Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Short Communication MIR183 (microRNA 183) Juanjuan Zhu, Xiaofei Zheng Beijing Institute of Radiation Medicine, Beijing 100850, PR China (JZ, XZ) Published in Atlas Database: November 2011 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR183ID50539ch7q32.html DOI: 10.4267/2042/47300 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology Identity - has-mir-96 7: 129414532-129414609 [-] - has-mir-182 7: 129410223-129410332 [-]. Other names: MIRN183, miR-183, miRNA183 HGNC (Hugo): MIR183 Location: 7q32.2 Local order: Based on Mapviewer (Master Map: Genes on sequence), genes flanking miR-183 oriented from centromere to telomere on 7q32.2 are: - MIR182 (7q32.2): microRNA 182 - MIRN183 (7q32.2): microRNA 183 - MIRN96 (7q32.2): microRNA 96 - UBE2H (7q32.2): ubiquitin-conjugating enzyme E2H - ZC3HC1 (7q32.2): zinc finger, C3HC-type containing 1. Transcription In general, the microRNA genes are transcribed by RNA polymerase II, whereas RNA polymerase III is also responsible for transcription of some other microRNAs. Pre-microRNA 183 (precursor microRNA) - Accession: MI0000273. - Length: 110 bp. - Sequence: 5'CCGCAGAGUGUGACUCCUGUUCUGUGUAUGG CACUGGUAGAAUUCACUGUGAACAG UCUCAGUCAGUGAAUUACCGAAGGGCCAUAA ACAGAGCAGAGACAGAUC CACGA-3'. DNA/RNA Description Mature miR-183 - Accession: MIMAT0000261. - Length: 22 nucleotides. - Sequence: 27-uauggcacugguagaauucacu-48. miR-183 is located in an intergenic region. miR-182, miR-183 and miR-96 are clustered genes, containing identical seed sequences and both map to the 7 chromosome. The positions of these cluster microRNAs are: Pseudogene No pseudogenes were reported for mir-183 and 182. - hsa-mir-183 7: 129414745-129414854 [-] Figure1. A. Stem-loop structure of miR-183. Atlas Genet Cytogenet Oncol Haematol. 2012; 16(4) 275 MIR183 (microRNA 183) Zhu J, Zheng X Figure 1. B. Genomic localization of miR-183 (MIRN183), miR-96 (MIRN96) and miR-182 (MIRN182) on chromosomal band 7q32.2 (modified from Ensembl). oncogenic role through the regulation of 2 tumor suppressor genes, EGR1 and PTEN, and the deregulation of this fundamental miRNA regulatory network may be significant to many tumor types. Protein Note MicroRNAs are not translated into amino acids. Breast cancer Implicated in Note In breast cancer, miR183 is dysregulated. Its expression correlates with estrogen receptor and HER2/neu receptor expression. Overexpression of miR183 would inhibit migration of breast cancer cells. Specifically, the VIL2-coding protein ezrin was confirmed as a target of miR183 and downregulation of this protein was confirmed by immunocytochemistry. Consequently, miRNA183 may present an attractive target for therapeutic intervention in breast tumor. Various cancers Oncogenesis The transcription factor EGR1 is a tumor suppressor gene that is downregulated in many types of cancer. Clinically, loss the function of EGR1 translates to increased tumor transformation and subsequent patient morbidity and mortality. In synovial sarcoma, the SS18-SSX fusion protein represses EGR1 expression through a direct association with the EGR1 promoter. However, the mechanism through which EGR1 becomes downregulated in other tumor types is unclear. Researcher reported that EGR1 is regulated by miR183 in multiple tumor types including synovial sarcoma, rhabdomyosarcoma (RMS), and colon cancer. Using an integrative network analysis, researchers identified that miR-183 is significantly overexpressed in these tumor types as well as in corresponding tumor cell lines. Bioinformatic analyses implied that miR-183 could target EGR1 mRNA and this specific interaction was validated in vitro. miR-183 knockdown in synovial sarcoma, RMS, and colon cancer cell lines revealed deregulation of a miRNA network composed of miR183-EGR1-PTEN in these tumors. Integrated miRNAand mRNA-based genomic analyses indicated that miR-183 is an important contributor to cell migration in these tumor types and this result was functionally validated to be occurring via an EGR1-based mechanism. In conclusion, these findings have significant implications in the mechanisms underlying EGR1 regulation in cancers. miR-183 has a potential Atlas Genet Cytogenet Oncol Haematol. 2012; 16(4) Lung cancer Note Lung cancer is the leading cause of cancer death. In the present study, researchers have addressed the significant role of miRNA in mediating tumor metastasis, through a screen with miRNA array, researchers found that miR183 was reversely correlated with the metastatic potential of lung cancer cells. In addition, ectopic overexpression of miR183 in highly metastatic cells could inhibit cell migration and invasion. Consistent with its cellular function, miR183 regulated the expression of many migration and invasion-related genes, including ezrin, which has a role in controlling actin cytoskeleton, cell adhesion and motility. Hepatocellular carcinoma (HCC) Note miR-183 can inhibit apoptosis in human HCC cells by repressing the PDCD4 expression, and miR-183 may play an important role in HCC development. 