to the large amount of phosphorous. Today there are over 2000
publicly owned WWTPs in Sweden. During the 1990s it was realised that nitrogen in
wastewater also was an environmental problem causing eutrophication in coastal areas.
Therefore, during the last few years’ nitrogen removal in the Swedish WWTPs has been
developed drastically. Three different treatment techniques, in different combinations, are
implemented in most WWTPs today; (1) Mechanical treatment; large and heavy particles
and fats are removed through coarse bar screens, sand traps and pre-sedimentation, (2)
Chemical treatment; removal of phosphorus through precipitation by addition of chemical
compounds, e.g. iron and aluminium, (3) Biological treatment; microorganisms, foremost
bacteria, utilised for removal of the remainders of organic compounds and nitrogen. In all
steps, sludge is collected and it is estimated that the WWTPs in Sweden annually produce
230,000 tons of sludge. The sludge is rich in nutrients, but may contain biological and
chemical pollutants. Although faecal indicator bacteria, such as Escherichia coli, coliform
bacteria and Enterococci spp., are measured for indication of bacterial content, there is no
direct treatment step focusing on removal and disinfection of bacteria and possible pathogens
today. (154;177)
3.1
The WWTP Ryaverket, Gothenburg, Sweden
The municipal WWTP Ryaverket in Gothenburg city is one of the largest in Northern Europe,
receiving wastewater from nearly 830,000 person equivalents, with an average daily flow of
350,000 m3. It was taken into operation in 1972 and was rebuilt for biological nitrogen
removal during 1995 – 1997. The wastewater is collected from five municipalities; Ale,
Gothenburg, Härryda, Kungälv, Mölndal and Partille, and around 10 % of the total
wastewater are from industry, health-care and public administration.
4
Like all other treatment plants in Sweden, Ryaverket utilises mechanical treatment, but also
implements both chemical and biological treatment. In addition to removal of phosphorus, the
plant is designed for biological nitrogen removal, utilising pre-denitrification in a nonnitrifying activated sludge system, and post-nitrification in a trickling filter. An overview of
Figure 2. Overview of the treatment processes at Ryaverket, Gothenburg, Sweden (Ryaverket Fact sheet 2006)
the complete treatment process at Ryaverket can be viewed in Figure 2. After mechanical
5
treatment the wastewater at Ryaverket is transferred to the activated sludge basins. In the
activated sludge, bacteria is utilised for oxidation of organic particles. The first part (40 - 60
%) of the basins is anoxic which forces the bacterial community to use NO3 for respiration
resulting in NO3 being converted to N2, which is released directly to the atmosphere. The
second part of the basins is aerobic, resulting in organic particles being oxidised through
aerobic respiration. After passing the activated sludge basins, the water is pumped into
sedimentation basins, where phosphorus aggregates and sludge are allowed to settle.
Phosphorus is precipitated with iron sulphate, which is added prior to the activated sludge.
The collected sludge is pumped back to primary settling in the mechanical treatment, while
the water is separated, with about 50 % released at the Rya nabbe in the estuary of Göta
River. The remaining water is mixed with ammonium rich reject water from dewatered
sludge, collected mainly from primary settling, and recirculated in the system through
nitrifying trickling filters (NH4++ 2 O2 → NO3- + 2H+ + H2O). The trickling filter is filled
with a plastic crossflow material that provides a large surface for bacterial biofilm growth.
After the trickling filters, the water is pumped back into the anoxic phase of activated sludge.
In 2004, Ryaverket received on average Ptot of 4.4 mg l-1 and Ntot of 27.1 mg l-1 and released
Ptot 0.4 mg l-1 and N2 10 mg l-1. The system has a hydraulic retention time of ~8 h and the
activated sludge system has a solid retention time of 2-4 days. (4;138)
3.2
Bacterial communities and pathogens in municipal WWTPs
Bacterial communities play a vital role in wastewater treatment, since they are the ones
responsible for most of the carbon and nutrient removal in WWTPs (167). In activated sludge,
bacteria are used for oxidation of organic particles and the transformation of nitrate and nitrite
to nitrogen (nitrification and denitrification). The bacteria in biofilms are commonly used to
transfer ammonium to nitrate (nitrification).
There is no such thing as a universal bacterial flora for all WWTPs, instead studies have
shown a great difference in population structure between WWTPs (20;167). The structure of
the bacterial community is probably affected to a high degree by operational parameters and
quality/composition of the wastewater. In Ryaverket it has been shown that the ammonium
content largely affected the nature of the bacterial biofilm in the trickling filters in terms of
thickness, structure, biomass content and community structure (105). However, within a
WWTP the bacterial structure is often stable, at least over a 6-month period (20). Molecular
typing has shown that the community has a high diversity, with high numbers of cells and
6
different bacterial species (20;168). A total of 13 bacterial phyla out of the 36 described have
been detected in WWTPs. The Proteobacteria is the most abundant phylum, constituting for
up to 50 % of the population in WWTPs (168), and in the aeration basins in activated sludge
they can account for up to 70 % (166). It is foremost α- β- and γ- Proteobacteria that are
detected, with the β-Proteobacteria being the most frequent. Furthermore, in activated sludge,
it has been shown that the β-Proteobacteria has high diversity (168). Cultivation experiments
have shown that Enterobacteriaceae, Aeromonas spp. and Acinetobacter spp. can be
commonly isolated (166). Besides Proteobacteria, other common phyla are Actinobacteria,
Bacteroidetes, Chloroflexi and Planctomycetes.
The nitrifying and denitrifying bacteria in WWTPs have been paid a lot of attention due to
their importance for reducing nitrogen levels. However, the bacteria responsible for
denitrification in WWTPs are still largely unknown, but a majority probably belong to βProteobacteria (167;168). Alcaligenes spp., Pseudomonas spp., Methylobacterium spp.,
Bacillus spp., Paracoccus spp. and Hypohomicrobium spp. have all been isolated through
their denitrifying ability, but it is not clear if they are representative for the in-situ flora. On
the other hand the bacteria responsible for the nitrification process are better described.
Nitrosomonas europea and Nitrobacter spp. are commonly identified in WWTPs all over the
world as the main ammonium and nitrite oxidisers, but Nitrosomonas eutropha, Nitrosomonas
marina, Nitrococcus mobilis, and phylogentic lineages of uncultured representatives are also
common. In Ryaverket it was shown that the most common ammonium oxidising bacterium
was Nitrosomonas oligotropha (104).
Besides the “normal” flora in WWTPs, a large diversity of different pathogens has been
described (Table 1) (57;79;93;125;141;144;175), but the levels of pathogens are lower than
those of the non-pathogenic bacteria (93). Studies showed that pathogens were detected to a
higher extent in incoming water compared to outgoing, and that the treatment processes
reduced their concentrations. E. coli, coliforms and Enterococcus spp. are often used as
indicators for bacterial concentration and studies have shown that total coliforms was reduced
by up to 6 log10 units, E. coli, 1-4 log10 units, while Enterococcus spp. was reduced 0.5-3
log10 units (47;48;79). One study focusing on Clostridium perfringens showed a reduction by
1-2.5 log10 units, and the authors proposed that pathogenic bacteria might survive better than
the indicator bacteria (175). Studies have also shown that the treatment process reduced the
7
number of human viruses; astroviruses, 2-3 log10 units and norovirus, 0-2.5 log10 units
(92;121). However, most of the pathogens were never completely removed (Table 1).
Table 1. Detected pathogens in wastewater
Untreated
Aeromonas hydrophilia
Campylobacter coli
Clostridium perfringens
Enterotoxigenic Escherichia coli
Escherichia coli O157
Listeria monocytogenes
Shigella flexneri
Treated
Bacillus cereus
Campylobacter jejuni
Enterococcus faecalis
Klebsiella pneumoniae
Pseudomonas aeruginosa
Salmonella spp.
adenoviruses
enteroviruses
astroviruses
Noroviruses
Helminth ova*
Cryptosporidium spp.**
Giardia cysts**
Aeromonas hydrophilia
Campylobacter jejuni,
Enterococcus faecalis
Listeria monocytogenes
Shigella flexneri
Campylobacter coli
Clostridium perfringens
Klebsiella pneumoniae
Salmonella spp.
adenoviruses
noroviruses
astroviruses
Giardia cysts**
*Parasitic worm, **Protozoa
4.
Staphylococcus aureus
The genus staphylococcus was first described in 1880 (123) and is gram-positive cocci of 0.81.0 μm in diameter. Under the microscope the staphylococci have a characteristic grape-like
appearance, due to division in several plains (107). Today, more than 40 different
staphylococcal species have been described (1), and several of them are pathogenic to humans
and/or animals (71). Staphylococcus aureus is by far the staphylococci species that is most
pathogenic to humans and is also the best studied. It can be easily separated from most other
staphylococci through its ability to coagulate plasma, thanks to production of coagulase. The
other staphylococci are therefore often referred to as coagulase-negative staphylococci
(CoNS). The reason for the higher virulence of S. aureus is probably due to the wide variety
8
of cell-wall associated proteins and secreted toxins it possesses (22;103). This also gives S.
aureus its capability of causing a large diversity of both benign and lethal infections in
humans and animals (Table 2). (136;176) In many parts of the world S. aureus is the most
Table 2. Diseases caused by S. aureus
Skin and
Invasive infections
soft tissue infections
Botryomycosis
Endocarditis
Carbuncles
Osteomyelitis
Cellulitis/erysipelas
Pneumonia
Folliculitis
Sepsis
Fruncles
Septic arthritis
Impetigo
Sinusitis
Pyomyositis
Urinary tract infection
Scalded skin syndrome
Stye
Others
Gastroenteritis
Toxic shock syndrom
frequent cause of hospital-acquired infections. In the USA 19 % of over 3 million bacterial
isolates from inpatients were determined to be S. aureus, making it the most prevalent species
(152). Besides being a common hospital pathogen, S. aureus causes infections in the
community; in the USA it was the second most prevalent species from outpatient specimens.
The community-acquired infections are generally minor skin infections, but there are cases of
severe skin-infections and lethal haemolytic pneumonia (101). Furthermore, the total number
of infections caused by S. aureus, both in the community and clinical settings, has increased
steadily over the past decades (103).
The duality of S. aureus is that it is also a human commensal and has been described to be
carried by ~30 % up to 70 % of the population (126). Longitudinal studies have distinguished
three different carriage patterns; persistent, intermittent and non-carriage. However, some
researchers make a further distinction; occasional and intermittent. Studies have shown that
12 - 30 % of the population are persistent carriers, 16 - 70 % occasional/intermittent carriers
and 16 – 69 % are non-carriers. The large variation in percentages is due to differences in the
studies, e.g. culture techniques, the population (carriage is connected to age, sex and
ethnicity) and interpretation guidelines. The persistent carriers are colonised by a single strain,
while intermittent carriers can carry different strains over time. A fit between host and the
carried S. aureus is essential, because persistent carriers are resistant to colonisation with new
strains (126;176). The genetic diversity of carriage strains of S. aureus is high, but no clear
association of genotypes and different host attributes, such as sex, age or medical history, is
9
evident (143). However, some genotypes of S. aureus are more prevalent among carriers. The
most frequent carriage site is the anterior nose, but the exact position is still unclear. Crosssectional surveys performed on healthy adults have reported nasal carriage rates of ~27 %.
Besides nasal carriage, S. aureus can often be isolated from the skin, perineum and pharynx.
(126;176) The risk of acquiring a S. aureus infection increases if you are a carrier. Studies
have shown that for nasal carriers the relative risk for a surgical infection increases with 1.3 7.0 and 80% of those with community acquired skin lesions were nasal carriers (162;176).
However, among non-carriers that have acquired exogenous S. aureus bacteraemia the
mortality is fourfold higher compared to nasal carriers (176).
4.1
Typing of S. aureus
Because of S. aureus status as one of the most common causes of bacterial infections, and as a
commensal, it is important to understand its occurrence and distribution. It is also significant
to identify if there are specific isolates or major clusters responsible for infections and
colonisation (161). If there are one or a few strains, this indicates that these have genotypic
and/or phenotypic factors that give a selective advantage. On the other hand, if major clusters
are responsible, there should be factors that are common in the population. Accurate typing
methods are therefore necessary for S. aureus, to identify different strains and elucidate their
relationship. An optimal typing method should have high stability, reproducibility, typeability
and discriminating power. Furthermore, it would be advantageous if it is user friendly, rapid
and has a low cost. Several different techniques for typing, both phenotypic and genotypic,
have therefore been developed for S. aureus over the past four decades (36). In the beginning,
isolates were distinguished based on phenotypic properties. Common typing methods were
antibiotic resistance typing, phage typing (resistance to a standard set of phages), serological
typing (differences in antigenicity), biotyping (metabolic capabilities), bacteriocin typing and
resisto-typing (resistance to various chemicals). These methods have in common that they are
all limited in reproducibility, typeability and/or discriminatory power. The reason is that the
expression of genes, giving rise to the resulting phenotypes, is often dependent on
environmental factors, which means that unrelated strains can share phenotypic traits. The
methods are also inadequate for evolutionary studies, since the genes responsible for
phenotypic traits tend to evolve quickly or may be subjected to horisontal gene transfer.
(36;39) All the disadvantages of phenotypic typing methods have led to the development of
genotypic methods, such as plasmid analysis, southern hybridisation analysis, e.g. ribo typing
(RT) and binary typing (BT); PCR-based techniques, e.g. random amplified polymorphic
10
DNA (RAPD), repetitive element sequence based-PCR (rep-PCR), amplified fragment length
polymorphism (AFLP); pulse field gel electrophoresis (PFGE), and sequence typing, such as
spa typing and multilocus sequence typing (MLST) (36). Based on the literature, the most
used methods today are PFGE, MLST and spa typing (32).
4.1.1
Pulse field gel electrophoresis
PFGE is the most frequently used typing method, and many have embraced it as the golden
standard for studying outbreaks and hospital transmissions. The reason is that PFGE is the
most discriminative of the genotypic methods, due to the fact that it reflects genetic events
that occur during a short period of time. PFGE is based on the fragmentation of the whole
bacterial chromosomal DNA using restriction enzymes, often SmaI. The fragmented DNA is
then separated on an agarose gel using an alternating voltage field. This result in a unique
band pattern, which is analysed with specially designed computer software, often using the
Dice coefficient and unweighted pair grouping. However, for long-term surveillance and
evolutionary studies, PFGE may be inadequate, due to the instability of the restriction sites
over a prolonged period of time, and that minor genetic alterations can lead to major changes
in the band pattern. The comparison of results between laboratories is also difficult or even
impossible due to poorly harmonised protocols, the lack of a standardised nomenclature and
the fact that the analyses of patterns are subjective. Furthermore, the PFGE is both time and
cost consuming. (33;36;39)
4.1.2
Multilocus sequence typing
MLST is used for typing of almost all major human bacterial pathogens including S. aureus,
and more protocols are in the pipeline (159). It is based on sequencing of several
housekeeping genes; for S. aureus typing sequences of approximately 500 bp are determined
for seven genes; arc, aroE, glpF, gmk, pta, tpi, and ygiL. The sequences are compared for
each gene and different sequences are assigned distinct alleles. The alleles for all seven genes
are then used to create an allelic profile and every specific profile is designated as a sequence
type (ST). An S. aureus isolate assigned to ST8 has an allelic profile that looks like 3-3-1-1-44-3, while an isolate designated ST5 has the profile 1-4-2-4-12-1-10. Using the Based Upon
Related Sequence Types (BURST) algorithm, related STs can then be joined together in
clonal complexes (CC). An ST is grouped within the same CC when at least five out of seven
genes have identical gene sequences/alleles. MLST has been shown to be an excellent method
11
with high reproducibility and is suitable for population and evolutionary studies. However, it
is also expensive and laborious. (32;33)
4.1.3
spa typing
spa typing, introduced in 1996 by Frenay et al. (44) has a discriminating power that lies
between MLST and PFGE, and in contrast to these methods, has been described to be suitable
for studying both evolutionary events and hospital outbreaks. This fact has probably
contributed to its increasing popularity over the last couple of years. Its simplicity, time
efficiency and lower cost relatively to PFGE and MLST, have probably also contributed to the
popularity. These advantages are due to that spa typing is a single locus sequence typing
method, using only the polymorphic region X of the protein A gene, found exclusively in S.
aureus. The typing is based on that the region X constitutes a number of repeats of 24 bp in
length. The diversity of the region is due to the deletion and duplication of the repeats, but
also in some cases point mutations. S. aureus strains are divided into spa types based on the
number and arrangement of these repeats and on which repeats that are identified. As an
example of spa types, one can compare t008 and t064 that have the same number of repeats,
but differs in the sequence of the fourth repeat (table 3). It should be pointed out that because
Table 3. Examples of spa types and arrangement of repeats
spa type
Repeat succession
Sequence of mismatching repeats
t008
t064
11-19-12-21-17-34-24-34-33-25
11-19-12-05-17-34-24-34-33-25
r21 =AAAGAAGACAACAACAAGCCTGGC
r05 =AAAGAAGACAACAAAAAGCCTGGC
spa typing is more discriminating than MLST several different spa types can correspond to a
single ST, but remain within an assigned CC. Furthermore, using the typing software Ridom
StaphType it is possible to perform cluster analysis using the algorithm based upon repeat
patterns (BURP). (32;33)
A problem with spa typing is that studies have shown that spa types on occasion violate
MLST STs. This violation can occur in two ways, either that different STs, belonging to the
same CC, have the same spa type, or that closely related spa types are found in distant CC
(59). The reason for this problem is probably intergenomic recombination events of the spa
gene. However, these events take place only rarely, and the spa gene has been shown to have
both long-term in vitro and in vivo stability (86). A further disadvantage is that two parallel
nomenclatures exist today, based on the works of Harmsen et al. (63), as exemplified in table
12
3, and Koreen et al. (86), making it difficult to compare studies. Generally, the Harmsen
system is more commonly used in Europe, while Koreen is more accepted in the U.S.A. One
large advantage of using spa typing is that a spa server, http://spaserver.ridom.de exists, and
this is probably the world largest typing database for S. aureus. At the time of writing this
thesis, the database lists more than 4700 spa types combined from over 270 different repeats
based on over 78 000 strains from 61 countries. Furthermore, this spa server is freely
accessibly through the Internet and all spa types and repeat sequences can be downloaded.
