Download Gene Section MIR125B1 (microRNA 125b-1) Atlas of Genetics and Cytogenetics

Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
MIR125B1 (microRNA 125b-1)
Serkan Tuna, Ayse Elif Erson
Department of Biology, Middle East Technical University, Ankara, Turkey (ST, AEE)
Published in Atlas Database: August 2008
Online updated version : http://AtlasGeneticsOncology.org/Genes/MIRN125B1ID44326ch11q24.html
DOI: 10.4267/2042/44514
This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence.
© 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology
5'-UGCGCUCCUCUCAGUCCCUGAGACCCU
AACUUGUGAUGUUUACCGUUUAAAUCCACGG
GUUAGGCUCUUGGGAGCUGCGAGUCGUGCU-3'
Mature miR-125b
Mature miR-125b can originate from two precursor
structures: pre-miR-125b1 and pre - miR-125b2. The
mature microRNA resides between the 15th and 36th
nucleotides of precursor miR-125b1. Mature miR-125b
is 22 nucleotides long.
Sequence:
miR-125b (from miR-125B1):
15 - ucccugagacccuaacuuguga - 36
Identity
Other names: MIRN125B1 (microRNA 125b-1);
MIR125B1; hsa-mir-125b-1
HGNC (Hugo): MIR125B1
Location: 11q24.1
Local order: Based on Mapviewer (Master Map:
Genes on sequence), genes flanking miR-125b1
oriented from centromere to telomere on 11q24.1 are:
SC5DL (11q23.3): Sterol-C5-Desaturase (ERG3 delta5-desaturase homolog, S.cerevisiae)-like; LOC283155
(11q24.1): Hypothetical LOC283155; LOC645470
(11q24.1): Similar to programmed cell death 2 isoform
1; SORL1 (11q23.2-q24.2): Sortilin-Related Receptor,
L(DLR class); miR-125b1 (11q24.1): microRNA 125b1; BLID (11q24.1): BH3-like motif containing, cell
death inducer; Let-7a2 (11q24.1): microRNA let-7a-2;
miR-100 (11q24.1): microRNA 100.
Pseudogene
No reported pseudogenes.
Protein
Note
miRNAs are not translated into amino acids.
DNA/RNA
Implicated in
Breast Cancer
Note
Among differentially expressed microRNAs in cancers,
miR-125b is one of the most consistently deregulated
microRNAs in breast cancer. Downregulation of miR125b suggested that it may potentially act as a tumor
suppressor gene. Microarray analysis of 10 normal and
76 neoplastic breast tissues showed downregulation of
miR-125 in breast tumors. Although the miR-125b
levels in MDA-MB-231 breast cancer cells were
comparable
to normal breast tissue, in MCF-7, T47D, SK-BR3,
BT20 and MDA-MB-175 breast cancer cells showed
downregulation of miR-125b. Both microarray analysis
and Northern blotting demonstrated low levels of miR125b transcript in breast cancer cell lines and tumors.
Stem-loop structure of miR-125b1.
Description
The gene is located in an intergenic region.
Transcription
Transcription start site is not known for this
microRNA.
Pre-miRNA
Pre-miR Length: 88 bases
Sequence:
Atlas Genet Cytogenet Oncol Haematol. 2009; 13(7)
487
MIR125B1 (microRNA 125b-1)
Tuna S, Erson AE
In another study, miR-125b along with its homolog;
miR-125a were identified to be significantly
downregulated
in
ERBB2-amplified
and
overexpressing breast cancers. Ectopic expression of
miR-125a and miR-125b in the ERBB2 dependent
human breast cancer line, SKBR3, caused suppression
of its anchorage-dependent growth and inhibition of its
mobility and invasive capabilities. Ectopic expression
miR-125a and miR-125b in non- transformed and
ERBB2-independent MCF10a cells produced inhibitory
effects on its anchorage-dependent growth and no
significant impact on the mobility of these non-invasive
human breast epithelial cells. Furthermore, miR-125a
and miR-125b targets, ERBB2 and ERBB3, were
downregulated when these two microRNAs were
expressed in SKBR3 cells. Downregulation of ERBB2
and ERBB3 decreased the motility and invasiveness
features of SKBR3 cells.
Ovarian Cancer
Note
Through microarray analysis, several microRNAs were
found to be deregulated in human ovarian cancer.