276 MIR183 (microRNA 183) Zhu J, Zheng X Yin Y, Li M, Li H, Jiang Y, Cao LY, Zhang HF, Xu XC. [Expressions of 6 microRNAs in prostate cancer]. Zhonghua Nan Ke Xue. 2010 Jul;16(7):599-605 Development Note MicroRNAs (miRNAs) constitute a class of small noncoding endogenous RNAs that downregulate gene expression by mapping to 3' untranslated region (UTR) of target messenger RNAs. They have been found to regulate developmental and physiological processes in several organs and tissues. Based on previous background, researchers have performed systematic in situ hybridizations to analyze the temporal and spatial distribution of three miRNAs (miR-96, miR-182 and miR-183) that are likely to arise from a single precursor RNA during the development and the maturation of the cochlea. Strikingly, the expression of miR-96, miR-182 and miR-183 was highly dynamic during the development of the cochlea, from the patterning to the differentiation of the main cochlear structures. Gundara JS, Robinson BG, Sidhu SB. Evolution of the "autophagamiR" Autophagy. 2011 Dec 1;7(12) Jalvy-Delvaille S, Maurel M, Majo V, Pierre N, Chabas S, Combe C, Rosenbaum J, Sagliocco F, Grosset CF. Molecular basis of differential target regulation by miR-96 and miR-182: the Glypican-3 as a model. Nucleic Acids Res. 2011 Oct 18; Lin Q, Mao W, Shu Y, Lin F, Liu S, Shen H, Gao W, Li S, Shen D. A cluster of specified microRNAs in peripheral blood as biomarkers for metastatic non-small-cell lung cancer by stemloop RT-PCR. J Cancer Res Clin Oncol. 2012 Jan;138(1):8593 Mihelich BL, Khramtsova EA, Arva N, Vaishnav A, Johnson DN, Giangreco AA, Martens-Uzunova E, Bagasra O, KajdacsyBalla A, Nonn L. miR-183-96-182 Cluster Is Overexpressed in Prostate Tissue and Regulates Zinc Homeostasis in Prostate Cells. J Biol Chem. 2011 Dec 30;286(52):44503-11 Park YG, Lee KH, Lee JK, Lee KT, Choi DW, Choi SH, Heo JS, Jang KT, Lee EM, Kim JO, Min SY, Kim EJ. [MicroRNA expression pattern in intraductal papillary mucinous neoplasm]. Korean J Gastroenterol. 2011 Oct 25;58(4):190-200 References Mahdieh N, Rabbani B, Wiley S, Akbari MT, Zeinali S. Genetic causes of nonsyndromic hearing loss in Iran in comparison with other populations. J Hum Genet. 2010 Oct;55(10):639-48 Pottelberge GR, Mestdagh P, Bracke KR, Thas O, Durme YM, Joos GF, Vandesompele J, Brusselle GG. MicroRNA expression in induced sputum of smokers and patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2011 Apr 1;183(7):898-906 Meerson A, Cacheaux L, Goosens KA, Sapolsky RM, Soreq H, Kaufer D. Changes in brain MicroRNAs contribute to cholinergic stress reactions. J Mol Neurosci. 2010 Jan;40(12):47-55 Zhu W, Liu X, He J, Chen D, Hunag Y, Zhang YK. Overexpression of members of the microRNA-183 family is a risk factor for lung cancer: a case control study. BMC Cancer. 2011 Sep 15;11:393 Myatt SS, Wang J, Monteiro LJ, Christian M, Ho KK, Fusi L, Dina RE, Brosens JJ, Ghaem-Maghami S, Lam EW. Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer. Cancer Res. 2010 Jan 1;70(1):367-77 Zhu Q, Sun W, Okano K, Chen Y, Zhang N, Maeda T, Palczewski K. Sponge transgenic mouse model reveals important roles for the microRNA-183 (miR-183)/96/182 cluster in postmitotic photoreceptors of the retina. J Biol Chem. 2011 Sep 9;286(36):31749-60 Sarver AL, Li L, Subramanian S. MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration. Cancer Res. 2010 Dec 1;70(23):9570-80 Stark TJ, Arnold JD, Spector DH, Yeo GW. High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection. J Virol. 2012 Jan;86(1):22635 Saus E, Soria V, Escaramís G, Vivarelli F, Crespo JM, Kagerbauer B, Menchón JM, Urretavizcaya M, Gratacòs M, Estivill X. Genetic variants and abnormal processing of premiR-182, a circadian clock modulator, in major depression patients with late insomnia. Hum Mol Genet. 2010 Oct 15;19(20):4017-25 This article should be referenced as such: Zhu J, Zheng X. MIR183 (microRNA 183). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(4):275-277. Schaefer A, Jung M, Mollenkopf HJ, Wagner I, Stephan C, Jentzmik F, Miller K, Lein M, Kristiansen G, Jung K. Diagnostic and prognostic implications of microRNA profiling in prostate carcinoma. Int J Cancer. 2010 Mar 1;126(5):1166-76 Atlas Genet Cytogenet Oncol Haematol. 2012; 16(4) 277