Submission of new repeats and spa types is possible for everyone, and the server is
synchronised with the typing software Ridom StaphType (Ridom GmbH, Würzburg,
Germany).
4.2
S. aureus in wastewater and the environment
The occurrence of S. aureus in the environment is scarcely studied, although failed attempts
to cultivate S. aureus from municipal wastewater, drinking water and river surface water have
been made (145;164). However, it was possible to isolate S. aureus from hospital wastewater
(145). There have also been attempts to detect S. aureus using molecular methods in samples
collected from municipal WWTPs, both from treated and untreated wastewater, but S. aureus
was not detected (93;144;146). Taken together, these results indicate that S. aureus has low
prevalence in wastewater. However, there are indications that S. aureus can be viable in
wastewater and is more resilient than earlier believed. Cultivation experiments have shown
that S. aureus can be sustained on culture plates supplemented with wastewater for up to 80
days, but they were not able to grow (45). Furthermore, one study made observations
indicating that S. aureus can enter a viable but un-cultivatable state in wastewater (122). This
study also described that S. aureus in vitro has the capability of transferring plasmids,
harbouring the aminoglycoside resistance genes aac(6´)-Ie+aph(2´´) in wastewater. In
addition, other groups have been able to cultivate S. aureus from bioaerosols in WWTPs, at
least during the winter period (43). Studies have also indicated that S. aureus can survive the
treatment process in a WWTP, because an increase in prevalence of S. aureus infections has
been reported among residents living in proximity to areas fertilised with sewage sludge (97).
13
5.
Methicillin resistant S. aureus (MRSA)
MRSA, which is resistant to all clinically used β-lactam antibiotics, is the reason for
increasing numbers of S. aureus infections in hospitals and in the community. Besides higher
infection rates MRSA is also responsible for higher cost and mortality in the society.
Methicillin, a semi-synthetic penicillin, originally named celbenin, is no longer in use, but the
definition MRSA remains. Methicillin was introduced in 1959 as a way to battle the
increasing number of β-lactamase producing S. aureus strains. However, just two years after
the introduction the first case of “celbenin” resistant S. aureus was reported (75), and in 1967
the first reports of multi-resistant MRSA came, in Australia, Denmark, England, France, India
and Switzerland (51). During the 60s and 70s a swift dissemination of a specific multiresistant clone, the phage type 83A, occurred in Europe. In Denmark 15 % and in Zürich,
Switzerland, 20 % of all clones belonged to this phage type, but in the late 70s and early 80s
the occurrence decreased to 2 % in Denmark and 3 % in Zürich. The reason for the decrease is
unknown, but it was probably influenced by changes in antibiotic prescriptions and control
policies. In the 1980s, when rapid increases in gentamycin resistant MRSA was reported in
USA, United Kingdom and Ireland, the concern for MRSA was renewed (51). Today, MRSA
has risen to one of the most frequent causes of hospital infections worldwide. In the USA ~34
% of all S. aureus were described as MRSA in 1998 – 2002; Central Europe 9 %, in 1995;
Europe 26 % and Latin America 35 %, in 1997-1999; South Africa 40 %, Japan 67 % and
Australia 22 % in 1998-1999. However, in Europe there are big geographical differences (Fig
3) with less than 3 % in Scandinavia, Iceland and Netherlands compared to over 30 % in
Figure 3. The prevalence of MRSA among blood
isolates of S. aureus in Europe 2006 (7)
14
southern Europe, UK and Ireland. One study compared over 3000 MRSA isolates from Asia,
Europe, Latin America and North America using different typing techniques (36). It was
found that six clones of MRSA were spreading worldwide suggesting that only a few
epidemic clones exist. However, there were also clones, with high diversity, dominating in a
single area or hospital and from only one or a few patients. In contrast to the 70s and 80s the
increasing trend is not due to a specific clone, and it appears not to secede any time soon.
Furthermore, the increase in MRSA includes the low prevalence areas, Scandinavia, Iceland
and Holland, e.g. in Sweden there were 1128 cases of MRSA blood isolates in 2007 compared
to 327 cases in 2000 (155).
5.1
β-lactams and resistance mechanisms to β-lactams
The β-lactam antibiotics are extensively used clinically, and in Sweden they constitute ~50 %
of the antibiotics administered in the community and hospital care (155). They are broadspectrum bactericidal agents and have low toxicity to eukaryotes (49). Furthermore, it is the
largest class of antibiotics and most of them are semi-synthetic compounds. The class is
defined by the β-lactam ring in their chemical structure (Fig 4) and is roughly divided into
Figure 4. The β-lactam ring
four groups: penicillins (narrow to extended spectrum), cephalosporins (1st - 4th generation),
carbapenems and monobactams. The exact mechanism by which the β-lactams kill the
bacteria is not completely understood, but they affect the cell wall biosynthesis (62;171). The
rigidity of the bacterial cell wall comes from peptidoglycan, a complex of covalently crosslinked peptide and glycan strands (Fig 5A). The cell wall synthesis includes ~30 enzymes and
is performed in three stages. β-lactams inhibit the third and final stage, the completion of the
cross-link, performed by transpeptidases. The inhibition is due to that β-lactams act as
pseudosubstrates and acylate the active site of the transpeptidases (Fig 5B), which in the end
leads to cell-lysis. The transpeptidases are therefore also termed penicillin-binding proteins
(PBPs). The PBPs are found in all bacteria and in addition to the transpeptidases, there are
other related PBPs.
15
Figure 5. The inhibition of cell-wall synthesis by β-lactams A. Covalent Cross-linking of
peptidoglycan chains B. Binding of penicillin to transpeptidases (penicillin-binding protein).
Modified from Walsh (171).
Bacteria have evolved three major ways in which they avoid the bactericidal effect of βlactam antibiotics: (1) Production of β-lactamases, which are enzymes that hydrolyse the βlactam ring, rendering the antibiotic inactive, (2) Altered PBPs with low affinity for βlactams, (3) Lowered or lack of expression, due to mutations, of outer membrane proteins in
gram-negative bacteria, which leads to difficulty for the β-lactams to access the PBPs (12).
The first described resistance to β-lactams was the production of penicillinase by E. coli, and
penicillinase was also the first resistance mechanism described for S. aureus. To date, over
530 β-lactamases have been reported and the genes encoding them (bla genes) are located on
either the bacterial chromosome, plasmids, transposons or integrons (12;180). There are ways
to overcome the β-lactamases; (1) finding inhibitors/inactivators, and (2) to develop or find
new β-lactam antibiotics that are not hydrolysed or hydrolysed poorly by the β-lactamases.
The gram-positive bacteria have remained susceptible to inhibitors (16), but the introduction
of semi-synthetic β-lactams, such as methicillin, cephalosporins and carbapenems, led to the
evolution of PBPs with low or no affinity for β-lactams. For gram-positive bacteria, altered
16
PBPs are the most important resistance mechanism for β-lactams, while the gram-negative
rely more on β-lactamases (12;16). The mecA gene, responsible for β-lactam antibiotic
resistance in MRSA, is the most described and studied example of alternative PBP.
5.2
The mecA gene and the staphylococcal cassette chromosome mec (SCCmec)
The resistance to β-lactams in MRSA is the result of the 2.1 kb mecA gene that encodes a 78
kDA PBP dubbed PBP2a (alternatively PBP2’) with low affinity for binding the β-lactams
(17;32). Compared to the four native PBPs, the PBP2a appears to be a relatively poor
transpeptidase, taking over only after the others have been saturated, and it also requires a
native transglycosylase to function. The mecA gene is regulated by the neighbouring genes
mecI and mecRI/ΔmecRI. The mecI gene codes for the repressor and mecRI/ΔmecRI codes for
a trans-membrane β-lactam sensing signal transducer (32). Besides mecI and mecRI, other
genes can influence the expression of mecA, for example blaRI and blaI, which are analogous
to mecI and mecRI, or the factors essential for methicillin resistance (fem) genes, femA-F,
femR and femX, that encode peptidoglycan modifying enzymes (17). Furthermore, genes that
are part of the native genome and partake in cell-wall biosynthesis and turnover, most likely
also play a role for β-lactam resistance (109).
The only vector identified for the mecA gene is the staphylococcal cassette chromosome mec
(SCCmec), which has not been identified in any other bacteria except staphylococci (61). The
SCCmec appears to be a well-developed vessel for genetic exchange, believed to occur
through horisontal transfer, but the exact mechanism is unclear. The fact that it is transferred
frequently is supported by species independent conservations (61). The distribution of
SCCmec among S. aureus strains is not even, instead they are found more frequently in five
out of eleven identified MLST CC (40). The reason for the uneven distribution is not known,
but it may be due to that these strains are more virulent and selection pressure from antibiotic
treatment may have forced them to retain SCCmec. Compared to other genes in the S. aureus
genome the SCCmec appear to have been acquired relatively recent (69).
The SCCmec is introduced in the S. aureus genome at a specific site (attBSCC) at the 3’ end of
an open reading frame with unidentified function (orfX) (33;34;61). The specific integration,
and excision, of SCCmec into the genome is executed by the cassette chromosome
recombinases (ccr), of the invertase/resolvase class, which is found in all SCCmec. In MRSA
three genes have been identified that code for the ccr, ccrA and ccrB with four allotypes, and
17
ccrC. The mecA gene itself is located on a structure termed the mec complex. Besides mecA,
the genes responsible for regulation of transcription, mecI and mecRI/ΔmecRI, as well as
insertions sequences, IS431 and IS1272, are found in this complex. Five different classes (A –
E) of the complex have, to date, been defined based on the combination of mecI, mecRI,
ΔmecRI and insertion sequences (Table 4). Of these the classes, A - C are the most common.
Table 4. The classes of the mec complex
Class
Structure
A
mecI-mecRI-mecA-IS431
B
IS1272-ΔmecRI-mecA-IS431
C
IS431-ΔmecRI-mecA-IS431
D
ΔmecRI-mecA-IS431
E
ΔmecRI-mecA-IS431
In addition, to the two essential components, the ccr- genes and the mec-complex, SCCmec
contain junkyard (J) regions. These J-regions are made up of non-essential components, but
additional resistance genes can be found here. There are three J-regions; (1) J1, between the
genome right junction and the ccr genes, (2) J2, between the ccr and the mec complex, and
(3) J3, from the mec complex to the orfX. Based on the composition of the ccr genes and the
mec complex, the SCCmec is divided into seven types, ranging in size from 20.9 to 66.9 kb
(Fig 6) (32), and based on variations in the J-regions these types can be further divided into
subtypes. The SCCmec types have been named using roman numerals, I-VII, based on the
Figure 6. Comparison of the SCCmec types I-VII described in MRSA Deurenberg and
Stobberingh (32).
order in which they were described. Among MRSA isolates worldwide, the SCCmec IV
dominates and is at least twice as common as any other type. The SCCmec IV also dominates
18
in Swedish MRSA strains (18). Carrying SCCmec is thought to impose an energetic cost for
the staphylococci, but the type IV does not to impose a cost in terms of growth rate, cell yield
or number of cells produced per mole ATP consumed (94). This can explain why type IV is
more common than the other types. The type IV is also the most variable with eight subtypes,
IVa-IVh, and these variations are largely believed to be a result of higher mobility of type IV
compared to the other types (32). The SCCmec I, IV, V and VII do not generally carry any
other resistance genes except the mecA, but the types II and III on the other hand cause multiresistance, due to integration of plasmids. Besides carrying resistance genes in the SCCmec
MRSA can harbour resistance genes in other sites of the genome and on plasmids. (32;61).
The origin of mecA and SCCmec is not known, but there are data indicating that they
originated from CoNS (51;61). The leading theory is that SCCmec elements have been
introduced several times in S. aureus, due to the genetic difference of MRSA strains and that
the same strains harbour different SCCmec (137). The suggested number of times that
SCCmec has been introduced in S. aureus is at least 20, while the same number for S.
epidermidis is around 50 times (34).
5.3
Hospital- and community-Dssociated MRSA
MRSA was traditionally considered just as nosocomial pathogens, but this changed when a
novel MRSA was isolated in 1993 among aborigines in Western Australia, not previously
exposed to western healthcare (51). After this first report came several more about
community-associated MRSA (CA-MRSA), mainly occurring in groups with high physical
contact. Today, CA-MRSA is described worldwide in all type of settings, and is primarily
associated with skin and soft tissue infections. Furthermore, the trend is that CA-MRSA
strains are replacing the more traditional hospital-associated MRSA (HA-MRSA) strains (32).
In the USA, >75 % of the MRSA cases are defined to have CA background and in
Scandinavia the CA-MRSA is more prevalent then the HA-MRSA (32;148). No universal
definition of what a CA-MRSA really is exist, but they are generally considered to be strains
isolated in outpatient settings or from a patient within 48 hours of hospital admission, with no
history of previous MRSA infection/colonisation or contact with healthcare settings the
previous year (32;37). In addition, the patients should have no permanent catheters or medical
devices piercing the skin. CA-MRSA is more genetically diverse compared to HA-MRSA,
and appear generally to carry SCCmec IV. HA-MRSA generally harbours SCCmec I, II and
III and is more resistant compared to the CA-MRSA, which mainly shows β-lactam
19
resistance. However, the CA-MRSA is more virulent, probably due to the presence of
additional virulence factors. One such factor can be the genes lukS-PV and lukF-PV, which
encode the subunits of Panton Valentine leukocidin (PVL). PVL is a cytotoxin that causes
necrosis and leukocyte destruction through pore formation (21). It is also the most consistent,
of the transferable toxins, in CA-MRSA. Among CA-MRSA harbouring SCCmec IV, PVL
has been found in 40-90 % of the isolates, while the corresponding number among SCCmec I
and II is <5 %. However, there is evidence suggesting that PVL is not a major virulence factor
(110;165).
HA-MRSA mainly appears to constitute a handful of highly epidemic clones that share a
genetic background with epidemic Methicillin-sensitive Staphylococcus aureus (MSSA)
(32;34), suggesting that their successful proliferation lays in their genetics rather than that
they are MRSA. Originally, it was believed that CA-MRSA was spread from the hospital to
the community, but when applying PFGE and MLST it was shown that the CA-MRSA were
genetically distinct from the main HA-MRSA (113;137). It was also shown that CA-MRSA
had a genetically distinct background in distinct geographic areas, or that they can originate
from many different backgrounds in the same area. However, CA-MRSA clones that are more
frequent than others, have been identified and they are rapidly spreading worldwide (34;60).
