Download ATRX has a critical and conserved role in mammalian sexual differentiation

ATRX has a critical and conserved role in
mammalian sexual differentiation
Huyhn et al.
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39 (14 June 2011)
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
RESEARCH ARTICLE
Open Access
ATRX has a critical and conserved role in
mammalian sexual differentiation
Kim Huyhn2, Marilyn B Renfree1,2, Jennifer A Graves2,3 and Andrew J Pask1,4*
Abstract
Background: X-linked alpha thalassemia, mental retardation syndrome in humans is a rare recessive disorder
caused by mutations in the ATRX gene. The disease is characterised by severe mental retardation, mild alphathalassemia, microcephaly, short stature, facial, skeletal, genital and gonadal abnormalities.
Results: We examined the expression of ATRX and ATRY during early development and gonadogenesis in two
distantly related mammals: the tammar wallaby (a marsupial) and the mouse (a eutherian). This is the first
examination of ATRX and ATRY in the developing mammalian gonad and fetus. ATRX and ATRY were strongly
expressed in the developing male and female gonad respectively, of both species. In testes, ATRY expression was
detected in the Sertoli cells, germ cells and some interstitial cells. In the developing ovaries, ATRX was initially
restricted to the germ cells, but was present in the granulosa cells of mature ovaries from the primary follicle stage
onwards and in the corpus luteum. ATRX mRNA expression was also examined outside the gonad in both mouse
and tammar wallaby whole embryos. ATRX was detected in the developing limbs, craniofacial elements, neural
tissues, tail and phallus. These sites correspond with developmental deficiencies displayed by ATR-X patients.
Conclusions: There is a complex expression pattern throughout development in both mammals, consistent with
many of the observed ATR-X syndrome phenotypes in humans. The distribution of ATRX mRNA and protein in the
gonads was highly conserved between the tammar and the mouse. The expression profile within the germ cells
and somatic cells strikingly overlaps with that of DMRT1, suggesting a possible link between these two genes in
gonadal development. Taken together, these data suggest that ATRX has a critical and conserved role in normal
development of the testis and ovary in both the somatic and germ cells, and that its broad roles in early
mammalian development and gonadal function have remained unchanged for over 148 million years of
mammalian evolution.
Keywords: Marsupial, eutherian, tammar wallaby, testis, ovary, germ cells
Background
The ATRX gene is located on the mammalian X-chromosome and is a member of the SNF-2-like helicase
superfamily subgroup that contains genes involved in
DNA recombination, repair and regulation of transcription [1]. Mutations in this gene cause ATR-X syndrome
in humans, a sex-linked condition characterized by
alpha thalassaemia, severe psychomotor retardation,
characteristic facial features, microcephaly, short stature,
cardiac, skeletal and urogenital abnormalities [2,3]. Urogenital abnormalities occur in 80% of patients and range
* Correspondence: [email protected]
1
ARC Centre of Excellence for Kangaroo Genomics, Australia
Full list of author information is available at the end of the article
from complete male to female sex reversal [4], commonly associated with truncations of the C-terminus of
the protein, to mild hypospadias [3]. However, the precise role of ATRX in gonadal development in mammals
remains unclear. Although XY ATR-X patients have
varying degrees of gonadal dysgenesis, a common feature is an absence of Müllerian ducts and differing
degrees of virilization [5] showing that there is initial
testis formation that subsequently becomes dysgenetic.
The initial development of the testes indicates that the
phenotype is not caused by sex reversal, but rather by
early testicular failure and a subsequent lack of androgen. The absence of Müllerian ducts in affected individuals confirms the initial development of testes with
functional Sertoli cells that are able to produce AMH
© 2011 Huyhn et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
(required for regression of the Müllerian ducts). Thus
ATRX acts downstream of the sex-determining gene,
SRY and of SOX9 that is required for Sertoli cell development and upregulation of AMH in testicular development [6]. This is consistent with the analysis of testes
from ATR-X patients with more mild gonadal phenotypes. Such testes typically show reduced numbers of
seminiferous tubules and functional Leydig cells but an
absence of germ cells [4,7-9]. Together these phenotypes
suggest that there is an early failure to maintain a viable
testis causing reduced virilization. Depending on how
early in development testicular failure occurs, the developmental effects can range from severe to mild feminization [10].
The mouse X-linked ATRX gene shares 85% homology
with its human orthologue [11]. However, marsupials
are unique in that they have orthologues of ATRX on
both the X (ATRX) and Y (ATRY) chromosomes. ATRX
shares 72% and 78% sequence identity with mouse and
human respectively [12], while ATRY shares 61%
sequence identity and 88% amino acid similarity with
human and mouse ATRX [13]. The more divergent
ATRY gene is functionally specialized, and is exclusively
expressed in the male urogenital system, whereas ATRX
has a broad pattern of mRNA expression in marsupials,
as in mice and humans [6]. The only site where ATRX
and ATRY are co-expressed in the marsupial is in the
adult testis [6]. ATRX is present in the somatic and
germ cells of the adult testes of humans and rats, indicating a possible role in spermatogenesis [14].
