Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Mechanisms of Bacterial Virulence Or what separates the pathogens from the wannabes Summary • Serum resistance capsule, IGBP,LOS host protein binding • Intraphagocytic survival • Modulation of phagocytic function: phagocytic activity, NO, respiratory burst inhibition • Immunoglobulin binding proteins • Antigenic variation Level of virulence factor expression will vary with the type of virulence factor and environmental factors. Constitutive factors like cell wall component are expressed continually. Virulence factors such as toxins, adhesin, capsules, immunoglobulin binding proteins, anticomplement proteases, and alterations of external antigen have variable expression. Expression of these virulence factors comes at a high metabolic cost to the bacteria. The only way they are favorable to the bacteria’s survival is if they in some way confer a competitive advantage to the bacteria’s survival invivo. These genetically encoded virulence factors are usually expressed in a coordinated manner influenced by metabolic and genetic regulator elements that respond to environmental signals. Or…said another way if given a choice bacteria often do not express encoded virulence factors until they sense the environment is right for its favorable application. Once they “sense” the right environment (ie proximity to a mucous membrane, or presence within a phagosome) the genes coding for the particular virulence factor are transcribed and expressed. Virulence factors of H. somnus • • • • • • • Complement resistance Resistance to phagocytosis Intraphagocytic survival Antibody resistance Modulation of phagocytic function Lipooligosaccharide Enhancer bacteria Innate host defense • • • • • • • Mucosal and epithelial barriers Secretory and circulating immunoglobulins Innate serum antimicrobial factors Secretory protease Professional phagocytic cells Natural Killer cells Acute phase response Adaptive host immune response • • • • Secretory and circulating immunoglobulin Helper and cytotoxic T cell response Opsonization Adapted acute phase response – enhanced phagocytic function – enhanced serum mediated killing Virulence factors . . . . the competitive edge • • • • Adhesins Antigen cloaking Antigen variation Complement resistance • Antibody resistance • Antiphagocytic properties • Resistance to intracellular killing • Bacterial proteases • Invasiveness • Exotoxins • Endotoxins • Iron regulating proteins Virulence factors affecting innate immunity • • • • • • Capsular polysaccharide Protease Adhesins Induced cellular entry Resistance to phagocytosis Intaphagocytic survival Virulence factors affecting adaptive immunity • • • • • Intracellular survival Immunoglobulin binding proteins Antigenic variation Proteases Capsular polysaccharide Adhesins • Pili • Type IV Pili • Non Pilus adhesion (afimbrial) Masking Bacterial Recognition • Capsule • Surface binding of host proteins • Non-neutralizing epitopes Toxins • Pore forming toxins (RTX toxins) • IgA proteases • Heat stable toxins (guanylin cyclase activators) • Cytoskeletal toxins Complement Resistance • Confers serum resistance • Favors septicemic disease • Serum resistance is usually one of the major virulence factors differentiating invasive strains from carrier mucosal isolates. Capsular polysaccharide and complement lysis and nonfunctional assembly protease nonfunctional assembly or remote assembly, subject to degradation Capsular polysaccharide Invasion • Directed uptake • Phagocytic uptake – intraphagocytic survival Outcomes of Phagocytosis Blocked fusion lysosome X Phagocytosed bacteria fusion survival Escape prior to fusion killing Resistance to phagocytic killing • • • • Escape from the vacuole Prevention of phagolysosomal fusion Ability to survive in the lysosome Prevention of oxidative burst activity Virulence factors affecting adaptive immunity • Antibody lysis • Immunoglobulin binding proteins – surface Ig binding proteins – soluble Ig binding proteins • Antigenic cloaking • Antigenic variation • Modulation of the immune response IgG Isotypes and resistance to disease • IgG2 Most important in controlling pyogenic infections • IgG2a • IgG2b – Most easily bound by H. somnus Ig binding proteins. – Pathogenic strain of H somnus with IGB fibrils are C resistant Immunoglobulin Binding Proteins Normal Ig binding Opsonization x x Ig mediated C fixation x Y Y YYY Y Soluble IGBP IGBP fixed Antigenic variation • Genetic mechanisms • Post translational antigen modification • Selection pressure – culture + cattle usually are seronegative to strains isolated from their lungs, but may be seropositive to previous infections strains. – Molecular Cloning and Mutagenesis of a DNA Locus Involved in LOS Biosynthesis in H somnus. Wu et al Infection and Immunity vol 68 no 1 Jan 2000 p310-319 Start codon 20 repeats AUGCAATCAATCAATCAAT//////CAATCAATCAATGCCTACCGGTATATT antigen Slip Strand Mispairing 19 repeats AUGCAATCAATCAATCAAT/////CAATCAATGCCTACCGGTATAT New antigen Expression of virulence factors • Genetic control – Environmental stimuli – Induced expression • Innate virulence factor expression • Host specific virulence factors • Tissue specific virulence factors Genetic control of virulence factors • External environment triggering gene transcription • Multiple different regulatory systems • Bacterial population density. NEGATIVE CONTROL INDUCER POLYMERASE gene REPRESSOR Active repressor protein in place preventing transcription Polymerase gene Inducer binds to repressor, causing alteration releasing repressor and allowing polymerase to transcribe gene Inducer activator Inducer activates activator protein and stimulates transcription RNA POL pro gene TRANSCRIPTION PROCEEDS Act RNA POL pro ACTIVATOR POLYMERASTE gene INDUCER PROMTER Selective pressure • Immunologic pressure • Competitive pressure • Nutrient restriction Summary • Serum resistance capsule, IGBP,LOS, host protein binding • Intraphagocytic survival • Modulation of phagocytic function: phagocytic activity, NO, respiratory burst inhibition • Immunoglobulin binding proteins • Antigenic variation Metabolic alterations of virulence factors • Temperature • Chemotherapeutic agents