They belong mainly to the MLST ST8, ST30 and ST80, which are the same STs that are
found most frequently in MSSA isolated from the community. Although the CA-MRSA are
increasing they do not dominate in the community, as the HA-MRSA do in hospitals in some
parts of the world, e.g. Japan, U.S.A and U.K. (34;80).
5.4
MRSA in animals
Besides being a problem in human medicine, MRSA is an increasing problem in veterinary
settings (132). MRSA was first isolated in 1972 from cows with inflammation of the udder,
and has since then been identified in a variety of domestic animals (95). The MRSA from
household pets is generally identical to the human HA-MRSA, indicating that the animals
have been colonised through human contact. However, MRSA isolated from equines and pigs
have been described to be distinct from the human MRSA (32;95). In the Netherlands, it was
found that 39 % of the pigs carried MRSA, and it has been shown that persons living or
working on farms (particularly pig farms) have an increased risk of being colonised with
MRSA (98). Therefore, it is possible that animals and animal farms can be significant
reservoirs for known and new MRSA clones.
20
5.5
β-lactams in wastewaters
β-lactam antibiotics, foremost penicillins and cephalosporins, have been described to occur in
untreated and treated sewage from WWTPs (25;56;173;174), but concentrations were
generally low, measured in ng - μg per litre. One study focusing on WWTPs in Sweden,
showed that penicillins and cephalosporins could not be detected in a majority of samples
(100). Furthermore, the β-lactams were reduced in the treatment process at WWTPs by up to
100 % and detected with far lower frequency in treated sewage (56;173;174). However, the
removal varies and the cephalosporin Cefalexin varied in reduction between 9 and 89 %
between different WWTPs (56). In addition, the cephalosporins were generally found in
higher concentrations compared to the other groups, and appeared to be more resilient to the
wastewater treatment, i.e. found in higher degree and concentration in outlet (56;173;174).
The penicillins on the other hand were only occasionally detected, and in very low
concentrations (23;56;100;173;174). In surface waters, β-lactams were rarely detected and
when they occurred it was at concentrations well below those in wastewater (23;25;174). The
reason why β-lactams are not persistent in aquatic environments is hydrolysis of the
chemically unstable β-lactam ring (25).
5.6
Methicillin-resistant staphylococci and other ß-lactam resistance in wastewater
and other environments
MRSA has not been isolated from wastewater, but methicillin-resistant CoNS has been
isolated from hospital wastewater (145;164). In addition, the mecA gene has been molecularly
detected in hospital wastewater, but not in municipal wastewater, surface water or agriculture
soil (including soil fertilised with wastewater) (108;145;164). However, other ß-lactam
resistant bacteria and genes encoding ß-lactam resistance occur frequently in wastewater.
Bacteria resistant to penicillins, amoxicillin and/or ampicillin have been isolated from both
treated and untreated wastewater in several studies (30;41;46;52;53;131;147;181). These
studies generally focused on isolation of Acinetobacter spp., Enterobacteriaceae,
Enterococcus spp. and/or Pseudomonas spp., and described 10 % up to 100 % of the isolates
as penicillin, amoxicillin and/or ampicillin resistant. In addition, many of the isolates were
described to be resistant to cephalosporin and/or resistant to more than one class of antibiotic.
It has also been shown that ESBL-producing E. coli and Klebsiella spp. frequently occur in
wastewater (114;130). The question of whether WWTPs selects for a higher prevalence of
antibiotic resistance or not is still unanswered. Some studies have shown more extensive and
higher frequency of antibiotic resistance in treated wastewater (41;46;147), while others have
21
described the opposite (53;131;181). One study focusing on quantification of the ß-lactamase
gene blaTEM group showed that the concentration of the gene group were higher in WWTPs
compared to natural environments, but that the wastewater treatment reduced blaTEM
concentration, both related to water volume and total-DNA, by ~0.5 log10 unit (91). However,
if related to total number of 16S rRNA genes an increase, by ~1 log10 unit, was observed in
treated compared to untreated wastewater.
Besides wastewater ß-lactam, including cephalosporin, resistant bacteria have been isolated
from surface water, soil and wetland sediment (10;38;58;172), and in a polluted estuary, ßlactamases genes were frequently detected (66). It has also been shown that anthropogenic
influence leads to an increased prevalence of ß-lactam resistance (24;38;91;172).
6.
Aminoglycoside antibiotics
The aminoglycosides are rapid broad-spectrum bactericidal antibiotics, which are naturally
produced by Streptomyces spp. or Micromonospora spp. (74;87). Examples of commonly
used aminoglycosides are gentamicin, tobramycin and streptomycin. They are primarily used
to treat infections caused by aerobic gram-negative bacteria, but are also active against
Staphylococcus spp., Enterococcus spp. and some Mycobacteria spp.. However, their
usefulness is limited by their serious toxicity, e.g. nephrotoxicity and ototoxicity. The class is
characterised by a backbone structure consisting of an aminocyclitol ring, which in most
clinically used aminoglycosides are streptamine or 2-deoxystreptamine (Fig 8). The exception
Figure 8. The backbone structure of aminoglycosides. Jana and Deb (74)
is streptomycin, which has a streptidine molecule. The ring in all aminoglycosides is saturated
with amine and hydroxyl substitutions, and connected to amino sugars (aminoglycosides)
through glycosidic linkages. The bactericidal effect of aminoglycosides is primarily due to
22
binding to the 30S ribosomal subunit rendering the ribosome unavailable for translation,
which results in halting protein synthesis. In addition to their direct effect on protein
synthesis, they cause membrane damage through changed membrane composition and
permeability, altered cellular ionic concentrations and disturbance of the DNA and RNA
synthesis.
6.1
Aminoglycosides in wastewater
Occurrence of aminoglycosides in wastewater and other environments is scarcely studied, due
to the fact that the antibiotics are not persistent in the environment (72). Compared to many of
the other antibiotic classes, they are more readily degraded in the environment. Furthermore,
aminoglycosides are generally positively charged under acidic conditions, which can facilitate
adsorption to negatively charged soil and clay particles, thus further decreasing the
concentration. However, one study was able to measure the occurrence of aminoglycosides in
hospital wastewater, showing concentrations from 0.4 to 7.6 μg per litre (106).
6.2
Resistance to aminoglycosides
Resistance to aminoglycosides by bacteria is mediated by three mechanisms: (1) reduction of
aminoglycoside concentrations via either dedicated or general efflux pumps, (2) alteration of
target for the agent and (3) enzymatic inactivation of the aminoglycoside (74;87). It should be
pointed out that the same bacterial strain often utilises more than one mechanism. Reduction
of aminoglycoside concentration is mainly seen in non-fermenting gram-negative bacilli, such
as Pseudomonas spp., and among others the nodulation cell division transporters superfamily
play an important role in intrinsic or acquired resistance. Alteration of target sites mainly
occurs through two ways; the acquisition of genes encoding rRNA methylases, which are
capable of modifying 16sRNA at positions critical for binding, and secondly, point mutations
of the ribosomal target. However, out of the three resistance mechanisms enzymatic
inactivation is by far the most common and widespread, with >50 enzymes already described
(42;74). Most of the enzymes, and the genes encoding them, are detected in gram-negative
bacteria and the genes are generally located on transferable elements, i.e. plasmids,
transposons and integrons. Three types of modifications have been described and the enzymes
are classified based on these mechanisms: acetyltransferases (AAC); adenylyltransferases
/nucleotidyltransferases (ANT); and phosphotransferases (APH) (Figure 9A), but all three
mechanisms have the same end result, reduced affinity for the aminoglycosides to the
ribosomal target. The enzymes have different positions on the substrate for modification,
23
which in the classification is denoted by a number, with or without a primer or double primer
(Figure 9B). A further subclassification can be done based on which aminoglycoside that is
Figure 9A. Modification of aminoglycoside by acetyltransferases (AAC);
adenylyltransferases/nucleotidyltransferases (ANT); and phosphotransferases (APH) B. The
modifying enzymes and their substrates: A amikacin, Dbk dibekacin, G gentamicin, GmB
geneticin, I isepamicin, K kanamycin, N netilmicin, S Sisomicin and T tobramycin. Modified
from Dessen et al (35) and Jana and Deb (74).
modified. The genes encoding the transferases follow the same nomenclature, but can be
further subclassified when different genes encode transferases with the same substrate profile.
A bifunctional enzyme ACC(6’)+APH(2’’) exists that can simultaneously acetylate and
phosphorylate, resulting in resistance to most clinically used aminoglycosides. The gene
encoding ACC(6’)+APH(2’’) is widely distributed among pathogenic bacteria and is common
and highly conserved in gram-positive bacteria such as staphylococci, enterococci and
streptococci.
6.3
Aminoglycoside resistance in wastewaters and other environments
The prevalence of bacteria resistant to aminoglycosides in wastewater varies greatly between
location and occasion. Studies focusing on Enterococcus spp. have described 0 % up to 20 %
of the isolates as aminoglycoside resistant (30;46;116). Aminoglycoside resistance among
Acinetobacter spp., E. coli and Pseudomonas spp. isolates vary from generally no resistance,
up to 15 % (30;46;53;131;172). However, when aminoglycoside resistant bacteria were
isolated, they were often multi-resistant, and most isolates carried more than one gene
encoding aminoglycoside resistance (30;163). Studies have also described that genes
encoding enzymatic inactivation, from all three classes, can be detected in wastewater
(67;157;163). In addition, conjugative plasmids carrying the genes have been isolated, mainly
from activated sludge in WWTPs, and have been shown to be transferred to aminoglycoside-
24
sensitive strains in vitro. It has also been indicated that the number of aminoglycoside
resistant isolates increases over the treatment process in WWTPs (53;42;147), but also the
contrary has been described (181).
Aminoglycoside resistant bacteria and genes encoding the resistance have been detected in
soil, farm-soil, coastal and estuarine water, seawater, creek/river and lake water
(13;67;84;150;156;163), and conjugative plasmids have been isolated from most of these
environments. It has also been described that soil harbours several not previously
characterised AAC-, APH- and ANT-genes (133).
7.
Tetracycline antibiotics
The tetracyclines are the second most clinically used antibiotic class in Sweden and are
extensively used worldwide in human and animal therapy (27;155). They are also extensively
used in farming, agriculture, and aquaculture. Tetracyclines exhibit activity against a wide
range of gram-positive and -negative bacteria, but also against protozoan parasites and filarial
nematodes. In addition, they have non-bacterial effects such as anti-inflammation,
immunosuppression, inhibition of lipase and collagenase activity, enhancement of gingival
fibroblast cell attachment and wound healing (134). Tetracycline is also the cheapest class of
antibiotics, and has no major side effects in humans. Examples of commonly prescribed
tetracyclines for human treatment are minocycline and doxycycline.
The tetracycline molecules all contain a linear fused tetracycline core (Fig 10) and an
Figure 10. Structure of the tetracycline molecule
Rn = the functional groups. Modified from Chopra and Roberts, 2001 (27)
assortment of functional groups is attached to the core (27). They are only bacteriostatic and
affect the bacteria through binding to the 30S subunit of the ribosome, resulting in halted
25
protein synthesis. However, the binding is reversible and diluting the antibiotic can reverse
the effect. Besides their effect on bacteria, they also bind to 70S ribosomes in mitochondria
and weakly to the 80S ribosome in eukaryotic cells.
7.1
Tetracyclines in wastewater
Tetracyclines have been detected in both treated and untreated wastewater from WWTPs,
including Swedish ones, with concentrations generally in the range 10 to 1000 ng per litre
(14;15;56;78;100;174). However, other studies have described no or limited occurrence in
wastewater (23;70;173). Concentrations were generally reduced, by 70 to 100 %, by the
wastewater treatment process at WWTPs, but studies have also shown limited, below 30 %, to
no reduction (15;56;100;174). The rate of reduction is probably influenced by removal of
solids in the treatment facilities, because there are indications of strong adsorption of
tetracyclines to soil, sludge, clay and sediment. (15;72). However, tetracyclines appear not to
be biodegraded, but photodegradation on the other hand plays an essential role in removal
(72). In rivers receiving WWTP discharge, tetracycline concentrations can be as high as 400
μg per litre in the sediment (128), compared to concentrations generally below 100 ng per
litre in discharge or in receiving surface water (14;100;158;174).
7.2
Resistance to tetracycline
Resistance to tetracycline exists in all bacterial genera, but the rate of resistant bacteria varies
greatly between genus, species and geographical location. Most tetracycline resistant bacteria
also harbour more than one resistance gene (27;134). In total, 35 tetracycline resistance genes
(tet-genes) and 3 oxytetracycline resistance gene (otr-genes) have been described (135).
However, no innate difference between the tet-genes and otr-genes exists, instead the
nomenclature reflects the bacterium first described to carry the gene.
Of the 38 genes, 23 encode resistance through efflux pumps, most belonging to the major
facilitator superfamily (MFS) (Fig 11) (134;135). The tetracycline MFS are membraneassociated proteins, commonly residing in the lipid bilayer, that export tetracycline out of the
cell against the concentration gradient by exchange of one proton. This reduces tetracycline
concentration and thus protects the intracellular ribosomes. Most pumps confer resistance
only to tetracycline and doxycycline, but not minocycline and tigecycline. Only four genes
encoding efflux pumps, tetK, tetL, tet33 and tet38, have been detected in gram-positive
26
Figure 11. Example of structure of the tetracycline major-facilitator superfamily.
EmrA: periplasmic accessory protein and ErmB: cytoplasmic accessory.
Modified from Mckeegan et al. (112).
bacteria. The tetB gene has the widest host range among gram-negatives and it confers
resistance to minocycline.
Eleven of the genes encode ribosomal protection proteins (RPP), of which tetO and tetM are
the best studied. However, it is generally assumed that the other nine genes have similar
mechanisms (29;135). The RPPs are soluble cytoplasmic proteins conferring a wider
spectrum of resistance than efflux pumps. They have high sequence similarity to the bacterial
ribosomal elongation factors EF-G and EF-Tu and display, like these factors, guanosine
triphosphatase (GTPase) activity. However, they cannot substitute the EF-G and EF-Tu, but
may have evolved from them. Instead the RPPs confer resistance by binding to the
tetracycline inhibited ribosome at the base of the h34 protein, causing an allosteric disruption
and thereby releasing the tetracycline. Exactly by which mechanism the RPPs distinguish the
tetracycline inhibited ribosome is not completely understood, nor whether they actively
prevent the antibiotic from rebinding. RPPs have been detected in gram-positive bacteria,
anaerobes and non-enteric gram-negative bacteria, and tetM is the most commonly detected
tet-gene in gram-positive pathogens.
In addition to the efflux pumps and RPPs, three genes (tetX, tet34 and tet37) have been
described to confer resistance through enzymatic modification, but they are not common
(135). The tetX has only been described in anaerobic Bacteroides spp. and tet34 only in
Vibrio spp. isolates from marine fish, while no specific bacteria have been identified carrying
27
the tet37. Another gene, the tetU, exists, which confers low-level resistance with unknown
functions.
The tet-genes are mainly found on highly mobile elements, i.e. plasmids, transposons,
conjugative transposons and integrons, and with a few exceptions pathogens acquire their
resistance by acquisition of these elements. In addition, horizontal gene transfer has been
described both between different species and genera (134). The gram-positive RPPs genes are
generally harboured on small plasmids, while the gram-negative efflux pump genes are found
on transposons or integrons inserted in a high diversity of plasmids.