Orthologues of ATRX have also been identified in the
nematode Caenorhabditis elegans (C.elegans), suggesting
it is an ancient and ultra-conserved gene in the sex determination cascade. The C.elegans ATRX orthologue (xnp1) has a remarkable conservation of function in gonadogenesis with human ATRX. xnp1 and lin35 (the orthologue to mammalian retinoblastoma) act in concert to
regulate target gene expression in C.elegans. Their roles
appear to be redundant since knockout of either xnp1 or
lin35 alone does not produce a phenotype. However, the
double mutant has abnormalities, which, despite their
divergence from humans, paralleled those seen in XY
ATR-X patients. The mutants were sterile with severe
defects in gonadal development and a decrease in germ
cell numbers [15]. Many of the male C.elegans also exhibited defects in the structure and/or function of the male
mating apparatus [15]. These abnormalities are analogous to the gonadal dysgenesis and external genitalia
defects of XY ATR-X patients [5]. The mutant C.elegans
also had other consistent characteristics with human
ATR-X patients including patterning abnormalities and
growth restriction [5,15,16]. There were also gonadal
anomalies in female C.elegans double mutants, suggesting
a potential role in ovarian development.
Page 2 of 10
To date there are very few reports detailing ATRX
expression in mammals, and none that examine its role
in the early gonad. Marsupials provide a unique system
to examine the function of this gene particularly in
reference to gonadal development since there are two
orthologues, ATRX on the X-chromosome, and ATRY
on the Y-chromosome. To further define the role of this
gene in early gonadal development in mammals we
examined expression of both ATRX and ATRY in the
developing marsupial gonad and of ATRX in the developing mouse gonad.
Results
The ATRX antibody used in this study (rabbit antihuman, Santa Cruz biotechnology, ATRX-H-300) binds
with high affinity to both ATRX and ATRY in marsupials and as such cannot differentiate between the two
orthologues. However, since only ATRY (and not
ATRX) is expressed in the developing testes of marsupials [6], in situ and immunohistochemistry data in
developing tammar wallaby testes demonstrates ATRY
mRNA/protein distribution. Conversely, since ATRY is
absent in XX females, all data in developing tammar
ovaries represents ATRX mRNA/protein distribution.
Similarly in mice, in which there is no Y-linked ATRY
orthologue, all expression data represents ATRX
mRNA/protein distribution. The only tissue in which
ATRX/ATRY expression cannot be distinguished is in
the adult tammar testis where the two genes are coexpressed [6]. A summary of ATRX and ATRY expression in the gonads of eutherian and marsupial mammals
is shown in Table 1.
ATRX and ATRY mRNA distribution in the developing
mammalian testis
Ubiquitous expression of ATRX in mice and ATRY in
marsupials was detected in the indifferent XY gonad
before sexual differentiation by whole mount in situ
hybridization. Staining was weak and diffuse, and localized throughout the entire gonad and mesonephros.
During testicular differentiation, ATRX mRNA distribution in the mouse was identical to ATRY mRNA distribution in the tammar testes at all stages examined
(Figure 1 A, B, C, D). We investigated the mouse from
E11 through to E16.5 and equivalent development stages
in the tammar wallaby testis from d24 of the 26.5 day
gestation to day 40 post partum. The pattern of expression throughout these stages did not change from those
shown in Figure 1. As development proceeded, ATRX/Y
staining was lost in the mesonephros but persisted in
the gonads. Intense staining was detected within the
newly formed seminiferous cords (Figure 1C, D), suggesting localization of ATRX/Y transcripts in the germ
cells and Sertoli cells of the testis throughout its
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
Page 3 of 10
Table 1 Summary of ATRX and ATRY expression in the gonads of eutherian and marsupial mammals
Tissue
Atrx Mouse
ATRX Tammar
ATRY Tammar
Bi potential XY gonad
Yes
Germ and somatic cells
No
Yes
Germ and somatic cells
Developing Testis
Yes
Sertoli, germ and Leydig cells
No
Yes
Sertoli, germ and
Adult Testis
Yes
Leydig and germ cells
Bi potential XX gonad
Yes
Germ and somatic cells
Yes
Germ and somatic cells
Absent
Developing Ovary
Yes
Germ cells
Yes
Germ cells
Absent
Adult Ovary
Yes
Somatic and germ cells
Yes
Somatic and germ cells
Absent
Mouse
A
Tammar
B
E11.5 Testis
d25 Testis
E15.5 testis
E
development. Diffuse staining was also seen in the interstitial tissue suggesting expression outside the cords.
ATRX and ATRY protein distribution in the developing
mammalian testis
D
C
Yes
Leydig and germ cells
D15pp testis
F
ATRY protein was detected by the ATRX antibody in
both the nucleus and the cytoplasm of the somatic and
germ cells of the developing male tammar, at the time
of gonadal sex determination (Figure 2A). By day 2 post
partum, the cords are defined and ATRY had become
nuclear and was restricted to the Sertoli and germ cells
(Figure 2C). This expression pattern persisted throughout development with additional ATRY protein found in
a subset of the interstitial cells (including cells with a
Leydig like shape and location) in later stage gonads
(Figure 2E,G). An identical staining pattern was
observed for ATRX protein in the mouse testis at E14.5
(Figure 2H).
