Download Gene Section MIR125A (microRNA 125a) Atlas of Genetics and Cytogenetics

Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
MIR125A (microRNA 125a)
Serkan Tuna, Ayse Elif Erson
Department of Biology, Middle East Technical University, Ankara, Turkey (ST, AEE)
Published in Atlas Database: August 2008
Online updated version : http://AtlasGeneticsOncology.org/Genes/MIRN125AID44325ch19q13.html
DOI: 10.4267/2042/44513
This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence.
© 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Transcription
Identity
MicroRNA genes are generally transcribed by RNA
Pol II but can also be transcribed by RNA Pol III, if
located downstream of repetitive Alu elements, 5S
rRNA, tRNA and U6 snRNA genes. Transcription start
site is not known for this microRNA. miR-125a is
transcribed as a cluster with let-7e and miR-99b.
Pre-miRNA
MicroRNAs are first transcribed as primary
microRNAs (pri-miR) which then are processed by
RNase III enzyme Drosha and by dsRNA binding
protein DGCR8 to form the precursor microRNA (premiR). Through Exportin5
mediated transfer
mechanism, pre-miR is transferred to the cytoplasm. In
the cytoplasm, microRNAs are further processed by
Dicer, another RNase III enzyme, finally producing the
mature microRNA of around 20 nucleotides.
Pre-miR length: 86 bases
Sequence:
5'-UGCCAGUCUCUAGGUCCCUGAGACCCU
UUAACCUGUGAGGACAUCCAGGGUCACAGGU
GAGGUUCUUGGGAGCCUGGCGUCUGGCC-3'
Mature miR-125a
The miR-125a gene has two mature miRNAs in its
precursor structure: hsa-mir-125a-5p and hsa-mir-125a3p
hsa-mir-125a-5p is 24 nucleotides long.
15 - ucccugagacccuuuaaccuguga - 38
hsa-mir-125a-3p is 22 nucleotides long.
53 - acaggugagguucuugggagcc - 74
Other names: MIRN125A (microRNA 125a); hsamir-125a; miR-125a
HGNC (Hugo): MIR125A
Location: 19q13.33
Local order: Based on Mapviewer (Master Map:
Genes on sequence), genes flanking miR-125a oriented
from centromere to telomere on 19q13.33 are:
SIGLEC5 (19q13.3): Sialic acid binding Ig-like lectin
5; SIGLEC14 (19q13.4): Sialic acid binding Ig-like
lectin 14; miR-99B (19q13.33): microRNA 99b; miRLET7E (19q13.33): microRNA let-7e; miR-125a
(19q13.33): microRNA 125a; LOC147650 (19q13.33):
Hypothetical protein LOC147650; HAS1 (19q13.4):
Hyaluronan Synthase 1; FPR1 (19q13.4): Formyl
Peptide Receptor 1; FPRL1 (19q13.3-q13.4): Formyl
Peptide Receptor-like 1; FPRL2 (19q13.3-q13.4):
Formyl peptide receptor-like 2.
DNA/RNA
Stem-loop structure of miR-125a.
Description
Pseudogene
miR-125a gene is located in an intergenic region and it
is close to let-7e and miR-99B. The gene cluster
coordinates are:
miR-99B 19: 56887677-56887746 [+]
let-7e 19: 56887851-56887929 [+]
miR-125a 19: 56888319-56888404 [+]
No reported pseudogenes.
Atlas Genet Cytogenet Oncol Haematol. 2009; 13(7)
Protein
Note
miRNAs are not translated into amino acids.
485
MIR125A (microRNA 125a)
Tuna S, Erson AE
Implicated in
microRNAs were also downregulated. This finding
indicated that these microRNAs with similar sequences
might potentially target similar mRNAs.
Breast Cancer
Neuroblastoma
Note
miR-125a and its homolog miR-125b were identified to
be significantly downregulated in ERBB2-amplified
and overexpressing breast cancers. Ectopic expression
of miR-125a and miR-125b in the ERBB2 dependent
human breast cancer line, SKBR3, caused suppression
of its anchorage-dependent growth and inhibition of its
mobility and invasive capabilities. Ectopic expression
miR-125a and miR-125b in non-transformed and
ERBB2-independent MCF10a cells produced inhibitory
effects on its anchorage-dependent growth and no
significant impact on the mobility of these non-invasive
human breast epithelial cells. Furthermore, miR-125a
and miR-125b targets, ERBB2 and ERBB3, were
downregulated when these two microRNAs were
expressed in SKBR3 cells. Downregulation of ERBB2
and ERBB3 decreased the motility and invasiveness
features of SKBR3 cells.
Note
miR-125a and miR-125b transcription was elevated in
response to retinoic acid (RA) treatment in human
neuroblastoma cell line (SK-N-BE), confirmed by
Northern blot and qRT-PCR. Neurotrophin Receptor
Tropomyosin-Related Kinase C (NTRK3) is a key
regulator protein of the neuroblastoma cell
proliferation. Only the truncated form of NTRK3 was
found to be a target of both miR-125a and miR-125b.
Downregulation of tNTRK3 is critical for growth of
neuroblastoma cells. Ectopic expression of miR-125a
and miR-125b in primary neuroblastoma cells, (SK-NBE), resulted in the downregulation of tNTRK3.
Downregulation of these microRNAs in neuroblastoma
cells resulted in tumor formation whereas upregulation
of them resulted in in-vitro neuronal differentiation.
References
Prostate Cancer
Borchert GM, Lanier W, Davidson BL. RNA polymerase III
transcribes human microRNAs. Nat Struct Mol Biol. 2006
Dec;13(12):1097-101
Note
MicroRNA levels were examined by microarrays in 10
benign peripheral zone tissues and 16 prostate cancer
tissues. Widespread downregulation of miR-125b was
shown in prostate cancer tissues. These results were
also verified by qRT-PCR. Among 328 known and 152
novel human microRNAs, miR-125b was one of the
most downregulated microRNAs in prostate cancer.
Some bioinformatically predicted targets of miR-125b
were found to be upregulated in prostate cancer, shown
by microarray analysis (EIF4EBP1, RPL29,
MGC16063 and PAPB) and immunohistochemistry
(RAS, E2F3, BCL-2 and MCL-1). Increased expression
EIF4EBP1 was also confirmed through qRT-PCR, in
61 human prostate tumors and 19 normal tissues.
Several microRNA paralogous groups, having high
levels of sequence similarity, were also found to be
downregulated in prostate cancer. Along with miR125a, and miR-125b, other members of let-7 family
Atlas Genet Cytogenet Oncol Haematol. 2009; 13(7)
Laneve P, Di Marcotullio L, Gioia U, Fiori ME, Ferretti E, Gulino
A, Bozzoni I, Caffarelli E. The interplay between microRNAs
and the neurotrophin receptor tropomyosin-related kinase C
controls proliferation of human neuroblastoma cells. Proc Natl
Acad Sci U S A. 2007 May 8;104(19):7957-62
Scott GK, Goga A, Bhaumik D, Berger CE, Sullivan CS, Benz
CC. Coordinate suppression of ERBB2 and ERBB3 by
enforced expression of micro-RNA miR-125a or miR-125b. J
Biol Chem. 2007 Jan 12;282(2):1479-86
Ozen M, Creighton CJ, Ozdemir M, Ittmann M. Widespread
deregulation of microRNA expression in human prostate
cancer. Oncogene. 2008 Mar 13;27(12):1788-93
This article should be referenced as such:
Tuna S, Erson AE. MIR125A (microRNA 125a). Atlas Genet
Cytogenet Oncol Haematol. 2009; 13(7):485-486.
486