7.3
Tetracycline resistance in wastewater and other environments
Tetracycline resistant bacteria are commonly isolated from a wide range of environments such
as ground water, seawater, freshwater, aquaculture, soil, feedlot, and from wastewater
(11;26;115;120;124). Most studies dealing with tetracycline resistance in WWTPs has
focused on isolation of Coliform bacteria, Escherichia spp., Klebsiella spp., Citrobacter spp.,
Pseudomonas spp., Enterobacter spp., Salmonella spp., Enterococcus spp., and Acinetobacter
spp. (30;41;52;131;147;183). In untreated wastewater, the rate of resistance among the
isolates ranged from 6-60 % and in treated wastewaters from 16-75 %, with most of the
studies describing an increase of resistance. However, there are examples describing limited
or no occurrence of tetracycline resistant isolates (46). Rates of tetracycline resistant bacteria
varied greatly between different types of wastewater, for example if the WWTP receives
hospital or pharmaceutical wastewater, the level of resistant bacteria reported is generally
higher compared to municipal wastewater (52;55;131). High rates of tetracycline resistance
have also been shown in slaughterhouse WWTPs e.g. 86 % of Enterococcus spp. being
tetracycline resistant (30). It has been shown that the percentage of tetracycline resistant
bacteria increases with increasing influent tetracycline concentration in a WWTP (83). The
biomass also influences the rate, at least in activated sludge, where higher rates of tetracycline
resistant bacteria correlated with higher biomass (82).
There is conflicting evidence if
effluent from WWTPs increases the rate of tetracycline resistance in receiving water with
studies showing an increase (52;172) and others describing no difference between WWTPs
effluent, receiving water and non-receiving water (19;131).
Using a microarray targeting, 23 genes encoding tetracycline resistances, it was shown that
only the genes encoding efflux pumps could be detected in farm and garden soil (124). The
28
tetA gene was detected in all soils investigated, with other common genes being tetC and
tetD. In animal faeces, the RPP genes were more abundant with no single efflux gene
frequently detected. In WWTPs, genes encoding efflux pumps and RPP could both be
continuously detected over the treatment process, with tetA detected in all samples (11). In
addition, tetA was the only gene detected in lake water. Concentration of genes tetG,
encoding an efflux pump, and tetQ, encoding a RPP, were also determined during the
wastewater treatment process. It was shown that tetG was reduced by 1-2 log10 units and tetQ
by 2-3 log10 units, related to wastewater volume. If gene copies instead were related to totalDNA, the reduction was lower or did not occur. When tetA-E were investigated in urban and
hospital wastewater tetA, but none of the other genes, was detected in all samples (55). From
seawater samples collected in close proximity to outflow of WWTPs, the genes tetA, tetC,
tetE, tetK and tetM could be detected (120). In sediment samples, collected from rivers
receiving wastewater from WWTPs and agriculture, concentrations of tetW and tetO were
generally higher compared to a river with low anthropogenic affect (128).
Tetracycline resistant bacteria and genes encoding the resistance are common in wastewater
lagoons connected to animal confinement facilities and/or feedlots, with a 100% detection
frequency in all studies (26;85;127;149;151). Both genes encoding RPP and efflux pumps
were detected and quantified in the lagoons, but concentrations of RPPs were two to seven
times higher (85;151). Genes commonly detected and/or had high abundance in the lagoons
were tetM, tetA and tetB. It has been shown that the concentration of both gene types
increased with higher usage of tetracycline in the feedlots (127;149), but that the RPP genes
increased more drastically (127). However, only weak correlation of gene concentrations to
measured tetracycline concentrations in the lagoons were detected. Tetracycline resistant
bacteria and the genes encoding resistance were also frequently detected in groundwater wells
and surface water in close vicinity to the animal settings (26;85;151). However, the
concentration of the genes was much lower, and genes encoding efflux pumps had higher
concentrations than the genes encoding RPPs (85). The rates of resistant bacteria were also
lower e.g. 79 % of the Enterococci being tetracycline resistant in the lagoons as compared to
15 % in the surface waters (151).
Another environment where tetracycline resistance is commonly detected is fresh and marine
aquacultures (64;115;120;139). In these studies the genes tetA and tetB were commonly
29
detected both in total DNA extracted and in tetracycline resistant bacterial isolates. Some of
the isolates were also able to transfer tetA and tetB in vitro through plasmid conjugation.
8.
Polymerase chain reaction (PCR) and Real-time PCR
The use of molecularly based methods for detection and assessment of microorganisms are an
integral part in microbiology laboratories today. An abundance of different nucleic acid based
systems exists for detection and assessment of antimicrobial resistance and mechanisms,
extensively reviewed by Fluit et al. (42) and Sundsfjord et al. (153), with PCR, first
introduced in 1988 by Mullis and co-workers (142), as the golden standard. Compared to
cultivation-based methods, PCR offers a rapid, sensitive and easy way for detection of
resistance genes and is especially useful for slow-growing and uncultivable microorganisms.
This is important for evaluating microorganisms in non-clinical settings, such as wastewater
and soil, as it has been estimated that >99 % of the bacteria are uncultivable (9). However, the
PCR approach contains some limitations, e.g. it is only possible to screen for what you
already know, silent and pseudogenes giving false positives exists, and you cannot directly
detect resistance caused by point mutations. Furthermore, PCR detects nucleic acids rather
than living cells so there is a risk of “free” nucleic acids or nucleic acids from dead cells
giving false-positives (179).
The basis for PCR is the detection and synthesis of a specific DNA/RNA template (129). The
template is identified with two short synthetic and sequence-specific oligonucleotides, a.k.a.
primers, and the primers also acts as the initiation points for the synthesis, which is carried out
by polymerases. The first and most used polymerase is Taq DNA polymerase, isolated from
Thermus aquaticus, but another commonly used is the high fidelity Pfu DNA polymerase,
isolated
from
Pyrococcus
furiosus.
In
addition,
to
polymerase
and
primers,
deoxyribonucleotide triphosphates (dNTP), which are building blocks of the synthesised
DNA strands, are needed. The PCR is carried out by temperature cycling (Fig 12), starting
with high temperature for separation/melting of the double stranded helical DNA molecule
(denaturing), after which the temperature is lowered to let primers bind (annealing) and then
increased, usually to around 72 ºC, to allow the polymerase to extend the primers from the
3´end using the dNTPs (extension). This procedure is usually repeated through 25 - 45 cycles,
which will allow for an exponential increase in the amount of DNA produced, with each
30
Figure 12. The PCR temperature cycle
newly formed product acting as a template during the remaining cycles. PCR is a sensitive
method where the stability and efficiency of the reaction are affected by many parameters;
DNA/RNA concentration/quality, primer concentration/quality, dNTP concentration, type and
concentration of polymerase, buffer type, cycling parameters, type of tubes/wells and PCR
instrument. Furthermore, after completion it requires a separation of the formed PCR-product,
usually by agarose gel electrophoresis with ethidium bromide staining, to confirm that the
template has been amplified and that it is of expected size.
The basis for PCR has not changed significantly since its introduction over twenty years ago,
but the method has been modified and improved through the years. The most significant
advancement is the introduction of real-time PCR in 1993 (68) and its development into a
commercially available real-time quantitative PCR in 1996 (65). The biggest problem with
conventional PCR is that it is only possible to study the end product of the reaction. In theory
the PCR reaction generates copies in an exponential fashion with a doubling in each cycle, but
this is only true if the PCR function with 100 % efficiency. During the later cycles, the PCR
will not generate products in an exponential fashion. It will instead enter a plateau phase due
to limitations in the polymerase, primer concentrations and dNTP concentrations. Real-time
PCR circumvents this problem by using fluorescent dyes that bind to the amplified DNA in
each cycle (50;89;160). The fluorescent signal is measured in each cycle and is directly
proportional to the amplified DNA, making it possible to follow the PCR in “real time”. This
makes it possible to study the amount of PCR product during the exponential phase and to
extrapolate back to determine the original amount of template. One must be aware that during
the initial cycles the signal will be weak and cannot be distinguished from the background,
but as the template is amplified the signal exponentially increase (Fig 13). The time the signal
31
is amplified over the background depends on the initial amount of template, with higher
concentrations reaching the threshold earlier (Fig 13). In order to compare different runs, the
background fluorescence is subtracted from each separate run; a baseline is set (Fig 13).
Figure 13. A hypothetical real-time PCR amplification plot.
Amplification plot = the fluorescence signal vs. the PCR cycle number.
Furthermore, separate runs are only comparable in the exponential phase, so a threshold must
be set for the runs where all are above the baseline, in their exponential phase and parallel in
growth. The number of PCR cycles that are required to reach this threshold is called the Ct
value. Using a serial dilution of pure DNA with known concentrations the efficiency of the
PCR reaction can be estimated from a standard curve (Fig 14). The Ct values of the diluted
standards will be plotted against the logarithm of the standards concentration, dilution factor
or number of template copies. The efficiency of the PCR corresponds to the slope of the
curve, with a –3.33 slope corresponding to 100 % efficiency. Using the standard curve it is
Figure 14. Real-time PCR standard curve. Showing the fluorescence amplification plots in
logarithmic scale for six standard samples and the interpolated standard curve using
determined Ct values and known template numbers.
also possible to determine the concentration in unknown samples, by using the determined
equation of the curve and a Ct value for an unknown sample. This approach is often referred
to as absolute quantification or standard-curve quantification. An alternative is relative
32
quantification, where, simply put, the determined Ct for the template of interest is compared
to the Ct of a reference run simultaneously with the template. The reference must not vary in
concentration or expression, with the efficiency of both reactions as equal as possible and
preferably above 90 % (50;89;160). In addition, to offer the possibility to follow the PCR in
real-time and to quantify DNA/RNA, real-time PCR also eliminates the need for post-PCR
processing, which reduces the time to obtain results and minimise the risks for carryover
contamination.
Today a wide range of different fluorescence chemistries offered by different manufacturers
exists (50;89;160). The chemistries can be broadly categorised as, (1) Non-specific DNA
binding dyes/fluorophores, e.g. SYBR® green and Ethidium bromide, (2) Specific
hybridisation probes, a probe is a extra oligonucleotide designed to anneal in a position
“between” the primers, e.g. TaqManTM and Molecular beacons, (3) Labelled primers, e.g.
LUXTM and AmplifluorTM. In some of the chemistries, the dye/fluorophore is incorporated
into the final PCR product, e.g. SYBR® green or LUXTM. This binding can be utilised for
characterisation of the product. After the end of the PCR cycling, the temperature is increased
slowly and the fluorescence continuously measured. What happens is that the PCR product
starts to “melt”, resulting in the fluorescence decreasing gradually until it reaches a
temperature where the double stranded DNA completely separates, resulting in an abrupt drop
in fluorescence. This temperature is referred to as the melting temperature and is determined
by the length and sequence of the amplified product (Fig 15). The melting temperature can be
Figure 15. Melting curve analysis. Fluorescence drops rapidly when the PCR products melt.
The melting temperature is the inflection point that is easily determined as the maximum of
the negative first derivate of the measured melting curve.
used to discriminate between primer-dimers, non-specific products, specific products and
differences in sequences of a product (50;89;160).
33
In this thesis, PCR and real-time PCR are by far the most important methods. Real-time PCR
is used for detection and quantification of genes encoding antibiotic resistance in wastewater
environments. Several studies have earlier demonstrated real-time PCR as a fast, reliable and
sensitive method for this purpose (11;85;91;127;145;149;151;164). Both PCR and real-time
PCR are also applied to detect and characterise MRSA.
8.1
LUXTM real-time PCR
In this thesis we mainly worked with LUX (Light Upon eXtension) TM, which is a relatively
recent technique that only use one fluorophore that is attached to the 3’ end of either the
forward or reverse primer (102). The labelled primer is constructed to form a hairpin-loop
thus giving it fluorescence-quenching capability. The hairpin is achieved by designing a nonsequence specific tail at the 5’-end complementary to the 3’ end. To get high quenching
capability the fluorophore should be incorporated within 3 nucleotides of a guanosine base
(31;117). Furthermore, it is preferable to have a blunt-ended guanosine-cytosine base pairing.
When the primer is incorporated into double stranded DNA the fluorophore is dequenched
resulting in an increase in fluorescence (Fig 17). This technique simplifies the PCR kinetics
Figure 17. The Light Upon eXtension (LUX TM) effect.
and the 5’-tail prevents primer-dimer formation and mispriming (118). A further advantage is
that the fluorophore is incorporated into the amplified DNA, making it possible to perform
melting curve analysis. Assays are also easy to design and it is a cost-effective technique,
since it does not use probes or various fluorophores. In addition, it can be used on most realtime PCR platforms.
34
9.
Aims
The knowledge about occurrence and survival of MRSA in non-clinical environments and
what roles these might play in dissemination and development are very limited. The primary
aim of this thesis was to establish whether MRSA and the mecA gene occur in wastewater and
how they might be affected by the wastewater treatment in a full-scale WWTP. The secondary
aim was to generate knowledge about the occurrence and concentration of genes encoding
aminoglycoside and tetracycline resistance in wastewater environments. It is well described
that wastewater harbours aminoglycoside and tetracycline resistant bacteria and genes
encoding these resistances, as described in the introduction of this thesis. However, it is
scarcely studied how the gene concentrations are affected over time and by wastewater
treatment. In this thesis the focus was on the genes aac(6’)-Ie+aph(2’’), mecA, tetA and tetB.
The specific aims for each individual paper were:
I.
Develop quantitative real-time PCR assays, based on the LUXTM primer system, for
the genes, aac(6’)-Ie+aph(2’’), mecA, tetA and tetB, to be used for analysing
wastewater samples. The occurrence and concentration of these four genes were then
investigated in three different types of wastewater environments.
II.
Determine if the mecA gene, S. aureus and MRSA can be detected using real-time
PCR in a full-scale municipal WWTP. Furthermore, to investigate the effects of the
wastewater treatment process on mecA concentration and the prevalence of S. aureus
and MRSA.
III.
Characterise the MRSA flora in a municipal wastewater treatment plant by cultivation,
how the treatment processes affects the clonal-distribution and to establish
possible genetic relations to clinical isolates.
IV.
Investigate how the treatment process in a full-scale municipal WWTP affects the
concentrations of tetA and tetB, and determine if physiochemical parameters, bacterial
and biomass load, influence the gene concentrations.
35
10.
Sampling sites
For paper I, samples were collected from three sites representing widely different
wastewater-associated environments:
(1)
Korslöt overland flow area located in Vagnhärad in the southeast central Sweden
and operated by Torsabygdens Teknik AB. It was constructed in year 2000 on a
previous farmland. The area is covered with Phalaris arundinacea and reed Pragmites
australis and operated all year around. From 2000 - 2003 it was flooded with
wastewater from the Korslöt WWTP, and from 2003 it has been applied with
landfill leachates from Korslöt recycling site. From the area, triplicate soil samples
were collected at 0 – 10 cm depth, every third month from August 2004 to August
2005.
(2)
Ryaverket WWTP, Göteborg, described in section 3.3, samples were collected from
the plastic biofilm carriers in the nitrifying trickling filters. The biofilm was brushed
off and suspended in 1 ml phosphate buffered saline (PBS). The samples were
collected with approximately two-week intervals from December 2004 to February
2005.
(3)
County Hospital in Kalmar, on the coast in Southeast Sweden, sludge was collected
from a sewage pipeline, as grab samples, with two-week intervals from April 2003 to
July 2003. The pipeline received sewage from a building containing 127 beds (72
general and urology surgery, 33 gynaecology and 22 paediatric).
Papers II - IV were carried out using wastewater samples collected at Ryaverket WWTP
from key locations chosen to reflect the treatment processes at the plant (Fig 16). In paper II
and IV, one 500 ml water sample was collected as a grab sample, every month from March
2006 to February 2007 at eight locations in the plant; inlet, after primary settling, activated
sludge, after secondary settling, outlet, before and after trickling filter and reject water from
the centrifuges. For paper II, two additional grab-samples were collected from Inlet in
November 2007 with a two-week interval. All wastewater samples were collected in new and
clean polyethylene high-density bottles. For paper III, water samples were collected from
36
four locations: inlet, activated sludge, outlet and after trickling filters (Fig 16). From each
location, one 1-litre sample was collected in autoclaved Pyrex glass bottles every second
Figure 16. Schematic drawing of the wastewater treatment process at Ryaverket, with
sampling locations indicated with numbers. 1. Inlet 2. After primary settling 3. Activated
sludge 4. After secondary settling 5. Outlet 6. Before trickling filters 7. After trickling filters
and 8. Water from rejects pumps. (Paper II)
week from May 5th 2008 to July 1st 2008. Inlet and Outlet samples were collected from
wastewater, pooled over 24 h, while unpooled samples from activated sludge and after
trickling filters were collected on site in the treatment process.