ATRX and ATRY distribution in the adult tammar testis
E16.5 ovary
D15pp ovary
Figure 1 Whole mount in situ hybridization of ATRY in the
developing tammar testis (B, D) and ATRX in the developing
mouse testis (A, C) and mouse and tammar ovary (E, F). Stages
shown for mouse and tammar are at equivalent developmental
time points. mRNA distribution is shown by dark blue/purple
staining and tissues are bleached white. ATRX and ATRY mRNA
transcripts were diffuse and dispersed throughout the indifferent
gonad and to a lesser extent, the mesonephros (A,B). Once
testicular differentiation began, ATRX in mouse and ATRY in tammar
were confined to the developing testis cords and was absent in the
regressing mesonephros (C, D). In the ovary, ATRX mRNA showed a
punctate localization in the cortexin both mouse (E) and tammar (
F), indicative of germ cell staining. M - mesonephros, G - gonad, O ovary, T - testis, scale bar = 500 μm.
Since ATRX and ATRY are co-expressed in the adult
tammar testis [6], their differential protein localization
was not able to be determined. ATRX/Y protein was
present in the primary spermatogonia located at the
base of the seminiferous tubules in the adult tammar
testis (Figure 3A), but was lost from the mature Sertoli
cell nuclei (Figure 3C). ATRX/Y protein was also
detected in the interstitial cells (including cells with a
Leydig like shape and location) and some - but not all peritubular myoid cells (Figure 3E).
ATRX mRNA distribution in the developing mammalian
ovary
As in the testis, expression of ATRX and its protein
localization in the developing ovary was identical
between mice and marsupials. We investigated mouse
stages from E11 through to E16.5 and equivalent stages
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
Developing Testis
Page 4 of 10
A
B
A
Adult Ovary
Adult Testis
Developing Ovary
B
ST
OC
C
ST
C
D
GC
ST
D
AF
SC
T
SG
2 oF
PrF
E
GC
SC
F
F
E
SE
E16.5 Mouse Ovary
H
O
SG
GC
G
GC
PrF
LC
GC
G
H
SC
GC
CL
SC
E14.5 Mouse Testis
Figure 2 Immunohistochemistry for ATRY in the tammar testis
(A, C, E) and ATRX in the tammar ovary (B, D) and mouse
ovary and testis (F, H). Antibody staining is shown by brown/red
staining and tissues are counterstained blue with haematoxylin. In
the developing tammar before gonadal sex determination, ATRX
was confined to the primitive sex cords (A, B, developing
seminiferous tubules in males or cortical cords in females) of both
sexes. After testicular differentiation, ATRY protein was localized in
the Sertoli cells and germ cells of the seminiferous tubules (C). This
is clearly evident by day 8 post partum, where ATRY was clearly
nuclear in both Sertoli and germ cells (E). By day 40 post partum
the same pattern was seen as well as expression in a subset of
interstitial cells that resemble Leydig cells (G). An identical protein
localization was seen for ATRX in the mouse developing testis (H)
with nuclear staining detected in the Sertoli cells, germ cells and
some interstitial cells. After ovarian differentiation, ATRX protein was
strongly nuclear and restricted to the germ cell lineage (D). An
identical staining pattern was seen for ATRX in the mouse ovary (F).
GC - germ cell, SC - Sertoli cell, ST - seminiferous tubule, CC cortical cords, Scale bar = 500 μm.
Figure 3 Immunohistochemistry of combined ATRX and ATRY
in the adult tammar wallaby testis, and for ATRX in the adult
tammar ovary. Antibody staining is shown by brown/red staining
and tissues are counterstained blue with haematoxylin. In the adult
testis, ATRX/Y was predominantly localized at the periphery of the
seminiferous tubules (A). ATRX was nuclear in the primary
spermatogonia but was absent from the Sertoli cells (C). Protein was
also detected in the interstitial cells that resemble Leydig cells (E). In
the adult ovary ATRX was seen in the granulosa cells of developing
follicles (B) at all stages of growth, but not in primordial follicles (D,
F). ATRX was also detected in the steroidogenic theca cells (D) of
antral follicles, in the corpus luteum (H), in the ovarian surface
epithelium (F) and in the oocytes themselves (F). There was no
staining in the antibody negative control (G). SG - spermatogonia,
GC - germ cell, SC - Sertoli cell, LC - Leydig cell, ST - seminiferous
tubule, AF - antral follicle, T - theca, 2°F - secondary follicle, PrF primordial follicle, GC - granulosa cell, O - oocyte, SE - ovarian
surface epithelium, Scale bars; A,D,G,H = 200 μm, B = 500 μm, C, E,
F = 50 μm.
in the tammar wallaby (from d24 of gestation to day 40
post partum). The pattern of expression in these stages
did not change from those shown in Figure 1. A weak
staining pattern was identified throughout the gonad at
early developmental time points. After sexual
differentiation, staining became more intense and punctate, indicative of protein within the germ cell nests
(Figure 1 E, F). A low level of diffuse staining also persisted throughout the somatic cells of the ovary but this
was at a much lower level than that observed in the
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
germ cells (Figure 1 E, F). Thus the germ cells appear to
be the major site of expression in the developing ovary.
Again staining was observed in the mesonephros at
early developmental time points (before gonadal sex
determination) but was lost during gonadal
development.
ATRX protein distribution in the developing mammalian
ovary
Staining in the indifferent ovary was both cytoplasmic
and nuclear, and identical to the staining observed in
the indifferent testis (Figure 2A), restricted largely to the
germ cells and some somatic cells (Figure 2B). As the
ovary developed, ATRX antibody strongly stained in the
nucleus of XX germ cells and was completely absent
from the somatic cell lineages (Figure 2D). An identical
staining pattern was seen in the E16.5 mouse ovary,
with ATRX protein exclusively localized to the nuclei of
germ cells (Figure 2F).
