Download Gene Section MIR183 (microRNA 183) Atlas of Genetics and Cytogenetics

Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Short Communication
MIR183 (microRNA 183)
Juanjuan Zhu, Xiaofei Zheng
Beijing Institute of Radiation Medicine, Beijing 100850, PR China (JZ, XZ)
Published in Atlas Database: November 2011
Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR183ID50539ch7q32.html
DOI: 10.4267/2042/47300
This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence.
© 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
- has-mir-96 7: 129414532-129414609 [-]
- has-mir-182 7: 129410223-129410332 [-].
Other names: MIRN183, miR-183, miRNA183
HGNC (Hugo): MIR183
Location: 7q32.2
Local order: Based on Mapviewer (Master Map:
Genes on sequence), genes flanking miR-183 oriented
from centromere to telomere on 7q32.2 are:
- MIR182 (7q32.2): microRNA 182
- MIRN183 (7q32.2): microRNA 183
- MIRN96 (7q32.2): microRNA 96
- UBE2H (7q32.2): ubiquitin-conjugating enzyme E2H
- ZC3HC1 (7q32.2): zinc finger, C3HC-type containing
1.
Transcription
In general, the microRNA genes are transcribed by
RNA polymerase II, whereas RNA polymerase III is
also responsible for transcription of some other
microRNAs.
Pre-microRNA 183 (precursor microRNA)
- Accession: MI0000273.
- Length: 110 bp.
- Sequence:
5'CCGCAGAGUGUGACUCCUGUUCUGUGUAUGG
CACUGGUAGAAUUCACUGUGAACAG
UCUCAGUCAGUGAAUUACCGAAGGGCCAUAA
ACAGAGCAGAGACAGAUC CACGA-3'.
DNA/RNA
Description
Mature miR-183
- Accession: MIMAT0000261.
- Length: 22 nucleotides.
- Sequence: 27-uauggcacugguagaauucacu-48.
miR-183 is located in an intergenic region. miR-182,
miR-183 and miR-96 are clustered genes, containing
identical seed sequences and both map to the 7
chromosome. The positions of these cluster
microRNAs are:
Pseudogene
No pseudogenes were reported for mir-183 and 182.
- hsa-mir-183 7: 129414745-129414854 [-]
Figure1. A. Stem-loop structure of miR-183.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(4)
275
MIR183 (microRNA 183)
Zhu J, Zheng X
Figure 1. B. Genomic localization of miR-183 (MIRN183), miR-96 (MIRN96) and miR-182 (MIRN182) on chromosomal band 7q32.2
(modified from Ensembl).
oncogenic role through the regulation of 2 tumor
suppressor genes, EGR1 and PTEN, and the
deregulation of this fundamental miRNA regulatory
network may be significant to many tumor types.
Protein
Note
MicroRNAs are not translated into amino acids.
Breast cancer
Implicated in
Note
In breast cancer, miR183 is dysregulated. Its expression
correlates with estrogen receptor and HER2/neu
receptor expression. Overexpression of miR183 would
inhibit migration of breast cancer cells. Specifically,
the VIL2-coding protein ezrin was confirmed as a
target of miR183 and downregulation of this protein
was
confirmed
by
immunocytochemistry.
Consequently, miRNA183 may present an attractive
target for therapeutic intervention in breast tumor.
Various cancers
Oncogenesis
The transcription factor EGR1 is a tumor suppressor
gene that is downregulated in many types of cancer.
Clinically, loss the function of EGR1 translates to
increased tumor transformation and subsequent patient
morbidity and mortality. In synovial sarcoma, the
SS18-SSX fusion protein represses EGR1 expression
through a direct association with the EGR1 promoter.
However, the mechanism through which EGR1
becomes downregulated in other tumor types is unclear.
Researcher reported that EGR1 is regulated by miR183 in multiple tumor types including synovial
sarcoma, rhabdomyosarcoma (RMS), and colon cancer.
Using an integrative network analysis, researchers
identified that miR-183 is significantly overexpressed
in these tumor types as well as in corresponding tumor
cell lines. Bioinformatic analyses implied that miR-183
could target EGR1 mRNA and this specific interaction
was validated in vitro. miR-183 knockdown in synovial
sarcoma, RMS, and colon cancer cell lines revealed
deregulation of a miRNA network composed of miR183-EGR1-PTEN in these tumors. Integrated miRNAand mRNA-based genomic analyses indicated that
miR-183 is an important contributor to cell migration in
these tumor types and this result was functionally
validated to be occurring via an EGR1-based
mechanism. In conclusion, these findings have
significant implications in the mechanisms underlying
EGR1 regulation in cancers. miR-183 has a potential
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(4)
Lung cancer
Note
Lung cancer is the leading cause of cancer death. In the
present study, researchers have addressed the
significant role of miRNA in mediating tumor
metastasis, through a screen with miRNA array,
researchers found that miR183 was reversely correlated
with the metastatic potential of lung cancer cells. In
addition, ectopic overexpression of miR183 in highly
metastatic cells could inhibit cell migration and
invasion. Consistent with its cellular function, miR183
regulated the expression of many migration and
invasion-related genes, including ezrin, which has a
role in controlling actin cytoskeleton, cell adhesion and
motility.
Hepatocellular carcinoma (HCC)
Note
miR-183 can inhibit apoptosis in human HCC cells by
repressing the PDCD4 expression, and miR-183 may
play an important role in HCC development.