11.
Design and evaluation of LUXTM real-time PCR assays for the
mecA, tetA, tetB and aac(6’)-Ie+aph(2’’) genes
The main objective of paper I was to develop quantitative real-time PCR assays based on the
LUXTM technique for detection and quantification of the genes mecA, tetA, tetB and aac(6’)Ie+aph(2’’), to be applied on samples collected from wastewater environments. At the start of
this project, no well-established quantitative method was available for these genes.
Quantitative methods are needed to be able to monitor prevalence of the genes in wastewater
in order to study differences over time, between different environments or if concentrations
are increasing due to anthropogenic effects.
Using nucleotide sequences of mecA, tetA, tetB and aac(6’)-Ie+aph(2’’) collected from
GenBank (www.ncbi.nlm.nih.gov), primer-pairs suitable for LUXTM real-time PCR were
designed for each gene, using the LUXTM designer (Invitrogen Corp., Paisley, UK) and the
Lasergen 6.0 (DNASTAR Inc., Madison, WI, USA) (Table 5). The primer pairs were
evaluated using conventional PCR on reference strains and DNA extracted from wastewater
37
TABLE 5. PCR primers, targeting genes coding for antibiotic resistance, designed for LUX™
real-time PCR assay. Lower-case letters at the 5´-end of primers denote the part of the primer
added to give the hairpin structure. The lower-case letter t in the 3´-end of primers denotes the
putative location of the dye (L in the primer name). F = forward, R = reverse (Paper I)
Primer
Target gene
Sequence (5´ - 3´)
(Amplicon size, bp)
aac(6´)-F1
aac(6´)-R1-L
aac(6´)-Ie
+aph(2´´) (364)
CATTATACAGAGCCTTGGGAAGA
gaacatgGCCCTCGTGTAATTCATGtTC
mecA-F5
mecA-R5-L
mecA (108)
TGCTCAATATAAAATTAAAACAAACTACG
gaagtATGACGCTATGATCCCAATCTAACTtC
tetA-F2-L
tetA-R2
tetA (96)
cagccTCAATTTCCTGACGGGCTG
GAAGCGAGCGGGTTGAGAG
tetB-F1-L
tetB-R1
tetB (101)
cagcaAGTGCGCTTTGGATGCtG
TGAGGTGGTATCGGCAATGA
samples. The specificity of the primer-pairs were verified through agarose gel electrophoresis
and by nucleotide sequencing. Using the designed primers, assay conditions for the real-time
PCR were optimised for annealing temperature, Mg2+-concentration and primer concentration.
The efficiencies and detection limits were then determined for each assay using serial
dilutions of reference strains. Slopes (= PCR efficiencies) of the standard curves generated
from the serial dilutions were as follow for each primer pair (given as mean, n ≥ 3): aac(6´)F1+ aac(6´)-R1-L, -4.17; mecA-F5+mecA-R5-L, -3.52; tetA-F2-L+tetA-R2, -3.52 and tetBF1-L+tetB-R1; -3.31. The detection limits were determined to aac(6’)-Ie+aph(2’’), 15 gene
copies; mecA, 10 gene copies; tetA, 10 gene copies, and tetB, 5 gene copies, all per PCR
reaction.
To evaluate if the developed LUXTM real-time PCR assays were suitable for quantification of
mecA, tetA, tetB and aac(6’)-Ie+aph(2’’) in wastewater, they were applied on the samples
collected from an overland flow area, a municipal WWTP and a hospital sewage pipeline. We
were able to detect and/or quantify all genes in the three investigated environments. The
results are summarised in table 6. To verify that the PCR efficiency was not compromised,
due to co-extraction of inhibitory substances, serial dilutions were performed on the samples,
on which the assays then were applied. It was shown that no inhibition of the PCR occurred in
samples diluted more than 10-1. The specificity of the assays was verified in all collected
samples using melting curve analysis.
38
Table 6. Summary of the results of detection and quantification of the genes mecA, tetA, tetB
and aac(6’)-Ie+aph(2’’) in three wastewater environments. BD = Below detection limit, D =
Detected but not reliable quantified, Q = Quantified.
Gene
Overland flow
Ryaverket
Hospital Sewage
area, 5 samples
WWTP, 5 samples
pipeline, 8 samples
(genes per μg DNA) (genes per μg DNA)
(genes per μg DNA)
2
5
aac(6’)-Ie
D: 5/5
D: 2/5
Q: 8/8 (4.0x10 -1.4x10 )
3
3
+aph(2’’)
Q: 3/5 (1.4x10 -6.3x10 )
…………………………………………………………………………………………………...
mecA
BD: 5/5
D: 4/5
BD: 7/8
3
BD: 1/5
Q: 1/8 (4.5 x 10 )
…………………………………………………………………………………………………...
4
4
5
5
tetA
D: 5/5
Q: 5/5 (1.7x10 -8.0x10 )
Q: 8/8 (2.8x10 -6.5x10 )
.......................................................................................................................................................
3
3
tetB
D: 4/5
BD: 5/5
Q: 8/8 (1.1x10 -5.7x10 )
2
Q: 1/5 (4.2x10 )
The only environment where all four genes could be detected was the hospital sewage
pipeline (Paper I). In addition, this was the environment with the highest concentration of all
genes (Table 6). This might indicate that there is a higher selection for antibiotic resistance in
this environment. The hospital pipeline probably has relatively high concentration of
antibiotics compared to the other environments, which may help to sustain or select for
resistance. Earlier studies have also described relatively high amounts of antibiotics in the
wastewater at Kalmar County Hospital (76;99). The number of resistant bacteria that are
transported to the hospital sewage pipeline is also probably higher compared to the two other
environments. It was shown that the concentrations varied over time in the hospital pipeline,
but no clear trend could be detected. The overland flow area is the environment with generally
the lowest gene concentrations. This was expected because it treats landfill leachates and
therefore probably has the lowest antibiotic pressure. Tetracycline resistance appears do be
commonly detected in the environment, as described in section 8.3. So it could be expected
that the genes encoding tetracycline would be detected in all environments and have the
highest concentrations. The tetA gene had the clearest trend, lowest concentrations in the
overland flow area and highest in the hospital pipeline, when comparing concentrations
between the three environments. It should be pointed out that tetA appears to be a common
gene in anthropogenic-affected environments, and compared to tetB, its more frequently
detected (11;55;124). According to the literature mecA has previously only been detected in
hospital wastewater. However, in this study it was shown that besides occurring in hospital
wastewater mecA has a stable occurrence in municipal wastewater, since it was detected in
39
four out of five biofilm samples collected from the trickling filter in a WWTP. To our
knowledge, this is also the first study to detect aac(6’)-Ie+aph(2’’) in municipal wastewater,
but it has previously been detected in manure and soil (67).
12.
Detection of the mecA gene, S. aureus and MRSA in a full-scale
wastewater treatment plant
The fact that mecA was detected for the first time in municipal wastewater (paper I) raised
questions whether it would be possible to detect S. aureus and MRSA in wastewater (paper II)
and how the prevalence of mecA and possibly S. aureus and MRSA are affected over the
treatment process and time in a full-scale WWTP. To investigate this we used the
experimental set-up shown in Figure 18.
Figure 18. Overview of the experimental procedure for molecular detection of mecA, the S.
aureus specific nuc gene and MRSA.
It was shown that mecA could be detected continuously over the year at all sampling sites,
except in water from the rejects pumps (Table 7). S. aureus could also be detected every
month in inlet, after primary settling and activated sludge. In all other sampling sites S. aureus
occurred in most months, with the exception of water from reject pumps. MRSA was detected
during most months in inlet, after primary settling and in activated sludge. In all other
sampling sites MRSA was only occasionally detected, with the exception of after secondary
settling and before trickling filter, where MRSA could not be detected.
40
Table 7. Molecular detection of mecA, nuc/S. aureus and MRSA, in wastewater samples
collected from eight sites in a full-scale WWTP March 2006 to February 2007
To our knowledge this is the first report that shows occurrence of both S. aureus and MRSA
in municipal wastewater. The results indicate that both S. aureus and MRSA are more
resilient than previously believed and that wastewater may be a potential reservoir for MRSA.
However, the treatment process appears to reduce MRSA as evidenced by that it is mainly
detected in the early treatment steps. The mesophilic digestion of sludge collected from
primary settling is likely to have a highly reducing effect on MRSA, as well as on S. aureus
and mecA, because all three could only be occasionally detected in the water from the reject
pumps. That the mecA gene is detected in all locations indicates that it mainly originates from
CoNS, since CoNS often carry mecA, at least in the clinical setting (61), and since
methicillin-resistant S. epidermidis have been isolated from wastewater (145). Because both
mecA and S. aureus simultaneously occur in the same environment, there may be a potential
for new MRSA to develop due to horizontal gene transfer. The potential for S. aureus to
transfer genes encoding antibiotic resistance in wastewater has earlier been described (122).
13.
Cultivation and characterisation of MRSA from municipal
wastewater
In paper II it was shown that MRSA occurs in municipal wastewater and could be molecularly
detected in the early treatment steps in a full-scale WWTP. However, we did not show
whether MRSA is viable or how MRSA is affected over the treatment process. In addition,
41
the study raised some further questions: is there only one or a few strains present and are these
specific for the WWTP? In order to answer these questions cultivation of MRSA was
performed from four sampling sites in the WWTP (paper III), using the experimental set-up in
figure 19. The clonal relationship of MRSA isolates from wastewater to the 20 most common
clinical MRSA spa types in Sweden 2007 and 2008 were also determined using BURP
analysis.
Figure 19. Overview of the experimental procedure for cultivation of MRSA from a full-scale
wastewater treatment plant
In total, 189 MRSA were isolated from wastewater, corresponding to 29 different spa types
including six novel spa types t3950, t4013, t4100, t4102, t4203 and t4140 (Paper III). Most of
the isolates, 65 %, 12 spa types, were resistant only to β-lactam antibiotics, but 21 %, 9 spa
types, were defined as multi-resistant (resistant to at least two classes of antibiotics in addition
to β-lactams). MRSA was isolated from inlet and activated sludge, but not from outlet or after
trickling filters. Most of the isolates, 66 %, were cultivated from inlet and 19 spa types were
identified in inlet compared to 15 spa types in activated sludge (Figure 20). The majority of
the spa types were detected at one sampling site and one sampling occasion, but spa types
t018, t127, t172 and t186 occurred in more than one sampling. In the activated sludge 40 % of
42
spa types were defined as multi-resistant, while in inlet only 21 % were multi-resistant. PVL
positive isolates, spa types t008, t019, t127 and t852, were only detected in activated sludge.
The isolates were shown to harbour either SCCmec type I or IV, with 63 % carrying type IV.
Figure 20. The number of MRSA isolates and their spa types in Inlet (I) and Activated sludge
(A). The t127/t127* spa type with two different antibiograms. (paper III)
Based on that Sweden is a low prevalence area for MRSA and earlier studies have indicated
low or no occurrence of S. aureus in wastewater, it was surprising that we were able to isolate
such a great variety of spa types. However, the treatment process appears to have a negative
impact on the MRSA as they can only be isolated early in the WWTP, confirming the results
in paper II. Although the treatment process reduced MRSA, there are indications that it selects
for more extensive antibiotic resistance and possibly more virulent strains. These indications
are a higher rate of the spa types being multi-resistant in the activated sludge, and PVL
positive isolates only being detected at this stage.
The results show that it is not one specific lineage of MRSA that survives in the wastewater
(Paper III). Eight of the spa types, t002, t008, t015, t018, t019, t127, t186 and t790, detected
in the wastewater are among the 20 most commonly reported MRSA spa types in Sweden and
nine of them, t002, t008, t015, t018, t019, t067, t127, t172 and t790 are among the 30 most
reported spa types in the Ridom SpaServer. The remaining spa types isolated from
wastewater clustered in the same BURP-CC as the top 20 MRSA in Sweden (Fig 21). In
addition, several of the wastewater isolates showed a genetic relationship, sharing spa type
and SCCmec with worldwide-distributed MRSA clones (32). Together these data indicate that
43
the wastewater MRSA is most likely a reflection of the carriage in the community. This
assumption is further supported by the fact that a large and diverse MRSA flora, changing
from each sampling occasion, can be detected in the wastewater under such a short time
period.
Figure 21. Dendogram based on BURP analyses of MRSA spa types isolated from municipal
wastewater, and the 20 most common clinical MRSA spa types 2007 to 2008. Framed spa
types = wastewater MRSA isolates (Paper III)
44
14.
The effect of wastewater treatment on concentrations of mecA, tetA
and tetB
Using the LUXTM real-time PCR assays developed in paper I, we investigated how the
wastewater treatment process in a full-scale WWTP affected concentrations of mecA, tetA
and tetB (paper II and IV). Furthermore, it was determined how the gene concentration
correlated to faecal bacteria, e.g. E. coli and Coliform bacteria, physiochemical parameters,
and biomass, using the experimental set-up in Figure 22.
Figure 22. Overview of the experimental procedure for detection and quantification of mecA,
tetA and tetB
It was shown that mecA, tetA and tetB could be continuously detected throughout the year at
all sampling sites and that gene concentrations varied over the year (Fig 23), but no trend
could be observed for the genes. When comparing the median of the gene concentrations,
related to wastewater volume over the year at each sample site, it was observed that they
decreased during the wastewater treatment. However, the three genes showed higher
concentrations in the activated sludge compared to the other sampling sites. Higher
concentration for tetA was also observed at reject water compared to at inlet. If related to
biomass, i.e. total-DNA, the median over the year for mecA and tetA concentrations still
decreased, but the difference between median values is smaller than those of comparison of
genes and water volume. The median for mecA in inlet and after primary settling and for tetB
in inlet, after primary and secondary settling and outlet were on similar levels. The median
concentrations of tetA and tetB were lower in the three locations affected by biological
treatment compared to the other sampled locations.
45
Figure 23. Concentration of the genes. Sampling sites; 1. Inlet, 2. after primary settling, 3.
activated sludge, 4. after secondary settling, 5. outlet, 6. before trickling filter, 7. after
trickling filter, and 8. water from reject pumps. ●denotes the gene concentration for each
month. The horizontal line = the median of concentrations over the year. Months when the
genes were detected, but not quantified, are marked as 10 genes, corresponding to the
detection limit of each respective gene at the different sampling site.
It was shown that the treatment process in a full-scale WWTP reduced concentrations of
genes encoding antibiotic resistance, both related to wastewater volume and total-DNA
(papers II and IV). Comparing inlet and outlet, a reduction in concentration related to volume
was observed in eleven months for tetA and tetB, on average by 1.2 and 0.9 log10 units,
respectively, and for mecA in 8 months by 1.4 log10 units. If gene concentrations were related
to total-DNA the reductions were on average 0.3 log10 units in 9 months for tetA, 0.2 log10
units in 7 months for tetB and 0.5 log10 units in 8 months for mecA. These results are
supported by earlier studies showing reduction of genes encoding tetracycline resistance and
genes encoding ß-lactamases in WWTPs (11;91). In the activated sludge, the gene copies
related to water volume, exhibited higher concentrations compared to inlet in all months, on
46
average by 0.8 log10 for tetA, 0.9 log10 for tetB and 1.1 log10 units for mecA. However, when
related to total-DNA the gene levels are lower in all months for tetA and tetB, on average by
0.7 log10 units and 0.5 log10 units respectively, and in 8 months, by 0.5 log10 unit for mecA,
indicating that the genes have a selective disadvantage here. That gene concentrations related
to volume are higher at sampling sites with a high biomass, suggests that biomass load
influence the number of antibiotic resistance genes. This assumption is further supported by
that tetA concentration correlates to total-DNA concentration at most sampling sites, and that
reduction of the genes when related to total-DNA is smaller compared to related to water
volume. The smaller or lack of differences may also indicate that the reduction of gene copies
are partly due to removal of biomass rather than direct removal of the genes. Especially for
tetA and tetB, the reduction of biomass appears to play an essential role, since tetA and tetB
reductions correlates to biomass reduction. However, there is still a reduction in gene
concentration when comparing inlet and outlet, indicating additional mechanisms behind the
reduction. Over the trickling filter, concentrations of tetA and tetB related to total-DNA are
reduced, on average by 0.4 and 0.4 log10 units (paper IV), respectively, but the mecA
concentration show an increase in 10 months by 0.4 log10 units (paper II). These data suggest
a selective advantage for mecA in the trickling filter, but not for tetA or tetB.