ATRX distribution in the adult ovary
ATRX protein persisted in the nuclei of developing
oocytes but was also found at high levels in the nuclei
of granulosa cells of growing follicles (Figure 3B, D).
ATRX was not seen in the flattened granulosa cells of
primordial follicles, but was abundant and nuclear in
the cuboidal granulosa cells of follicles recruited to the
growing pool (Figure 3F). ATRX was also detected in
the luteal cells of the corpus luteum (Figure 3H) and
the theca cells of large antral follicles (Figure 3D). In
addition ATRX was nuclear and abundant in the ovarian
surface epithelium (Figure 3F).
ATRX mRNA distribution in the developing mammalian
embryo
ATRX mRNA distribution was identical and highly conserved in the mouse and tammar by whole mount in
situ hybridization during early embryonic development.
ATRX mRNA expression was pronounced in the developing fore- and hind-limbs, tail, craniofacial regions and
developing brain. Staining in the craniofacial regions
was consistently more intense in the anterior aspects
where the nose and mouth are situated (Figure 4A, B).
ATRX mRNA was also seen in the neural tube and dorsal root ganglia at all stages. ATRX expression persisted
in all tissues described above through E13.5 in the
mouse. In the tammar at day 25 of gestation (one day
before birth) staining was prominent in the hind limb
(equivalent in stage to an E13.5 mouse hind limb) but
was fading in the forelimb, which is developmentally
accelerated and equivalent to an E17.5 mouse forelimb
(Figure 4C, D, E, F, G, H). ATRX expression was also
prevalent in the developing phallus of both mice and
marsupials (Figure 4E; Figure 5A, B, C, D). ATRX
Page 5 of 10
expression is concentrated at the ventral midline (urethral grove) and in the preputial swellings of the mouse
phallus (Figure 5A, B). This staining pattern was present
at each stage examined from E10.5 to E16.5 in mouse
and day 22 to day 25 of gestation to in the tammar.
Immunohistochemistry of the developing phallus
showed ATRX protein was present in the surface
epithelium, sporadically in the mesenchyme and intensely stained the epithelium of the forming male urethra
up until at least day 8 post partum.
Discussion
This is the first analysis of ATRX expression in the
developing mammalian fetus, and demonstrates that the
regional distribution of ATRX mRNA is highly conserved between eutherian and marsupial mammals. All
sites of expression correspond with developmental deficiencies found in ATR-X patients [2,6] (Table 1). There
was strong expression of ATRX in the developing brain,
neural tube and dorsal root ganglia. These sites of
expression are consistent with the psychomotor retardation, central nervous system and neural tube defects
including spina bifida, scoliosis and kyphosis seen in
ATR-X patients [2]. This suggests ATRX plays a highly
conserved and fundamental role not only in the brain
but in multiple parts of the developing central nervous
system in all mammals. The expression in the dorsal
root ganglia suggests ATRX may be essential for normal
afferent nerve development and is consistent with hypotonia and some of the facial and limb muscle phenotypes observed in ATR-X patients.
ATRX expression was very strong in the developing
fore- and hind-limbs of the mouse and tammar. This
was especially pronounced in early limb bud stages in
the hand and footplate, suggesting a function in limb
patterning. Hand abnormalities are frequently observed
in ATR-X patients including clinodactyly, brachydactyly,
tapering of the fingers, drum stick phalanges, cutaneous
syndactyly and overlapping of the digits [2]. Foot deformities are also observed including pes planus, talipes
equinovarus and talipes calcaneovalgus [2]. Together
with our expression data, these phenotypes suggest
ATRX is essential in hand and footplate patterning in all
mammals and that the phenotypes observed in ATR-X
patients result from a combination of skeletal defects as
well as hypotonia.
Many of the same patterning factors seen in the developing limb are also essential for phallus outgrowth and
development [17]. ATRX fits into this class of factors as
it was detected at high levels in the developing phallus.
ATR-X patients frequently have penile abnormalities
ranging from mild hypospadias and deficient prepuce to
micropenis and severe hypospadias with ambiguous genitalia. The primary cause of these defects has been
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
Page 6 of 10
Mouse E13.5
Mouse E12.5
Mouse E11.5
E
C
A
HB
FB
FL
FL
CF
FL
CF
FB
FB
NT
Ph
T
HL
CF
HL
HL
D
B
F
HB
HB
FL
NT
HL
NT
T CF
d25 Tammar Wallaby fetus
H
G
FB
CF
NT
FL
HL
Figure 4 Whole mount in situ hybridization of ATRX in the developing mouse and marsupial embryo. mRNA distribution is shown by
dark blue/purple staining, while tissues are bleached white. In the E11.5 mouse, mRNA was concentrated in the developing limbs, tail and
craniofacial regions of the fetus. Staining was also evident in the brain, neural tube and dorsal root ganglia (A, B). mRNA persisted in each of
these domains throughout mouse development and was distinct in the forming hand and foot plate, developing phallus, fore and hind brain,
dorsal root ganglia, neural tube and craniofacial regions (C-F). Identical zones of mRNA expression were detected in the near-term tammar
wallaby fetus (G,H). HL - hind limb, FL - fore limb, P- phallus, FB - fore brain, HB - hind brain, NT - neural tube, CF - craniofacial regions, T - tail.