Among several microRNAs, miR-214, miR-199a and
miR-200a were found to be upregulated whereas MIR100, let-7 family members and miR-125b were the
most significantly downregulated microRNAs in
ovarian cancer. Downregulation of miR-125b was
further confirmed by Northern blotting. 5.5 fold
downregulation of miR-125b in primary ovarian tumor
compared to normal ovary was shown.
Neuroblastoma
Note
miR-125a and miR-125b transcription was elevated in
response to retinoic acid (RA) treatment in human
neuroblastoma cell line (SK-N-BE), confirmed by
Northern blot and qRT-PCR. Neurotrophin Receptor
Tropomyosin-Related Kinase C (NTRK3) is a key
regulator protein of the neuroblastoma cell
proliferation. Only the truncated form of NTRK3 was
found to be a target of both miR-125a and miR-125b.
Downregulation of tNTRK3 is critical for growth of
neuroblastoma cells. Ectopic expression of miR-125a
and miR-125b in primary neuroblastoma cells, (SK-NBE), resulted in the downregulation of tNTRK3.
Downregulation of these microRNAs in neuroblastoma
cells resulted in tumor formation whereas upregulation
of them resulted in in-vitro neuronal differentiation.
Prostate Cancer
Note
MicroRNA levels were examined by microarrays in 10
benign peripheral zone tissues and 16 prostate cancer
tissues. Widespread downregulation of miR-125b was
shown in prostate cancer tissues. These results were
also verified by qRT-PCR. Among 328 known and 152
novel human microRNAs, miR-125b was one of the
most downregulated microRNAs in prostate cancer.
Some bioinformatically predicted targets of miR-125b
were found to be upregulated in prostate cancer, shown
by microarray analysis (EIF4EBP1, RPL29,
MGC16063 and PAPB) and immunohistochemistry
(RAS, E2F3, BCL-2 and MCL-1). Increased expression
EIF4EBP1 was also confirmed through qRT-PCR, in
61 human prostate tumors and 19 normal tissues.
Several microRNA paralogous groups, having high
levels of sequence similarity, were also found to be
downregulated in prostate cancer. Along with miR125a, and miR-125b, other members of let-7 family
microRNAs were also downregulated. This finding
indicated that these microRNAs with similar sequences
might potentially target similar mRNAs.
Interestingly in another study, according to Northern
blot analysis in 9 prostatic cell lines, miR-125b was
found to be upregulated. 5 fold increase was found in 2
androgen positive prostate cell lines (AI cds1 and AI
cds2) compared to androgen negative prostate cell line
(AD LN CaP). Moreover, TATA box and Androgen
Responsive Elements (AREs) were found in the 5' of
the miR-125b gene. Upregulation of miR-125b was
also confirmed in response to androgen. Finally, one
target of miR-125b, BAK1 (BCL2-antagonist/killer1)
was confirmed initially by microarrays and then by
luciferase assays. Thus, upregulation of miR-125b in
response to androgen resulted with decreased levels of
BAK1, an apoptotic protein.
Atlas Genet Cytogenet Oncol Haematol. 2009; 13(7)
Squamous Cell Carcinoma
Note
Expression levels of 156 human mature microRNAs
were analyzed by using real-time quantitative PCR in
20 paired tongue squamous cell carcinoma (SCC) and
normal tissues. Apart from the upregulated microRNAs
in SCC, miR-125b was one of the downregulated
microRNAs. It was found that miR-125b was
downregulated 4.7 fold in SCC compared to normal
tissue.
Other cancers/Immune System
Note
Deregulation of miR-125b2 in differentiated cancer
cells was shown by primer extension assays through
comparison of transcript levels. Depletion of miR125b2 by siRNA in PC-3 (prostate cancer) and HeLa
cells (cervical cancer) inhibited cell proliferation.
Further, upregulation of miR-125b was shown in
response to retinoic acid treatment during
differentiation of cells in culture. Thus, it was
concluded that miR-125b was essential for proliferation
of differentiated cells.
miR-125b was also reported to have a role in innate
immunity. Downregulation of miR-125b was observed
488
MIR125B1 (microRNA 125b-1)
Tuna S, Erson AE
in response to lipopolysaccharide (LPS), an endotoxin,
stimulation in mouse Raw 264.7 macrophages.
Moreover, miR-125b level oscillated in response to
TNF-alpha. miR-125b was shown to target 3' UTR of
TNF-alpha, thus interfered with the cellular levels of
TNF-alpha. Downregulation of miR-125b in response
to LPS was required to increase the cellular levels of
TNF-alpha.