Reduction of tetA and tetB concentrations, but not mecA, correlates to reduction of biomass,
COD and Ptot (Paper IV). This indicates that the removal of tetA and tetB may partly be
explained by precipitation and sedimentation, as Ptot is removed by precipitation and
sedimentation and COD and biomass are partly reduced by sedimentation. The notion that
sedimentation is important for removal of tetA and tetB is further supported by that the
reductions correlated to reduction of E. coli and coliform bacteria. Sedimentation has been
described to have an essential role in removal of bacteria (48;182).
47
15.
•
Conclusions
Methicillin-resistant S. aureus (MRSA) was for the first time shown to occur in
wastewater, using both cultivation and molecular detection. The treatment
processes in a full-scale municipal WWTP were also shown to reduce both number
and diversity of MRSA. However, there are indications that the treatment process
selects for strains with more extensive antibiotic resistance and possibly higher
virulence.
•
LUX™ Real-time PCR assays targeting the genes aac(6´)-Ie+aph(2´´), mecA,
tetA, and tetB were developed and verified to be fast, sensitive and specific
methods for detection and quantification of the respective resistance genes in
wastewater environments. The results show that real-time PCR can be a useful tool
in monitoring concentration of genes encoding antibiotic resistance, between
different environments and over time, to be used for assessment of anthropogenic
impact.
•
By applying the developed real-time PCR assays targeting the genes mecA, tetA,
and tetB, it was shown that the wastewater treatment in a full-scale municipal
wastewater treatment plant reduced concentrations of the genes encoding antibiotic
resistance. Furthermore, biomass loads appear to influence the total number of
genes, and the reduction may partly be explained by removal of biomass. In
addition, the reduction of tetA and tetB concentrations can partly be explained
through precipitation and sedimentation in the plant.
16.
Future work
In this thesis it was described that MRSA survives in municipal wastewater, and wastewater
may therefore be a potential reservoir and source for MRSA. In the future it should be
addressed whether new strains of MRSA can evolve in wastewater and investigated whether
transfer of SCCmec can occur. However, this might be difficult to study because it has not
been established what the transfer mechanisms of SCCmec are or what triggers the gene
transfer. A way to get an indication whether transfer has recently occurred is to determine if
48
the isolated MRSA-strains can perform spontaneous excision of the SCCmec, i.e. if the
recombinases are active. The excision of SCCmec is an essential step in a possible transfer.
The SCCmec from the isolated MRSA strains should also be further subtyped to establish if
they possibly are new subtypes. It should be investigated whether MRSA has the capability to
collect “new” resistance genes and virulence factors in wastewater that is not carried by the
SCCmec. Furthermore, the CoNS flora in wastewaters should be paid attention to, as well as
the question if they carry SCCmec, which SCCmec type they harbour and whether they can
transfer SCCmec.
Although it was shown that the wastewater treatment reduced the concentration of genes
encoding antibiotic resistance, the concentrations in the outlet are probably higher than in the
receiving environment. It should therefore be investigated what potential impact this input has
on the surrounding environments. In addition, it was shown that mecA concentrations
increased over the trickling filter in the WWTP. A more extensive study should therefore be
considered for the trickling filters, for example to establish which bacteria carry mecA, if
transfer of mecA occur and if there is an increase in bacteria carrying the mecA. The
sedimentation, precipitation and removal of biomass were shown to play an essential role in
the decrease of gene concentration. It is therefore important to establish the ratio of resistant
bacteria and genes encoding the resistance in the collected sludge and how concentrations are
affected by the treatment of the sludge. We have also described that concentrations vary over
the year in the WWTP, but since no trend could be shown it would be interesting to measure
concentrations of antibiotics in the wastewater and establish if concentrations of the genes can
be correlated to incoming antibiotic concentrations.
49
17.
Acknowledgements
During the five years I’ve spent trying to be a researcher I have had the benefit of meeting a
lot of interesting people, making new friends and getting help and input (sometimes much,
sometimes little) from different persons. In this section I will therefore try to thank and
acknowledge the people that has contributed or helped me both with the project and/or on a
personal level. This will also include people I met outside the research and knew before my
time as a PhD-student. If you’re not mentioned here I’m sorry, but sometimes you just forget
people temporarily or completely.
Jan-Ove Johansson and Elisabeth Börjesson, my dad and mom, for their love, support,
encouragement and convincing me after high school that it was not in my best interest to
study to be a welder. You have always supported and cheered me on through my studies
despite the fact you haven’t understand half of what I’ve been doing or talking about.
(Far och mor, för er kärlek, support, uppmuntran och för ni övertygade mig att det inte var i
mitt intresse att läsa svetsareutbildningen efter gymnasiet. Ni har alltid stött och hejat fram
mig genom mina år på universitet fast ni en stor del av tiden inte förstått vad jag har arbetat
med och pratat om.)
Martina Börjesson, my sister for your love, support and just being the best sister in the world.
She is also acknowledged for taking the time to read and comment on the popular science
summary in this thesis making sure that a layman would understand it. Stefan Johansson my
brother-in-law, for his support and for actually being a brother.
My main-supervisor Per-Eric Lindgren for giving me the opportunity to become a PhDstudent and for your support.
Thanks to Åke Hagström at the University of Kalmar for introducing me to the world of
microbiology and giving me the first taste of the researchers life. So this is the guy you can
blame for my decision to become a PhD-student and my extra years spent at the University.
Andreas Matussek my hockey stick wielding and bicycle crazy co-supervisor for getting
involved in my project when he was needed the most. Thank you for your support and
especially your time, which I know you have a lack off.
Thanks to Lennart Nilsson and Björn Olsen for being my co-supervisors although you were
not involved 100 percent of the time you had always time over for me, my questions and
signing the papers. Special thanks to Lennart who took the time to comment and give
suggestions on this thesis.
Thanks to the “posse” Johan “Charmören” Nordgren, Peter “Boxholmaren” Wilhelmsson,
“Snäll-” Pontus Lindblom, Björn “Macho-Man” Berglund and the hang-around Fredrik
“Dansken a.k.a Hissförstöraren” Nyström for their contributions to my work, friendship and
the many funny hours consuming beer and other beverages. Hopefully this is not the end, but
we will always have Girona. Magalí Martí our Catalonian flower for inviting the gang to
Girona and being a good friend. A special thanks to Pontus and Johan for the many hours
spent on the squash court, it was fun despite the fact that I almost always seem to lose. Pontus
should also be recognised for his meticulous review of my thesis. In addition, Björn deserves
a special thank because as my office-mate he became the guinea pig for a lot of sentences and
formulations used and not used in this thesis, and for commenting on the thesis. Thanks to
50
Carina Sundberg for being my “lab mom” when I started and being a good friend. Other
people that should be thanked are Elisabeth Hollén and Charlotte Strandgren and also all the
other people that been or is part of Per-Eric’s group and out-groups.
All the other people, past and present, at the Division of Medical Microbiology for five funny
and pleasant years and being the best coworkers a guy could have. You are not mentioned by
name but you are all remembered. A special acknowledgment should go to the lady-mob, the
ones that possess the true power at the division. Amanda Welin also deserves a special thank
as she provided linguistic revision on this thesis and for being a good friend.
Thanks to Sara Melin, Sture Löfgren and Olaf Dienus for their help and contribution to my
work. Thanks also to all the other people at the Division of Laboratory Medicine, County
Hospital Ryhov for support and making my stay at Ryhov a pleasant one.
To all my other “real-life” friends old and new for your love, support and just being my
friends, hopefully I will now have more time over for you.
I would also like to thank Wala och Folke Danielssons Stiftelse, Svenska
Försäkringsföreningen Hans Dalbergs stiftelse för miljö och hälsa, Stiftelsen Längmanska
Kulturfonden and Knut och Alice Wallenbergs Stiftelse for giving me the opportunities to
visit Lyon (BAGECO-8), Vienna (ISME-11), Tokyo (WaterMicro-14) and
Cairns/Sydney/Melbourne (ISSSI-13).
Finally remember the words of the immortal Homer Simpson:
"Phfft! Facts. You can use them to prove anything”
51
18.
References
1. http://www.bacterio.cict.fr/
2. http://www.census.gov/
3. http://earthwatch.unep.net/health/
4. http://www.gryaab.se
5. http://naturvardsverket.se/ sv/Verksamheter-med-miljopaverkan/Avlopp/Siffror-omavloppsvattenrening/
6. http://nobelprize.org/nobel_prizes/medicine/laureates/1945
7. http://www.rivm.nl/earss
8. Alanis, A.J. (2005) Resistance to antibiotics: are we in the post-antibiotic era? Arch Med
Res 36: 697-705.
9. Amann, R.I., Ludwig, W., and Schleifer, K.H. (1995) Phylogenetic identification and in
situ detection of individual microbial cells without cultivation. Microbiol Rev 59: 143-169.
10. Ash, R.J., Mauck, B., and Morgan, M. (2002) Antibiotic resistance of gram-negative
bacteria in rivers, United States. Emerg Infect Dis 8: 713-716.
11. Auerbach, E.A., Seyfried, E.E., and McMahon, K.D. (2007) Tetracycline resistance genes
in activated sludge wastewater treatment plants. Water Res 41: 1143-1151.
12. Babic, M., Hujer, A.M., and Bonomo, R.A. (2006) What's new in antibiotic resistance?
Focus on beta-lactamases. Drug Resist Updat 9: 142-156.
13. Baker-Austin, C., McArthur, J.V., Lindell, A.H., Wright, M.S., Tuckfield, R.C., Gooch, J.
et al. (2009) Multi-site Analysis Reveals Widespread Antibiotic Resistance in the Marine
Pathogen Vibrio vulnificus. Microb Ecol 57: 151-159.
14. Batt, A.L., Bruce, I.B., and Aga, D.S. (2006) Evaluating the vulnerability of surface
waters to antibiotic contamination from varying wastewater treatment plant discharges.
Environ Pollut 142: 295-302.
15. Batt, A.L., Kim, S., and Aga, D.S. (2007) Comparison of the occurrence of antibiotics in
four full-scale wastewater treatment plants with varying designs and operations. Chemosphere
68: 428-435.
16. Berger-Bachi, B. (2002) Resistance mechanisms of gram-positive bacteria. Int J Med
Microbiol 292: 27-35.
17. Berger-Bachi, B., and Rohrer, S. (2002) Factors influencing methicillin resistance in
staphylococci. Arch Microbiol 178: 165-171.
18. Berglund, C., Molling, P., Sjoberg, L., and Soderquist, B. (2005) Predominance of
staphylococcal cassette chromosome mec (SCCmec) type IV among methicillin-resistant
Staphylococcus aureus (MRSA) in a Swedish county and presence of unknown SCCmec
types with Panton-Valentine leukocidin genes. Clin Microbiol Infect 11: 447-456
19. Boon, P.I., and Cattanach, M. (1999) Antibiotic resistance of native and faecal bacteria
isolated from rivers, reservoirs and sewage treatment facilities in Victoria, south-eastern
Australia. Lett Appl Microbiol 28: 164-168.
20. Boon, N., De Windt, W., Verstraete, W., and Top, E. (2002) Evaluation of nested PCRDGGE (denaturing gradient gel electrophoresis) with group-specific 16S rRNA primers for
the analysis of bacterial communities from different wastewater treatment plants. FEMS
Microbiol Ecol 39: 101-112.
21. Boyle-Vavra, S., and Daum, R.S. (2007) Community-acquired methicillin-resistant
Staphylococcus aureus: the role of Panton-Valentine leukocidin. Laboratory Invest 87: 3-9.
22. Bronner, S., Monteil, H., and Prevost, G. (2004) Regulation of virulence determinants in
Staphylococcus aureus: complexity and applications. FEMS Microbiol Rev 28: 183-200.
52
23. Brown, K.D., Kulis, J., Thomson, B., Chapman, T.H., and Mawhinney, D.B. (2006)
Occurrence of antibiotics in hospital, residential, and dairy effluent, municipal wastewater,
and the Rio Grande in New Mexico. Sci Total Environ 366: 772-783.
24. Burgos, J.M., Ellington, B.A., and Varela, M.F. (2005) Presence of multidrug-resistant
enteric bacteria in dairy farm topsoil. J Dairy Sci 88: 1391-1398.
25. Cha, J.M., Yang, S., and Carlson, K.H. (2006) Trace determination of beta-lactam
antibiotics in surface water and urban wastewater using liquid chromatography combined with
electrospray tandem mass spectrometry. J Chromatogr A 1115: 46-57
26. Chee-Sanford, J.C., Aminov, R.I., Krapac, I.J., Garrigues-Jeanjean, N., and Mackie, R.I.
(2001) Occurrence and diversity of tetracycline resistance genes in lagoons and groundwater
underlying two swine production facilities. Appl Environ Microbiol 67: 1494-1502.
27. Chopra, I., and Roberts, M. (2001) Tetracycline antibiotics: mode of action, applications,
molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev 65: 232260
28. Cohen, M.L. (2000) Changing patterns of infectious disease. Nature 406: 762-767.
29. Connell, S.R., Tracz, D.M., Nierhaus, K.H., and Taylor, D.E. (2003) Ribosomal
Protection Proteins and Their Mechanism of Tetracycline Resistance. Antimicrob Agents
Chemother 47: 3675-3681.
30. da Costa, P.M., Vaz-Pires, P., and Bernardo, F. (2006) Antimicrobial resistance in
Enterococcus spp. isolated in inflow, effluent and sludge from municipal sewage water
treatment plants. Water Res 40: 1735-1740.
31. Crockett, A.O., and Wittwer, C.T. (2001) Fluorescein-labeled oligonucleotides for realtime pcr: using the inherent quenching of deoxyguanosine nucleotides. Anal Biochem 290:
89-97.
32. Deurenberg, R.H., and Stobberingh, E.E. (2008) The evolution of Staphylococcus aureus.
Infect Genet Evol 8: 747-763.
33. Deurenberg, R.H., Vink, C., Kalenic, S., Friedrich, A.W., Bruggeman, C.A., and
Stobberingh, E.E. (2007) The molecular evolution of methicillin-resistant Staphylococcus
aureus. Clin Microbiol Infect 13: 222-235.
34. de Lencastre, H., Oliveira, D., and Tomasz, A. (2007) Antibiotic resistant Staphylococcus
aureus: a paradigm of adaptive power. Curr Opin Microbiol 10: 428-435.
35. Dessen, A., Di Guilmi, A.M., Vernet, T., and Dideberg, O. (2001) Molecular mechanisms
of antibiotic resistance in gram-positive pathogens. Curr Drug Targets 1: 63-77.
36. de Sousa, M.A., and de Lencastre, H. (2004) Bridges from hospitals to the laboratory:
genetic portraits of methicillin-resistant Staphylococcus aureus clones. FEMS Immunol Med
Microbiol 40: 101-111.
37. Diederen, B.M., and Kluytmans, J.A. (2006) The emergence of infections with
community-associated methicillin resistant Staphylococcus aureus. J Infect 52: 157-168.
38. Esiobu, N., Armenta, L., and Ike, J. (2002) Antibiotic resistance in soil and water
environments. Int J Environ Health Res 12: 133-144.
39. Feil, E.J., and Enright, M.C. (2004) Analyses of clonality and the evolution of bacterial
pathogens. Curr Opin Microbiol 7: 308-313.
40. Feng, Y., Chen, C.J., Su, L.H., Hu, S., Yu, J., and Chiu, C.H. (2008) Evolution and
pathogenesis of Staphylococcus aureus: lessons learned from genotyping and comparative
genomics. FEMS Microbiol Rev 32: 23-37.
41. Ferreira da Silva, M., Vaz-Moreira, I., Gonzalez-Pajuelo, M., Nunes, O.C., and Manaia,
C.M. (2007) Antimicrobial resistance patterns in Enterobacteriaceae isolated from an urban
wastewater treatment plant. FEMS Microbiol Ecol 60: 166-176.
42. Fluit, A.C., Visser, M.R., and Schmitz, F.J. (2001) Molecular detection of antimicrobial
resistance. Clin Microbiol Rev 14: 836-871.
