* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Document
Survey
Document related concepts
Hospital-acquired infection wikipedia , lookup
Hygiene hypothesis wikipedia , lookup
Neglected tropical diseases wikipedia , lookup
Childhood immunizations in the United States wikipedia , lookup
Schistosomiasis wikipedia , lookup
African trypanosomiasis wikipedia , lookup
Molecular mimicry wikipedia , lookup
Neonatal infection wikipedia , lookup
Infection control wikipedia , lookup
Globalization and disease wikipedia , lookup
Transmission (medicine) wikipedia , lookup
Germ theory of disease wikipedia , lookup
Transcript
SUMMARY • Cypress canker – Infectious propagules called conidia are multicelled, genetically identical to parent, and need a wound to infect – Genetic studies reveal one clone in Europe and many in California – Disease caused by exotic pathogen in Europe and by off site planting and exotic host in California Conidia of Seiridium cardinale observed by optical microscope and SEM SUMMARY • Heterobasidion – Primary infection caused by airborne genetically distinct basidiospores – Secondary infection of adjacent trees caused by direct root to root contact – Host specificity of H.irregulare vs. H. occidentale – Stumps main infection courts for H. irregulare on pine/juniper, wounds for true fir/sequoia – Environmental changes increase abundance of this root and bole pathogen • Armillaria (Honey mushroom) – Mostly secondary infection thanks to rhizomorphs, largest organism in the world True firs Pines Each spore is a genetically different individual: In pines we found the same genetic individual in stumps and adjacent trees indicating direct contagion between the two In true firs and true firs/sequoias we find same individual in adjacent standing trees indicating infection not linked to stumps but to wounds on standing trees “Emergent diseases”: 3: exotic pathogens • 99% of times human responsible for their introduction Like the conquistadores brought diseases that were lethal to those who had never been exposed to them, so do exotic diseases cause true devastation in plant communities because of lack of coevolution between hosts and microbes QuickTime™ and a TIFF (LZW) decompressor are needed to see this pict ure. California invaded: 1849 A.D. Port Orford Cedar Root Disease 1950s Sudden Oak Death 1990s Canker-stain of Sycamores 1980’s Pitch canker disease 1980s New hybrid root pathogen 1990s Manzanita/madrone die-back White pine blister rust 1930s Dutch Elm Disease 1960s Oak root canker 2000 How can people transport pathogens • By transporting plants and plant parts – Crops, and seeds – Raw food – Ornamental plants Untreated lumber Soil Insects vectoring fungi Military activity The Irish Potato Famine • From 1845 to 1850 • Phytophthora infestans • Resulted in the death of 750,000 • Emigration of over 2 million, mainly to the United States. Girdling aerial ‘cankers’ removed from roots Big Sur 2006 K. Frangioso % Mortality of Tanoak by Stem Size Class % Mortality 45 40 35 30 25 20 15 10 5 0 35.8 P. ramorum absent Non-infec ted plots P. ramorum present Infec ted plots 10.7 11.8 28.5 12.4 4.1 1-<5 34.1 5-<10 4.8 10-<20 >20 Tanoak st em diamet er size c lass (c m) Wickland et al., unpublished P. ramorum growing in a Petri dish Organism new to science • • • • Origin unknown Biology unknown Symptoms caused unknown Immediately though highly regulated Rhododendron: In EU mostly a nursery issue, but also present in nurseries in US and Canada Stem canker Leaf necrosis Phytophthora ramorum Sporangia Chlamydospores Is it exotic? • Our studies have indicated that California population is extremely simplified, basically two strains reproducing clonally as expected of an introduced organism • Many hosts appear to have no resistance at all • Limited geographic distribution Where does it come from? • It is unknown where pathogen originally comes from, but previous studies have shown that California forest population is derived from a relatively genetically diversified US nursery population, indicating ornamental nurseries were the most likely avenue for pathogen introduction Let’s look at its genetic structure • Need a number of independent and neutral DNA markers • Used AFLP, a technique that scans the entire nuclear genome • Are our isolates the same as the European ones? • Is the genetic structure suggestive of an introduced or native species? •US forest isolates clearly distinct from EU nursery isolates, also have different mating type •Isolates from nurseries in WA, OR, & BC both of the US and EU types •Potential for XXX sex and recombination in US nurseries •US forest population is genetically very homogeneous, trademark of an introduced species The entire genome was sequenced in less than 3 years since discovery of organism * 12 SSR loci (di- and tri- repeats identified) * Loci selected to be polymorphic both between and within continental populations * 500+ representative isolates analyzed CCGAAATCGGACCTTGAGTGCGGAGAGAGAGAGAGACTGTACGAGCCCGAGTCTCGCAT Mating Type Growth Rate A1 Fast A2 Slow A2 Fast Terminology Genotype Lineage Population Results of 1st microsatellite study • There actually three distinct (genotypically and phenotypically) lineages of P. ramorum • Very low diversity in US forests (microsats cannot discriminate among individuals, clonality confirmed), only one lineage • Several genotypes but only one lineage in EU nurseries • Three lineages in US nurseries Was the pathogen first in US forests or in US nurseries? Slide 12 Was the pathogen first in US forests or in US nurseries? Slide 12 nurserie forests Where was it introduced? • First reports mid 90’s • Pathogen identified in 2000 • By then, the pathogen was widespread • CLUES: severity of symptoms and anedoctal stories Positive isolation P. ramorum We found same genotypes in nurseries and forests proving origin of wild outbreak Introduction phase 1- Escape of pathogen from Infected nursery plants at two locations: Mount Tamalpais (Marin County), and Scott’s Valley (Santa Cruz County) 2- Nurseries and two sites have identical strain composition, but distance between sites is impossible for natural spread of organism nurseries What favors invasion of exotic fungi ? – Density of host increases severity of disease – Corridors linking natural habitats – Synchronicity between host susceptibility and pathogen life cycle – Ecological and environmental conditions Bay/Oak association Bay Coast Live Oak (no sporulation) Canker margin in phloem Bleeding canker Sporangia Site Mantel test among all individuals. [Moran’s I vs ln (geographic distance)] ID Correlation P-value coeff. (r) (1000,000 perm) ALL -0.2153 <0.000001 0.5 0.4 Moran's I 0.3 0.2 0.1 0 -0.1 -0.2 10 100 1000 Mean Geographic Distance (m) 10000 100000