276
MIR183 (microRNA 183)
Zhu J, Zheng X
Yin Y, Li M, Li H, Jiang Y, Cao LY, Zhang HF, Xu XC.
[Expressions of 6 microRNAs in prostate cancer]. Zhonghua
Nan Ke Xue. 2010 Jul;16(7):599-605
Development
Note
MicroRNAs (miRNAs) constitute a class of small noncoding endogenous RNAs that downregulate gene
expression by mapping to 3' untranslated region (UTR)
of target messenger RNAs. They have been found to
regulate developmental and physiological processes in
several organs and tissues. Based on previous
background, researchers have performed systematic in
situ hybridizations to analyze the temporal and spatial
distribution of three miRNAs (miR-96, miR-182 and
miR-183) that are likely to arise from a single precursor
RNA during the development and the maturation of the
cochlea. Strikingly, the expression of miR-96, miR-182
and miR-183 was highly dynamic during the
development of the cochlea, from the patterning to the
differentiation of the main cochlear structures.
Gundara JS, Robinson BG, Sidhu SB. Evolution of the
"autophagamiR" Autophagy. 2011 Dec 1;7(12)
Jalvy-Delvaille S, Maurel M, Majo V, Pierre N, Chabas S,
Combe C, Rosenbaum J, Sagliocco F, Grosset CF. Molecular
basis of differential target regulation by miR-96 and miR-182:
the Glypican-3 as a model. Nucleic Acids Res. 2011 Oct 18;
Lin Q, Mao W, Shu Y, Lin F, Liu S, Shen H, Gao W, Li S, Shen
D. A cluster of specified microRNAs in peripheral blood as
biomarkers for metastatic non-small-cell lung cancer by stemloop RT-PCR. J Cancer Res Clin Oncol. 2012 Jan;138(1):8593
Mihelich BL, Khramtsova EA, Arva N, Vaishnav A, Johnson
DN, Giangreco AA, Martens-Uzunova E, Bagasra O, KajdacsyBalla A, Nonn L. miR-183-96-182 Cluster Is Overexpressed in
Prostate Tissue and Regulates Zinc Homeostasis in Prostate
Cells. J Biol Chem. 2011 Dec 30;286(52):44503-11
Park YG, Lee KH, Lee JK, Lee KT, Choi DW, Choi SH, Heo
JS, Jang KT, Lee EM, Kim JO, Min SY, Kim EJ. [MicroRNA
expression pattern in intraductal papillary mucinous neoplasm].
Korean J Gastroenterol. 2011 Oct 25;58(4):190-200
References
Mahdieh N, Rabbani B, Wiley S, Akbari MT, Zeinali S. Genetic
causes of nonsyndromic hearing loss in Iran in comparison
with other populations. J Hum Genet. 2010 Oct;55(10):639-48
Pottelberge GR, Mestdagh P, Bracke KR, Thas O, Durme YM,
Joos GF, Vandesompele J, Brusselle GG. MicroRNA
expression in induced sputum of smokers and patients with
chronic obstructive pulmonary disease. Am J Respir Crit Care
Med. 2011 Apr 1;183(7):898-906
Meerson A, Cacheaux L, Goosens KA, Sapolsky RM, Soreq H,
Kaufer D. Changes in brain MicroRNAs contribute to
cholinergic stress reactions. J Mol Neurosci. 2010 Jan;40(12):47-55
Zhu W, Liu X, He J, Chen D, Hunag Y, Zhang YK.
Overexpression of members of the microRNA-183 family is a
risk factor for lung cancer: a case control study. BMC Cancer.
2011 Sep 15;11:393
Myatt SS, Wang J, Monteiro LJ, Christian M, Ho KK, Fusi L,
Dina RE, Brosens JJ, Ghaem-Maghami S, Lam EW. Definition
of microRNAs that repress expression of the tumor suppressor
gene FOXO1 in endometrial cancer. Cancer Res. 2010 Jan
1;70(1):367-77
Zhu Q, Sun W, Okano K, Chen Y, Zhang N, Maeda T,
Palczewski K. Sponge transgenic mouse model reveals
important roles for the microRNA-183 (miR-183)/96/182 cluster
in postmitotic photoreceptors of the retina. J Biol Chem. 2011
Sep 9;286(36):31749-60
Sarver AL, Li L, Subramanian S. MicroRNA miR-183 functions
as an oncogene by targeting the transcription factor EGR1 and
promoting tumor cell migration. Cancer Res. 2010 Dec
1;70(23):9570-80
Stark TJ, Arnold JD, Spector DH, Yeo GW. High-resolution
profiling and analysis of viral and host small RNAs during
human cytomegalovirus infection. J Virol. 2012 Jan;86(1):22635
Saus E, Soria V, Escaramís G, Vivarelli F, Crespo JM,
Kagerbauer B, Menchón JM, Urretavizcaya M, Gratacòs M,
Estivill X. Genetic variants and abnormal processing of premiR-182, a circadian clock modulator, in major depression
patients with late insomnia. Hum Mol Genet. 2010 Oct
15;19(20):4017-25
This article should be referenced as such:
Zhu J, Zheng X. MIR183 (microRNA 183). Atlas Genet
Cytogenet Oncol Haematol. 2012; 16(4):275-277.
Schaefer A, Jung M, Mollenkopf HJ, Wagner I, Stephan C,
Jentzmik F, Miller K, Lein M, Kristiansen G, Jung K. Diagnostic
and prognostic implications of microRNA profiling in prostate
carcinoma. Int J Cancer. 2010 Mar 1;126(5):1166-76
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(4)
277