Scale bar = 2 mm.
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
A
Page 7 of 10
B
Mouse
UG
UG
HL
HL
T
E13.5 male
Tammar
C
E14.5 male
D
UPE
UG
d25 male
d25 male IHC
Figure 5 Expression and protein distribution of ATRX in the
phallus. ATRX mRNA was seen throughout the developing genital
tubercle in the male mouse (A, B). Hind limbs and tail were
removed to allow clear observation of the phallus (A) or the entire
phallus was removed (B,C). mRNA appeared to be more
concentrated in the urethral groove on the ventral side of the
phallus (A,B). Identical mRNA distribution was seen in the
developing tammar phallus (C) again concentrated in the urethral
groove. ATRX protein was distributed through cells of the tammar
phallus mesenchyme but was concentrated in the urethral plate
epithelium, lining the urethral groove (D) and enlarged insert (D).
HL - hind limb, T - tail, UG - urethral groove, UPE - urethral plate
epithelium. Scale bars; A,B = 1 mm and C,D = 500 μm.
attributed to gonadal dysgenesis. However, the dynamic
expression of ATRX in the developing phallus with
mRNA and protein concentrated in the developing urethral plate (a signaling center for phallus patterning and
urethral closure) suggests that at least a subset of these
defects may be due to a direct role of ATRX in penile
development and not simply a lack of androgen. Similarly, undescended testes, common in ATR-X patients,
could also be the direct result of deficient genitofemoral
nerve function or development [18], consistent with the
expression detected in the dorsal root ganglia of developing embryos and may not necessarily be a secondary
effect of androgen deficiency.
The role of ATRX and ATRY in gonadal formation
appears to be identical between mice and tammar, indicating a highly conserved and fundamental role in gonadal development in mammals. We have previously
shown that the marsupial specific Y-linked orthologue,
ATRY, is exclusively expressed in the developing marsupial testis [6]. In mice, ATRX was present in the somatic
and germ cells of the bipotential gonad of both XX and
XY fetuses before sexual differentiation. Similarly, in
marsupials, ATRX was present in the somatic and germ
cells of the bipotential XX gonad and ATRY in the
bipotential XY gonad prior to sexual differentiation.
Despite their early expression, ATRX/Y does not appear
to have a functional role in early gonadal formation
since even the most severely affected ATR-X patients
show signatures of normal early testis development.
This is demonstrated by the absence of Müllerian ducts
in ATR-X patients, confirming early testicular differentiation and the formation of functional Sertoli cells that
secreted AMH [6].
After sexual differentiation and the initiation of testicular development, ATRX (in mice) and ATRY (in marsupials) became strongly nuclear and localized in the
Sertoli and germ cells. This was consistent with in situ
experiments showing mRNA localized in the forming
seminiferous cords. The Sertoli cells are essential for
maintaining testicular structure and function. Although
ATRX may not be required for initial Sertoli cell development, the gonadal dysgenesis phenotypes seen in
ATRX patients are consistent with deficient Sertoli cell
maintenance. ATRX (in mice) and ATRY (in marsupials) also appears to have an important function in
germ cell development as it is present in these cells in
both mammals. However, testicular development and
androgen secretion from the Leydig cells is still possible
in germ cell deficient testes, suggesting that the lack of
masculinization in ATR-X patients is not due to germ
cell loss, but potentially a defect in the Leydig cells
themselves. A recent study has shown the ATRX can
enhance the expression of androgen-dependent genes
through physical interaction with androgen receptor in a
human Sertoli cell line [19]. In the absence of a definitive Leydig cell marker in the tammar wallaby testis,
interstitial cells were classified on their location and
morphology. Cells that morphologically resemble Leydig
cells were ATRX positive (in mice) and ATRY positive
(in marsupials) supporting the suggestion of a possible
role in Leydig cell maintenance. However, we cannot
exclude the possibility that the lack of androgen in
ATR-X patients may be primarily caused by Sertoli cellmediated gonadal failure, but the expression profile
raises the possibility of a more direct role for ATRX (in
mice) and ATRY (in marsupials) in androgen function.
Although the marsupial specific Y-linked orthologue,
ATRY, is exclusively expressed in the developing marsupial testis [6], in the adult ATRX and ATRY mRNA are
co-expressed and the ATRX antibody does not discriminate between the two orthologues. Interestingly, in the
adult testis, ATRX/Y was lost from the Sertoli cell lineage suggesting that while it appears to be initially
required to maintain Sertoli cells and early testicular
viability, it is not required for mature Sertoli cell function. However, ATRX/Y remained localized in the germ
cell derivatives and was primarily detected in the type A
spermatogonia located at the basement membrane of
the seminiferous tubules. Thus there may be a direct
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
role of ATRX/Y in maintaining spermatogonial stem
cells. Taken together, the complex expression of ATRX
and ATRY in the developing and adult testis suggests it
functions in multiple cell lineages in both the somatic
and germ cell compartments.
Since it is a rare X-linked recessive condition, no
female ATR-X patients have been identified to date, so
a role for this gene in ovarian development has not
been established. Our mRNA and protein localization
analyses show that there is a highly conserved pattern of
expression in the developing mammalian ovary. Initially,
ATRX protein was cytoplasmic and nuclear, and was
localized in the germ cells of the developing ovary (similar to the pattern seen in the indifferent XY gonad). A
few days later, ATRX protein was pronounced and
strictly nuclear in the germ cells that were congregated
in nests. This was confirmed by whole mount in situ
hybridization, showing punctate mRNA staining in the
cortex of both the mouse and tammar ovaries, indicative
of germ cell expression. There was no ATRX expression
in the ovarian supporting cell lineage until puberty.