53
43. Fracchia, L., Pietronave, S., Rinaldi, M., and Giovanna Martinotti, M. (2006) Site-related
airborne biological hazard and seasonal variations in two wastewater treatment plants. Water
Res 40: 1985-1994.
44. Frenay, H.M., Bunschoten, A.E., Schouls, L.M., van Leeuwen, W.J., VandenbrouckeGrauls, C.M., Verhoef, J., and Mooi, F.R. (1996) Molecular typing of methicillin-resistant
Staphylococcus aureus on the basis of protein A gene polymorphism. Eur J Clin Microbiol
Infect Dis 15: 60-64.
45. Fujioka, R.S., and Unutoa, T.M. (2006) Comparative stability and growth requirements of
S. aureus and faecal indicator bacteria in seawater. Water Sci Technol 54: 169-175.
46. Gallert, C., Fund, K., and Winter, J. (2005) Antibiotic resistance of bacteria in raw and
biologically treated sewage and in groundwater below leaking sewers. Appl Microbiol
Biotechnol 69: 106-112.
47. Garcia-Armisen, T., and Servais, P. (2007) Respective contributions of point and nonpoint sources of E. coli and enterococci in a large urbanized watershed (the Seine river,
France). J Environ Manage 82: 512-518.
48. George, I., Crop, P., and Servais, P. (2002) Fecal coliform removal in wastewater
treatment plants studied by plate counts and enzymatic methods. Water Res 36: 2607-2617.
49. Georgopapadakou, N.H. (1993) Penicillin-binding proteins and bacterial resistance to
beta-lactams. Antimicrob Agents Chemother 37: 2045-2053.
50. Ginzinger, D.G. (2002) Gene quantification using real-time quantitative PCR: an
emerging technology hits the mainstream. Exp Hematol 30: 503-512.
51. Grundmann, H., Aires-de-Sousa, M., Boyce, J., and Tiemersma, E. (2006) Emergence and
resurgence of meticillin-resistant Staphylococcus aureus as a public-health threat. Lancet 368:
874-885.
52. Guardabassi, L., Petersen, A., Olsen, J.E., and Dalsgaard, A. (1998) Antibiotic resistance
in Acinetobacter spp. isolated from sewers receiving waste effluent from a hospital and a
pharmaceutical plant. Appl Environ Microbiol 64: 3499-3502
53. Guardabassi, L., Lo Fo Wong, D.M., and Dalsgaard, A. (2002) The effects of tertiary
wastewater treatment on the prevalence of antimicrobial resistant bacteria. Water Res 36:
1955-1964.
54. Guardabassi, L., and Dalsgaard, A. (2004) Occurrence, structure, and mobility of Tn1546like elements in environmental isolates of vancomycin-resistant enterococci. Appl Environ
Microbiol 70: 984-990.
55. Guillaume, G., Verbrugge, D., Chasseur-Libotte, M.-L., Moens, W., and Collard, J.-M.
(2000) PCR typing of tetracycline resistance determinants (Tet A-E) in Salmonella enterica
serotype Hadar and in the microbial community of activated sludges from hospital and urban
wastewater treatment facilities in Belgium. FEMS Microbiol Ecol 32: 77-85.
56. Gulkowska, A., Leung, H.W., So, M.K., Taniyasu, S., Yamashita, N., Yeung, L.W. et al.
(2008) Removal of antibiotics from wastewater by sewage treatment facilities in Hong Kong
and Shenzhen, China. Water Res 42: 395-403.
57. Guzman, C., Jofre, J., Montemayor, M., and Lucena, F. (2007) Occurrence and levels of
indicators and selected pathogens in different sludges and biosolids. J Appl Microbiol 103:
2420-2429.
58. Halda-Alija, L. (2004) Incidence of antibiotic-resistant Klebsiella pneumoniae and
Enterobacter species in freshwater wetlands. Lett Appl Microbiol 39: 445-450.
59. Hallin, M., Deplano, A., Denis, O., De Mendonca, R., De Ryck, R., and Struelens, M.J.
(2007) Validation of pulsed-field gel electrophoresis and spa typing for long-term, nationwide
epidemiological surveillance studies of Staphylococcus aureus infections. J Clin Microbiol
45: 127-133.
54
60. Hanssen, A.M., Fossum, A., Mikalsen, J., Halvorsen, D.S., Bukholm, G., and Sollid, J.U.
(2005) Dissemination of community-acquired methicillin-resistant Staphylococcus aureus
clones in northern Norway: sequence types 8 and 80 predominate. J Clin Microbiol 43: 21182124.
61. Hanssen, A.M., and Ericson Sollid, J.U. (2006) SCCmec in staphylococci: genes on the
move. FEMS Immunol Med Microbiol 46: 8-20.
62. Hardman, J., Limbird, L., and Gilman, A. (2006) Goodman and Gilman's The
Pharmacological Basis of Therapeutics: The McGraw-Hill Companies.
63. Harmsen, D., Claus, H., Witte, W., Rothganger, J., Turnwald, D., and Vogel, U. (2003)
Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using
novel software for spa repeat determination and database management. J Clin Microbiol 41:
5442-5448.
64. Heepngoen, P., Sajjaphan, K., Ferguson, J.A., and Sadowsky, M.J. (2008) Genetic and
physiological characterization of oxytetracycline-resistant bacteria from giant prawn farms. J
Microbiol Biotechnol 18: 199-206.
65. Heid, C.A., Stevens, J., Livak, K.J., and Williams, P.M. (1996) Real time quantitative
PCR. Genome Res 6: 986-994.
66. Henriques, I., Moura, A., Alves, A., Saavedra, M.J., and Correia, A. (2006) Analysing
diversity among beta-lactamase encoding genes in aquatic environments. FEMS Microbiol
Ecol 56: 418-429.
67. Heur, H., Krögerrecklenfort, E., Wellington, E.M.H., Egan, S., van Elsas, J.D., van
Overbeek, L.S. et al. (2002) Gentamicin resistance genes in environmental bacteria:
prevalence and transfer. FEMS Microbiol Ecol 42: 289-302.
68. Higuchi, R., Fockler, C., Dollinger, G., and Watson, R. (1993) Kinetic PCR analysis: realtime monitoring of DNA amplification reactions. Biotechnology (N Y) 11: 1026-1030.
69. Hiramatsu, K., Cui, L., Kuroda, M., and Ito, T. (2001) The emergence and evolution of
methicillin-resistant Staphylococcus aureus. Trends Microbiol 9: 486-493.
70. Hirsch, R., Ternes, T., Haberer, K., and Kratz, K.L. (1999) Occurrence of antibiotics in
the aquatic environment. Sci Total Environ 225: 109-118.
71. Holden, M., Lindsay, J., and Bentley, S. (2006) The grapes of wrath. Nat Rev Microbiol 4:
806-807.
72. Huang, C.H., Renew, J.E., Smeby, K.L., Pinkston, K., and Sedlak, D.L. (2001)
Assessment of potential antibiotic contaminants in water and preliminary occurrence analysis.
Water Res 120: 30-40.
73. Iversen, A., Kuhn, I., Franklin, A., and Mollby, R. (2002) High prevalence of
vancomycin-resistant enterococci in Swedish sewage. Appl Environ Microbiol 68: 2838-2842.
74. Jana, S., and Deb, J.K. (2006) Molecular understanding of aminoglycoside action and
resistance. Appl Microbiol Biotechnol 70: 140-150.
75. Jevons, MP. (1961). Celbenin-resistant staphylococci. BMJ 1: 124-125.
76. Jarnheimer PA, Ottoson J, Lindberg R, Stenström TA, Johansson M, Tysklind M, Winner
MM, Olsen B. (2004) Fluoroquinolone antibiotics in a hospital sewage line; occurrence,
distributionand impact on bacterial resistance. Scand J Infect Dis 36: 752–755.
77. Jorgensen, S.E., and Halling-Sorensen, B. (2000) Drugs in the environment. Chemosphere
40: 691-699.
78. Karthikeyan, K.G., and Meyer, M.T. (2006) Occurrence of antibiotics in wastewater
treatment facilities in Wisconsin, USA. Sci Total Environ 361: 196-207.
79. Katayama, H., Haramoto, E., Oguma, K., Yamashita, H., Tajima, A., Nakajima, H., and
Ohgaki, S. (2008) One-year monthly quantitative survey of noroviruses, enteroviruses, and
adenoviruses in wastewater collected from six plants in Japan. Water Res 42: 1441-1448.
55
80. Kilic, A., Mert, G., Senses, Z., Bedir, O., Aydogan, H., Basustaoglu, A.C., and
Appelbaum, P.C. (2008) Molecular characterization of methicillin-resistant Staphylococcus
aureus nasal isolates from Turkey. Antonie van Leeuwenhoek 94: 615-619.
81. Kim, S., and Aga, D.S. (2007) Potential ecological and human health impacts of
antibiotics and antibiotic-resistant bacteria from wastewater treatment plants. J Toxicol
Environ Health B Crit Rev 10: 559-573.
82. Kim, S., Jensen, J.N., Aga, D.S., and Weber, A.S. (2007) Fate of tetracycline resistant
bacteria as a function of activated sludge process organic loading and growth rate. Water Sci
Technol 55: 291-297.
83. Kim, S., Jensen, J.N., Aga, D.S., and Weber, A.S. (2007) Tetracycline as a selector for
resistant bacteria in activated sludge. Chemosphere 66: 1643-1651.
84. Kimiran-Erdem, A., Arslan, E.O., Yurudu, N.O.S., Zeybek, Z., Dogruoz, N., and Cotuk,
A. (2007) Isolation and identification of Enterococci from seawater samples: Assessment of
their resistance to antibiotics and heavy metals. Environ Monit Assess 125: 219-228.
85. Koike, S., Krapac, I.G., Oliver, H.D., Yannarell, A.C., Chee-Sanford, J.C., Aminov, R.I.,
and Mackie, R.I. (2007) Monitoring and source tracking of tetracycline resistance genes in
lagoons and groundwater adjacent to swine production facilities over a 3-year period. Appl
Environ Microbiol 73: 4813-4823.
86. Koreen, L., Ramaswamy, S.V., Graviss, E.A., Naidich, S., Musser, J.M., and Kreiswirth,
B.N. (2004) spa typing method for discriminating among Staphylococcus aureus isolates:
implications for use of a single marker to detect genetic micro- and macrovariation. J Clin
Microbiol 42: 792-799.
87. Kotra, P.L., Haddad, J., and Mobashery, S. (2000) Aminoglycosides: Perspectives on
Mechansims of action and resistance and strategies to Counter resistance. Antimicrob Agents
Chemother 44: 3249-3256.
88. Kruse, H., and Sorum, H. (1994) Transfer of multiple drug resistance plasmids between
bacteria of diverse origins in natural microenvironments. Appl Environ Microbiol 60: 40154021.
89. Kubista, M., Andrade, J.M., Bengtsson, M., Forootan, A., Jonak, J., Lind, K. et al. (2006)
The real-time polymerase chain reaction. Mol Aspects Med 27: 95-125.
90. Kummerer, K., al-Ahmad, A., and Mersch-Sundermann, V. (2000) Biodegradability of
some antibiotics, elimination of the genotoxicity and affection of wastewater bacteria in a
simple test. Chemosphere 40: 701-710.
91. Lachmayr, K.L., Kerkhof, L.J., Dirienzo, A.G., Cavanaugh, C.M., and Ford, T.E. (2009)
Quantifying nonspecific TEM beta-lactamase (blaTEM) genes in a wastewater stream. Appl
Environ Microbiol 75: 203-211.
92. Le Cann, P., Ranarijaona, S., Monpoeho, S., Le Guyader, F., and Ferre, V. (2004)
Quantification of human astroviruses in sewage using real-time RT-PCR. Res Microbiol 155:
11-15.
93. Lee, D.Y., Shannon, K., and Beaudette, L.A. (2006) Detection of bacterial pathogens in
municipal wastewater using an oligonucleotide microarray and real-time quantitative PCR. J
Microbiol Methods 65: 453-467.
94. Lee, S.M., Ender, M., Adhikari, R., Smith, J.M., Berger-Bachi, B., and Cook, G.M.
(2007) Fitness cost of staphylococcal cassette chromosome mec in methicillin-resistant
Staphylococcus aureus by way of continuous culture. Antimicrob Agents Chemother 51:
1497-1499.
95. Leonard, F.C., and Markey, B.K. (2008) Meticillin-resistant Staphylococcus aureus in
animals: a review. Vet J 175: 27-36.
96. Levy, S.B., and Marshall, B. (2004) Antibacterial resistance worldwide: causes,
challenges and responses. Nat Med 10: S122-129.
56
97. Lewis, D.L., Gattie, D.K., Novak, M.E., Sanchez, S., and Pumphrey, C. (2002)
Interactions of pathogens and irritant chemicals in land-applied sewage sludges (biosolids).
New Solut 12: 409-423.
98. Lewis, H.C., Molbak, K., Reese, C., Aarestrup, F.M., Selchau, M., Sorum, M., and Skov,
R.L. (2008) Pigs as source of methicillin-resistant Staphylococcus aureus CC398 infections in
humans, Denmark. Emerg Infect Dis 14: 1383-1389.
99. Lindberg R, Jarnheimer PA, Olsen B, Johansson M, Tysklind M. (2004) Determination of
antibiotic substances in hospital sewage water using solid phase extraction and liquid
chromatography/mass spectrometry and group analogue internal standards. Chemosphere 57:
1479–1488.
100. Lindberg, R.H., Wennberg, P., Johansson, M.I., Tysklind, M., and Andersson, B.A.
(2005) Screening of human antibiotic substances and determination of weekly mass flows in
five sewage treatment plants in Sweden. Environ Sci Technol 39: 3421-3429.
101. Lindsay, J.A., and Holden, M.T. (2004) Staphylococcus aureus: superbug, super
genome? Trends Microbiol 12: 378-385.
102. Lowe, B., Avila, H.A., Bloom, F.R., Gleeson, M., and Kusser, W. (2003) Quantitation of
gene expression in neural precursors by reverse-transcription polymerase chain reaction using
self-quenched, fluorogenic primers. Anal Biochem 315: 95-105.
103. Lowy, F.D. (1998) Staphylococcus aureus infections. N Engl J Med 339: 520-532.
104. Lydmark, P., Lind, M., Sorensson, F., and Hermansson, M. (2006) Vertical distribution
of nitrifying populations in bacterial biofilms from a full-scale nitrifying trickling filter.
Environ Microbiol 8: 2036-2049.
105. Lydmark, P., Almstrand, R., Samuelsson, K., Mattsson, A., Sorensson, F., Lindgren,
P.E., and Hermansson, M. (2007) Effects of environmental conditions on the nitrifying
population dynamics in a pilot wastewater treatment plant. Environ Microbiol 9: 2220-2233.
106. Löffler, D., and Ternes, T.A. (2003) Analytical method for the determination of the
aminoglycoside gentamicin in hospital wastewater via liquid chromatography-electrospraytandem mass spectrometry. J Chromatogr A 1000: 583-588.
107. Madigan, T.M., and Martinko, M.J. (2006) Brock Biology of Microorganisms. 11th
Edition, Pearson Precentice Hall.
108. Malik, A., Celik, E.K., Bohn, C., Bockelmann, U., Knobel, K., and Grohmann, E. (2008)
Detection of conjugative plasmids and antibiotic resistance genes in anthropogenic soils from
Germany and India. FEMS Microbiol Lett 279: 207-216.
109. Mallorqui-Fernandez, G., Marrero, A., Garcia-Pique, S., Garcia-Castellanos, R., and
Gomis-Ruth, F.X. (2004) Staphylococcal methicillin resistance: fine focus on folds and
functions. FEMS Microbiol Lett 235: 1-8.
110. Maree, C.L., Daum, R.S., Boyle-Vavra, S., Matayoshi, K., and Miller, L.G. (2007)
Community-associated methicillin resistant Staphylococcus aureus isolates causing
healthcare-associated infections. Emerg Infect Dis 13: 236-242.
111. Martins da Costa, P., Vaz-Pires, P., and Bernardo, F. (2006) Antimicrobial resistance in
Enterococcus spp. isolated in inflow, effluent and sludge from municipal sewage water
treatment plants. Water Res 40: 1735-1740.