Laneve P, Di Marcotullio L, Gioia U, Fiori ME, Ferretti E, Gulino
A, Bozzoni I, Caffarelli E. The interplay between microRNAs
and the neurotrophin receptor tropomyosin-related kinase C
controls proliferation of human neuroblastoma cells. Proc Natl
Acad Sci U S A. 2007 May 8;104(19):7957-62
Osteoblastic Differentiation
Shi XB, Xue L, Yang J, Ma AH, Zhao J, Xu M, Tepper CG,
Evans CP, Kung HJ, deVere White RW. An androgenregulated miRNA suppresses Bak1 expression and induces
androgen-independent growth of prostate cancer cells. Proc
Natl Acad Sci U S A. 2007 Dec 11;104(50):19983-8
Scott GK, Goga A, Bhaumik D, Berger CE, Sullivan CS, Benz
CC. Coordinate suppression of ERBB2 and ERBB3 by
enforced expression of micro-RNA miR-125a or miR-125b. J
Biol Chem. 2007 Jan 12;282(2):1479-86
Note
According to microRNA microarray analysis, miR125b expression level was found to be weakly
downregulated in mouse mesenchymal stem cells. This
finding indicated that miR-125b could have a role in
osteoblastic differentiation. Expression level of miR125b was found to be time dependent in ST2 cells
(mesenchymal stem cell). Ectopic expression of miR125b inhibited the proliferation of ST2 cells during
differentiation and thus, inhibited the osteoblastic cell
differentiation. On the other hand, silencing of miR125b promoted osteoblastic differentiation.
Tili E, Michaille JJ, Cimino A, Costinean S, Dumitru CD, Adair
B, Fabbri M, Alder H, Liu CG, Calin GA, Croce CM. Modulation
of
miR-155
and
miR-125b
levels
following
lipopolysaccharide/TNF-alpha stimulation and their possible
roles in regulating the response to endotoxin shock. J
Immunol. 2007 Oct 15;179(8):5082-9
Mizuno Y, Yagi K, Tokuzawa Y, Kanesaki-Yatsuka Y, Suda T,
Katagiri T, Fukuda T, Maruyama M, Okuda A, Amemiya T,
Kondoh Y, Tashiro H, Okazaki Y. miR-125b inhibits
osteoblastic differentiation by down-regulation of cell
proliferation. Biochem Biophys Res Commun. 2008 Apr
4;368(2):267-72
References
Ozen M, Creighton CJ, Ozdemir M, Ittmann M. Widespread
deregulation of microRNA expression in human prostate
cancer. Oncogene. 2008 Mar 13;27(12):1788-93
Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni
S, Magri E, Pedriali M, Fabbri M, Campiglio M, Ménard S,
Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin
GA, Querzoli P, Negrini M, Croce CM. MicroRNA gene
expression deregulation in human breast cancer. Cancer Res.
2005 Aug 15;65(16):7065-70
Wong TS, Liu XB, Wong BY, Ng RW, Yuen AP, Wei WI.
Mature miR-184 as Potential Oncogenic microRNA of
Squamous Cell Carcinoma of Tongue. Clin Cancer Res. 2008
May 1;14(9):2588-92
Lee YS, Kim HK, Chung S, Kim KS, Dutta A. Depletion of
human micro-RNA miR-125b reveals that it is critical for the
proliferation of differentiated cells but not for the downregulation of putative targets during differentiation. J Biol
Chem. 2005 Apr 29;280(17):16635-41
Yang H, Kong W, He L, Zhao JJ, O'Donnell JD, Wang J,
Wenham RM, Coppola D, Kruk PA, Nicosia SV, Cheng JQ.
MicroRNA expression profiling in human ovarian cancer: miR214 induces cell survival and cisplatin resistance by targeting
PTEN. Cancer Res. 2008 Jan 15;68(2):425-33
Borchert GM, Lanier W, Davidson BL. RNA polymerase III
transcribes human microRNAs. Nat Struct Mol Biol. 2006
Dec;13(12):1097-101
This article should be referenced as such:
Atlas Genet Cytogenet Oncol Haematol. 2009; 13(7)
Tuna S, Erson AE. MIR125B1 (microRNA 125b-1). Atlas Genet
Cytogenet Oncol Haematol. 2009; 13(7):487-489.
489