ATRX was strongly nuclear in the granulosa cells of
growing and atretic follicles. Interestingly, ATRX was
absent in the flattened granulosa cells surrounding primordial follicles, but rapidly accumulated once the cells
became cuboidal and the follicle was recruited to the
growing pool. This suggests a potential role for ATRX
in regulating granulosa cell growth during folliculogenesis. In addition to the supporting cells, ATRX was also
present in the oocytes at all stages of follicular development. This is consistent with a continued role in germ
cell maintenance as seen in the adult testis.
ATRX was also detected in the luteal cells of corpus
luteum and in the theca cells of large antral follicles
suggesting a possible function in steroidogenesis. In
addition, ATRX was strong and nuclear in the ovarian
surface epithelium where it may have role in proliferation and repair functions after ovulation. Interestingly,
over 85% of ovarian cancers are derived from the ovarian surface epithelium [20] and ATRX has been shown
to be upregulated in ovarian cancer cell lines [18].
The observed pattern of expression for ATRX and
ATRY in the gonads of mice and marsupials was strikingly similar to that of DMRT1 in mice, humans and
the tammar [16,21,22]. DMRT1 represents the most
ancient and conserved gene in the sex determination
pathway with orthologues involved in sexual development in flies and worms. DMRT1 is expressed at all the
same stages of development as ATRX in mice and ATRY
in marsupials and is distributed in the Sertoli and germ
cells of the developing mammalian testis. In the adult, it
is similarly lost from Sertoli cells but is maintained in
the type A spermatogonia [16,22]. In the developing
ovary, DMRT1 is present in the germ cells and then
Page 8 of 10
later seen in the granulosa cells and germ cells of the
adult ovary [16]. The gonadal phenotype of ATR-X and
DMRT1 patients is strikingly overlapping, with initial
Sertoli cell development followed by gonadal dysgenesis
[16,23-25]. Dmrt1 regulates germ cell proliferation in a
cell autonomous and dosage dependent manner in mice,
and its loss results in an increased incidence of teratomas [26,27]. In addition Dmrt1 is required to maintain
Sertoli cell proliferation and viability [27]. Furthermore,
haploinsufficiency of both ATRX and DMRT1 is compatible with normal ovarian development [5,21,25]. The
strikingly similar protein distribution of ARTX and
DMRT1 and the overlapping gonadal phenotypes (outlined in Table 1) between ATR-X and distal chromosome 9p deletion (including DMRT1) patients suggests
a potential interaction between these two genes in the
sexual development pathway. Furthermore, ATRX, like
DMRT1, represents an ancient and ultra-conserved gene
in the sex determination cascade. Thus, together ATRX
and DMRT1 represent the most conserved somatic and
germ cell factors in all animal species.
Conclusion
All sites of ATRX/Y expression and protein distribution
were consistent with phenotypes observed in ATR-X
patients and suggest important roles for this gene in
development of the CNS, limbs, phallus and gonads in
all mammals. ATRX/Y expression and protein distribution in the gonad suggests it may regulate somatic and
germ cell function and gametogenesis in both testicular
and ovarian development. The conserved mammalian
ATRX/Y expression pattern strikingly overlaps with that
of DMRT1 suggesting an ancient and conserved interplay between these two genes in the development of the
gonad. Finally, the similarity between the expression of
ATRX and ATRY in mammals and the mutant xnp-1
phenotype in C.elegans indicates an ultra-conserved role
for this gene in development and maintenance of the
animal gonad [15,16,28].
Methods
Animals
Tammar wallabies Macropus eugenii from Kangaroo
Island (South Australia) were maintained in open grassy
yards in our breeding colony in Melbourne, Australia.
Pouch young were removed from their mother’s pouch
for analysis. When the day of birth was uncertain, age
was estimated using head length and published growth
curves [29]. Fetal samples were obtained from pregnant
females after removal of the pouch young (designated as
day 0 of gestation) as previously described [30,31]. Fetal
mice were obtained from pregnant females with the day
of vaginal plug designated as day 0.5 of gestation [32]
All sampling techniques and collection of tissues
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
conformed to Australian National Health and Medical
Research Council guidelines (2004) and were approved
by The University of Melbourne Animal Experimentation & Ethics Committees.
Tissues
Three replicates were performed for each tissue or fetus
for the immunohistochemistry and in situ hybridization.
All tissues were collected under RNase-free conditions
fixed overnight in 4% paraformaldehyde, washed several
times in 1 X PBS, and stored in 100% methanol at -20°C
before paraffin embedding and sectioning at 8 μm for
immunohistochemistry, or rehydrating in to PBS for in
situ hybridization.
mRNA in situ hybridization
Whole-mount in situ hybridisation was carried out
using standard methods [33] Antisense and sense RNA
probes were prepared separately from a region of ATRX
spanning exons 10-12 that is highly conserved between
ATRX and ATRY using the following primers; Forward
Primer: 5’ CCTACTAAGCCTAAAGAGCAT 3’;
Reverse Primer: 5’ TCAAGGAGGAGGATTATTTTA
3’ and producing a product of 1113bp. Probes were
labeled with digoxigenin-UTP, incorporated by either
SP6 or T7 RNA polymerase. Whole mount in situ hybridisation was carried out in groups according to stage
and sex, with varying proteinase-K digestion times ranging from 270 seconds for gonads before sexual differentiation to 15 minutes for E16.5 mouse ovaries and
post partum tammar wallaby ovaries. Testes were
digested twice to enable probe penetration of the thick
tunica. Whole embryos and gonads were hybridised
with the ATRX/Y in situ ribo-probe overnight at 65 C.