112. McKeegan, K.S., Borges-Walmsley, M.I., and Walmsley, A.R. (2002) Microbial and
viral drug resistance mechanisms. Trends Microbiol 10: S8-S14.
113. McDougal, LK., Steward, CD., Killgore, GE. et al. (2003) Pulse field gel electrophoresis
typing of oxacillin-resistant Staphylococcus aureus isolates from the United States:
establishing a national database. J Clin Microbiol 41: 5113-5120.
114. Mesa, R.J., Blanc, V., Blanch, A.R., Cortes, P., Gonzalez, J.J., Lavilla, S. et al. (2006)
Extended-spectrum beta-lactamase-producing Enterobacteriaceae in different environments
(humans, food, animal farms and sewage). J Antimicrob Chemother 58: 211-215.
57
115. Miranda, C.D., Kehrenberg, C., Ulep, C., Schwarz, S., and Roberts, M.C. (2003)
Diversity of tetracycline resistance genes in bacteria from Chilean salmon farms. Antimicrob
Agents Chemother 47: 883-888.
116. Moore, D.F., Guzman, J.A., and McGee, C. (2008) Species distribution and
antimicrobial resistance of enterococci isolated from surface and ocean water. J Appl
Microbiol 105: 1017-1025.
117. Nazarenko, I., Pires, R., Lowe, B., Obaidy, M., and Rashtchian, A. (2002) Effect of
primary and secondary structure of oligodeoxyribonucleotides on the fluorescent properties of
conjugated dyes. Nucleic Acids Res 30: 2089-2195.
118. Nazarenko, I., Lowe, B., Darfler, M., Ikonomi, P., Schuster, D., and Rashtchian, A.
(2002) Multiplex quantitative PCR using self-quenched primers labeled with a single
fluorophore. Nucleic Acids Res 30: e37.
119. Neu, H.C. (1992) The crisis in antibiotic resistance. Science 257: 1064-1073.
120. Nikolakopoulou, T.L., Giannoutsou, E.P., Karabatsou, A.A., and Karagouni, A.D. (2008)
Prevalence of tetracycline resistance genes in Greek seawater habitats. J Microbiol 46: 633640.
121. Nordgren, J., Matussek, A., Mattsson, A., Svensson, L., and Lindgren, P.E. (2009)
Prevalence of norovirus and factors influencing virus concentrations during one-year in a fullscale wastewater treatment plant. Water Res In press.
122. Ohlsen, K., Ternes, T., Werner, G., Wallner, U., Loffler, D., Ziebuhr, W. et al. (2003)
Impact of antibiotics on conjugational resistance gene transfer in Staphylococcus aureus in
sewage. Environ Microbiol 5: 711-716.
123. Ogston, A. (1882) Micrococcus poisoning. J Anat Physiol 17: 24-58
124. Patterson, A.J., Colangeli, R., Spigaglia, P., and Scott, K.P. (2007) Distribution of
specific tetracycline and erythromycin resistance genes in environmental samples assessed by
macroarray detection. Environ Microbiol 9: 703-715.
125. Payment, P., Plante, R., and Cejka, P. (2001) Removal of indicator bacteria, human
enteric viruses, Giardia cysts, and Cryptosporidium oocysts at a large wastewater primary
treatment facility. Can J Microbiol 47: 188-193.
126. Peacock, S.J., de Silva, I., and Lowy, F.D. (2001) What determines nasal carriage of
Staphylococcus aureus? Trends Microbiol 9: 605-610.
127. Peak, N., Knapp, C.W., Yang, R.K., Hanfelt, M.M., Smith, M.S., Aga, D.S., and
Graham, D.W. (2007) Abundance of six tetracycline resistance genes in wastewater lagoons
at cattle feedlots with different antibiotic use strategies. Environ Microbiol 9: 143-151.
128. Pei, R., Kim, S.C., Carlson, K.H., and Pruden, A. (2006) Effect of river landscape on the
sediment concentrations of antibiotics and corresponding antibiotic resistance genes (ARG).
Water Res 40: 2427-2435.
129. Powledge, T.M. (2004) The polymerase chain reaction. Adv Physiol Educ 28: 44-50.
130. Prado, T., Pereira, W.C., Silva, D.M., Seki, L.M., Carvalho, A.P., and Asensi, M.D.
(2008) Detection of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in
effluents and sludge of a hospital sewage treatment plant. Lett Appl Microbiol 46: 136-141.
131. Reinthaler, F.F., Posch, J., Feierl, G., Wust, G., Haas, D., Ruckenbauer, G. et al. (2003)
Antibiotic resistance of E. coli in sewage and sludge. Water Res 37: 1685-1690.
132. Rich, M. (2005) Staphylococci in animals: prevalence, identification and antimicrobial
susceptibility, with an emphasis on methicillin-resistant Staphylococcus aureus. Br J Biomed
Sci 62: 98-105.
133. Riesenfeld, C.S., Goodman, R.M., and Handelsman, J. (2004) Uncultured soil bacteria
are a reservoir of new antibiotic resistance genes. Environ Microbiol 6: 981-989.
134. Roberts, M.C. (2003) Tetracycline therapy: update. Clin Infect Dis 36: 462-467.
58
135. Roberts, M.C. (2005) Update on acquired tetracycline resistance genes. FEMS Microbiol
Lett 245: 195-203.
136. Roberts, S., and Chambers, S. (2005) Diagnosis and management of Staphylococcus
aureus infections of the skin and soft tissue. Intern Med J 35 Suppl 2: S97-105
137. Robinson, D.A., and Enright, M.C. (2004) Multilocus sequence typing and the evolution
of methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect 10: 92-97.
138. Robinsson, P. (2005) Miljörapport enligt miljöbalken Gryaab 2004. Gryaab rapport
2005:2. Gryaab, Göteborg, Sweden
139. Rhodes, G., Huys, G., Swings, J., McGann, P., Hiney, M., Smith, P., and Pickup, R.W.
(2000) Distribution of oxytetracycline resistance plasmids between aeromonads in hospital
and aquaculture environments: implication of Tn1721 in dissemination of the tetracycline
resistance determinant tet A. Appl Environ Microbiol 66: 3883-3890.
140. Rooklidge, S.J. (2004) Environmental antimicrobial contamination from
terraccumulation and diffuse pollution pathways. Sci Total Environ 325: 1-13.
141. Sahlstrom, L., Aspan, A., Bagge, E., Danielsson-Tham, M.L., and Albihn, A. (2004)
Bacterial pathogen incidences in sludge from Swedish sewage treatment plants. Water Res 38:
1989-1994.
142. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T. et al. (1988)
Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.
Science 239: 487-491.
143. Sakwinska, O., Kuhn, G., Balmelli, C., Francioli, P., Giddey, M., Perreten, V. et al.
(2009) Genetic diversity and ecological success of Staphylococcus aureus strains colonizing
humans. Appl Environ Microbiol 75: 175-183.
144. Savichtcheva, O., Okayama, N., and Okabe, S. (2007) Relationships between
Bacteroides 16S rRNA genetic markers and presence of bacterial enteric pathogens and
conventional fecal indicators. Water Res 41: 3615-3628.
145. Schwartz, T., Kohnen, W., Jansen, B., and Obst, U. (2003) Detection of antibioticresistant bacteria and their resistance genes in wastewater, surface water, and drinking water
biofilms. FEMS Microbiology Ecology 43: 325-335.
146. Shannon, K.E., Lee, D.Y., Trevors, J.T., and Beaudette, L.A. (2007) Application of realtime quantitative PCR for the detection of selected bacterial pathogens during municipal
wastewater treatment. Sci Total Environ 382: 121-129.
147. Silva, J., Castillo, G., Callejas, L., Lo´pez, H., and Olmos, J. (2006) Frequency of
transferable multiple antibiotic resistance amongst coliform bacteria isolated from a treated
sewage effluent in Antofagasta, Chile. Electron. J. Biotechnol. 9: 533-540.
148. Skov, R., Gudlaugsson, O., Hardardottir, H., Harthug, S., Jakobsen, T., Kolmos, H.J. et
al. (2008) Proposal for common Nordic epidemiological terms and definitions for methicillinresistant Staphylococcus aureus (MRSA). Scand J Infect Dis 40: 495-502.
149. Smith, M.S., Yang, R.K., Knapp, C.W., Niu, Y., Peak, N., Hanfelt, M.M. et al. (2004)
Quantification of tetracycline resistance genes in feedlot lagoons by real-time PCR. Appl
Environ Microbiol 70: 7372-7377.
150. Srinivasan, V., Nam, H.M., Sawant, A.A., Headrick, S.I., Nguyen, L.T., and Oliver, S.P.
(2008) Distribution of tetracycline and streptomycin resistance genes and class 1 integrons in
Enterobacteriaceae isolated from dairy and nondairy farm soils. Microb Ecol 55: 184-193.
151. Stine, O.C., Johnson, J.A., Keefer-Norris, A., Perry, K.L., Tigno, J., Qaiyumi, S. et al.
(2007) Widespread distribution of tetracycline resistance genes in a confined animal feeding
facility. Int J Antimicrob Agents 29: 348-352.
152. Styers, D., Sheehan, D.J., Hogan, P., and Sahm, D.F. (2006) Laboratory-based
surveillance of current antimicrobial resistance patterns and trends among Staphylococcus
aureus: 2005 status in the United States. Ann Clin Microbiol Antimicrob 5: 2.
59
153. Sundsfjord, A., Simonsen, G.S., Haldorsen, B.C., Haaheim, H., Hjelmevoll, S.O.,
Littauer, P., and Dahl, K.H. (2004) Genetic methods for detection of antimicrobial resistance.
Apmis 112: 815-837.
154. The Swedish Water and Wastewater Association, (2000) Facts on Water supply and
sanitation in Sweden, Karléns Tryck AB
155. SWEDRES 2007. A Report on Swedish Antibiotic Utilisation and Resistance in Human
Medicine. The Swedish Strategic Programme for the Rational Use of Antimicrobial Agents
(STRAMA)/The Swedish Institute for Infectious Disease Control (SMI), Stockholm, Sweden
156. Tejedor Junco, M.T., Gonzalez Martin, M., Pita Toledo, M.L., Lupiola Gomez, P., and
Martin Barrasa, J.L. (2001) Identification and antibiotic resistance of faecal enterococci
isolated from water samples. Int J Hyg Environ Health 203: 363-368.
157. Tennstedt, T., Szczepanowski, R., Braun, S., Puhler, A., and Schluter, A. (2003)
Occurrence of integron-associated resistance gene cassettes located on a antibiotic resistance
plasmids isolated from a wastewater treatment plant. FEMS Microbiol Ecol 45: 239-252.
158. Tong, L., Li, P., Wang, Y., and Zhu, K. (2009) Analysis of veterinary antibiotic residues
in swine wastewater and environmental water samples using optimized SPE-LC/MS/MS.
Chemosphere 74: 1090-1097.
159. Turner, K.M., and Feil, E.J. (2007) The secret life of the multilocus sequence type. Int J
Antimicrob Agents 29: 129-135.
160. Valasek, M.A., and Repa, J.J. (2005) The power of real-time PCR. Adv Physiol Educ 29:
151-159.
161. van Belkum, A., Melles, D.C., Nouwen, J., van Leeuwen, W.B., van Wamel, W.,Vos,
M.C. et al. (2008) Co-evolutionary aspects of human colonisation and infection by
Staphylococcus aureus. Infect Genet Evol.
162. Vandenbergh, M.F., and Verbrugh, H.A. (1999) Carriage of Staphylococcus aureus:
epidemiology and clinical relevance. J Lab Clin Med 133: 525-534.
163. van Overbeek, L.S., Wellington, E.M.H., Egan, S., Smalla, K., Heur, H., Collard, J.-M.
et al. (2002) Prevalence of streptomycin-resistance genes in bacterial populations in European
habitats. FEMS Microbiol Ecol 42: 277-288.
164. Volkmann, H., Schwartz, T., Bischoff, P., Kirchen, S., and Obst, U. (2004) Detection of
clinically relevant antibiotic-resistance genes in municipal wastewater using real-time PCR
(TaqMan). J Microbiol Methods 56: 277-286.
165. Voyich, J.M., Otto, M., Mathema, B., Braughton, K.R., Whitney, A.R., Welty, D. et al.
(2006) Is Panton-Valentine Leukocidin the major virulence determinant in communityassociated methicillin-resistant Staphylococcus aureus Disease? JID 194: 1761-1770.
166. Wagner, M., Amann, R., Lemmer, H., and Schleifer, K.H. (1993) Probing activated
sludge with oligonucleotides specific for proteobacteria: inadequacy of culture-dependent
methods for describing microbial community structure. Appl Environ Microbiol 59: 15201525.
167. Wagner, M., and Loy, A. (2002) Bacterial community composition and function in
sewage treatment systems. Curr Opin Biotechnol 13: 218-227.
168. Wagner, M., Loy, A., Nogueira, R., Purkhold, U., Lee, N., and Daims, H. (2002)
Microbial community composition and function in wastewater treatment plants. Antonie Van
Leeuwenhoek 81: 665-680.
169. Walsh, C., and Wright, G. (2005) Introduction: antibiotic resistance. Chem Rev 105: 391394.
170. Walsh, F.M., and Amyes, S.G. (2004) Microbiology and drug resistance mechanisms of
fully resistant pathogens. Curr Opin Microbiol 7: 439-444.
171. Walsh, C. (2000) Molecular mechanisms that confer antibacterial drug resistance. Nature
406: 775-781.
60
172. Watkinson, A.J., Micalizzi, G.B., Graham, G.M., Bates, J.B., and Costanzo, S.D. (2007)
Antibiotic-resistant Escherichia coli in wastewaters, surface waters, and oysters from an urban
riverine system. Appl Environ Microbiol 73: 5667-5670.
173. Watkinson, A.J., Murby, E.J., and Costanzo, S.D. (2007) Removal of antibiotics in
conventional and advanced wastewater treatment: implications for environmental discharge
and wastewater recycling. Water Res 41: 4164-4176.
174. Watkinson, A.J., Murby, E.J., Kolpin, D.W., and Costanzo, S.D. (2009) The occurrence
of antibiotics in an urban watershed: From wastewater to drinking water. Sci Total Environ
407: 2711-2723
175. Wery, N., Lhoutellier, C., Ducray, F., Delgenes, J.P., and Godon, J.J. (2008) Behaviour
of pathogenic and indicator bacteria during urban wastewater treatment and sludge
composting, as revealed by quantitative PCR. Water Res 42: 53-62.
176. Wertheim, H.F., Melles, D.C., Vos, M.C., van Leeuwen, W., van Belkum, A., Verbrugh,
H.A., and Nouwen, J.L. (2005) The role of nasal carriage in Staphylococcus aureus infections.
Lancet Infect Dis 5: 751-762.
177. Widell, A. (2003) Avloppsrening i Sverige, The Swedish Environmental Protection
Agency,
178. Wise, R., Hart, T., Cars, O., Streulens, M., Helmuth, R., Huovinen, P., and Sprenger, M.
(1998) Antimicrobial resistance. Is a major threat to public health. Bmj 317: 609-610.
179. Wolffs, P., Norling, B., and Radstrom, P. (2005) Risk assessment of false-positive
quantitative real-time PCR results in food, due to detection of DNA originating from dead
cells. J Microbiol Methods 60: 315-323.
180. Wright, G.D. (2005) Bacterial resistance to antibiotics: enzymatic degradation and
modification. Adv Drug Deliv Rev 57: 1451-1470.
181. Xu, J., Gallert, C., and Winter, J. (2007) Multiple antibiotic resistances of Enterococcus
isolates from raw or sand-filtered sewage. Appl Microbiol Biotechnol 74: 493-500.
182. Zhang, K., and Farahbakhsh, K. (2007) Removal of native coliphages and coliform
bacteria from municipal wastewater by various wastewater treatment processes: implications
to water reuse. Water Res 41: 2816-2824.
183. Zwenger, S.R., and Gillock, E.T. (2009) Bacteria isolated from sewage influent resistant
to ciprofloxacin, chloramphenicol and tetracycline. J Environ Sci Health A Tox Hazard Subst
Environ Eng 44: 123-129.
61