The probe was detected with NBT/BCIP and photographs following dehydration and rehydration through a
methanol series as described [32].
Immunohistochemistry
Antigen retrieval was performed in boiling 0.05 M
NaCit (pH 7.0) for 20 minutes. Sections were pre-treated with 3% hydrogen peroxide in methanol for 15 minutes. The ATRX primary antibody (rabbit anti-human,
Santa Cruz biotechnology, ATRX-H-300) was applied to
tammar adult testis tissue sections at 1:150 dilutions at
4°C overnight. Signal was amplified using the ABC/HRP
kit (DAKO) visualized with AEC+ chromogen (Thermo
Scientific), and counterstained briefly with haematoxylin.
Acknowledgements
We thank all members of the wallaby research group and in particular Kerry
Martin and Scott Brownlees for assistance with the animals. This study was
supported by a National Health and Medical Research Council R D Wright
Fellowship to AJP the Australian Research Council Centre of Excellence in
Page 9 of 10
Kangaroo Genomics and a Federation Fellowship to MBR. There is no
financial or other potential conflict of interest.
Author details
1
ARC Centre of Excellence for Kangaroo Genomics, Australia. 2Department of
Zoology, The University of Melbourne, Victoria, 3010, Australia. 3Research
School of Biological Sciences, The Australian National University, ACT, 2601,
Australia. 4Department of Molecular and Cellular Biology, The University of
Connecticut, Storrs, CT 06269 USA.
Authors’ contributions
All authors participated in the design of the study. Tissue samples were
collected by MBR and AP. AP and KH performed all the experiments. Results
were analyzed by AP and KH who also drafted the manuscript. All authors
read, modified and approved the final manuscript.
Received: 20 January 2011 Accepted: 14 June 2011
Published: 14 June 2011
References
1. Picketts DJ, Higgs DR, Bachoo S, Blake DJ, Quarrell OW, Gibbons RJ: ATRX
encodes a novel member of the SNF2 family of proteins: mutations
point to a common mechanism underlying the ATR-X syndrome. Hum
Mol Genet 1996, 5:1899-907.
2. Gibbons R: Alpha thalassaemia-mental retardation, linked. Orphanet J Rare
Dis 2006, 1:15.
3. Gibbons RJ, Brueton L, Buckle VJ, Burn J, Clayton-Smith J, Davison BC,
Gardner RJ, Homfray T, Kearney L, Kingston HM, et al: Clinical and
hematologic aspects of the X-linked alpha-thalassemia/mental
retardation syndrome (ATR-X). Am J Med Genet 1995, 55:288-99.
4. Ion A, Telvi L, Chaussain JL, Galacteros F, Valayer J, Fellous M, McElreavey K:
A novel mutation in the putative DNA helicase XH2 is responsible for
male-to-female sex reversal associated with an atypical form of the ATRX syndrome. Am J Hum Genet 1996, 58:1185-91.
5. Gibbons RJ, Higgs DR: Molecular-clinical spectrum of the ATR-X
syndrome. Am J Med Genet 2000, 97:204-12.
6. Pask A, Renfree MB, Marshall Graves JA: The human sex-reversing ATRX
gene has a homologue on the marsupial Y chromosome, ATRY:
implications for the evolution of mammalian sex determination. Proc
Natl Acad Sci USA 2000, 97:13198-202.
7. McPherson EW, Clemens MM, Gibbons RJ, Higgs DR: X-linked alphathalassemia/mental retardation (ATR-X) syndrome: a new kindred with
severe genital anomalies and mild hematologic expression. Am J Med
Genet 1995, 55:302-6.
8. Wilkie AO, Pembrey ME, Gibbons RJ, Higgs DR, Porteous ME, Burn J, Winter RM: The
non-deletion type of alpha thalassaemia/mental retardation: a recognisable
dysmorphic syndrome with X linked inheritance. J Med Genet 1991, 28:724.
9. Wilkie AO, Zeitlin HC, Lindenbaum RH, Buckle VJ, Fischel-Ghodsian N,
Chui DH, Gardner-Medwin D, MacGillivray MH, Weatherall DJ, Higgs DR:
Clinical features and molecular analysis of the alpha thalassemia/mental
retardation syndromes. II. Cases without detectable abnormality of the
alpha globin complex. Am J Hum Genet 1990, 46:1127-40.
10. Gibbons RJ, Higgs DR: The alpha-thalassemia/mental retardation
syndromes. Medicine (Baltimore) 1996, 75:45-52.
11. Picketts DJ, Tastan AO, Higgs DR, Gibbons RJ: Comparison of the human
and murine ATRX gene identifies highly conserved, functionally
important domains. Mamm Genome 1998, 9:400-3.
12. Park DJ, Pask AJ, Huynh K, Renfree MB, Harley VR, Graves JA: Comparative
analysis of ATRX, a chromatin remodeling protein. Gene 2004, 339:39-48.
13. Park DJ, Pask AJ, Huynh K, Harley VR, Renfree MB, Graves JA:
Characterisation of the marsupial-specific ATRY gene: implications for
the evolution of male-specific function. Gene 2005, 362:29-36.
14. Tang P, Argentaro A, Pask AJ, O’Donnell L, Marshall-Graves J, Familari M,
Harley VR: Localisation of the Chromatin Remodelling Protein, ATRX in
the Adult Testis. J Reprod Dev 2009.
15. Bender AM, Wells O, Fay DS: lin-35/Rb and xnp-1/ATR-X function
redundantly to control somatic gonad development in C. elegans. Dev
Biol 2004, 273:335-49.
16. Pask AJ, Behringer RR, Renfree MB: Expression of DMRT1 in the
mammalian ovary and testis–from marsupials to mice. Cytogenet Genome
Res 2003, 101:229-36.
Huyhn et al. BMC Developmental Biology 2011, 11:39
http://www.biomedcentral.com/1471-213X/11/39
Page 10 of 10
17. Haraguchi R, Suzuki K, Murakami R, Sakai M, Kamikawa M, Kengaku M,
Sekine K, Kawano H, Kato S, Ueno N, et al: Molecular analysis of external
genitalia formation: the role of fibroblast growth factor (Fgf) genes
during genital tubercle formation. Development 2000, 127:2471-9.
18. Hrabovszky Z, Farmer PJ, Hutson JM: Undescended testis is accompanied
by calcitonin gene related peptide accumulation within the sensory
nucleus of the genitofemoral nerve in trans-scrotal rats. J Urol 2001,
165:1015-8.
19. Bagheri-Fam S, Argentaro A, Svingen T, Combes A, Sinclair A, Koopman P,
Harley VR: Defective survival of proliferating Sertoli cells and androgen
receptor function in a mouse model of the ATR-X syndrome. Hum Mol
Genet 2011.
20. Auersperg N, Wong AS, Choi KC, Kang SK, Leung PC: Ovarian surface
epithelium: biology, endocrinology, and pathology. Endocr Rev 2001,
22:255-88.
21. Raymond CS, Murphy MW, O’Sullivan MG, Bardwell VJ, Zarkower D: Dmrt1,
a gene related to worm and fly sexual regulators, is required for
mammalian testis differentiation. Genes Dev 2000, 14:2587-95.
22. Raymond CS, Kettlewell JR, Hirsch B, Bardwell VJ, Zarkower D: Expression of
Dmrt1 in the genital ridge of mouse and chicken embryos suggests a
role in vertebrate sexual development. Dev Biol 1999, 215:208-20.
23. Raymond CS, Parker ED, Kettlewell JR, Brown LG, Page DC, Kusz K,
Jaruzelska J, Reinberg Y, Flejter WL, Bardwell VJ, et al: A region of human
chromosome 9p required for testis development contains two genes
related to known sexual regulators. Hum Mol Genet 1999, 8:989-96.
24. Tang P, Park DJ, Marshall Graves JA, Harley VR: Trends Endocrinol Metab
2004, 15:339-44.
25. Villard L, Fontes M: Alpha-thalassemia/mental retardation syndrome, XLinked (ATR-X, MIM #301040, ATR-X/XNP/XH2 gene MIM #300032). Eur J
Hum Genet 2002, 10:223-5.
26. Krentz AD, Murphy MW, Kim S, Cook MS, Capel B, Zhu R, Matin A,
Sarver AL, Parker KL, Griswold MD, et al: The DM domain protein DMRT1 is
a dose-sensitive regulator of fetal germ cell proliferation and
pluripotency. Proc Natl Acad Sci USA 2009, 106:22323-8.
27. Kim S, Bardwell VJ, Zarkower D: Cell type-autonomous and nonautonomous requirements for Dmrt1 in postnatal testis differentiation.
Dev Biol 2007, 307:314-27.
28. Steensma DP, Gibbons RJ, Mesa RA, Tefferi A, Higgs DR: Somatic point
mutations in RUNX1/CBFA2/AML1 are common in high-risk
myelodysplastic syndrome, but not in myelofibrosis with myeloid
metaplasia. Eur J Haematol 2005, 74:47-53.
29. Poole WE, Simms NG, Wood JT, Lubulwa M: Tables for age determination
of the Kangaroo Island wallaby (tammar), Macropus eugenii, from body
measurements. CSIRO Division of Wildlife and Ecology 1991, Canberra.
30. Renfree MB: The composition of fetal fluids of the marsupial Macropus
eugenii. Dev Biol 1973, 33:62-79.
31. Tyndale-Biscoe CH, Renfree MB: Reproductive physiology of marsupials.
Cambridge Cambridgeshire; New York: Cambridge University Press; 1987.
32. Nagy A: Manipulating the mouse embryo: a laboratory manual. Cold
Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press;, 3 2003.
33. Wilkinson DG: In situ hybridization: a practical approach. Oxford; New
York: IRL Press at Oxford University Press; 1992.
doi:10.1186/1471-213X-11-39
Cite this article as: Huyhn et al.: ATRX has a critical and conserved role
in mammalian sexual differentiation. BMC Developmental Biology 2011
11:39.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit