Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Human Body Organization 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Chemical Bonds •A union between the electron structures of atoms •Atoms can have several orbiting shells that hold their electrons •the innermost shell holds a maximum of 2 electrons •the outer (or valence) shells can hold up to 8 electrons •If the outer shell is complete then the atom is not reactive •If the outer shell is not complete then the atom is reactive •It tries to fill its outer shell with the electrons from other atoms •This is the basis of Chemical Reactions and Chemical Bonds •There are three type of Chemical Bonds in the Human Body •Ionic •Covalent •Hydrogen Macromolecules •Are Giant Molecules of Life •All Use Carbon Atoms •Carbon has only 4 outer shell electrons •can make 4 covalent bonds •excellent for building molecules •hydrocarbons •carbon and hydrogen combinations •functional groups •attachments to carbon backbone •increase diversity •monomers •small molecules that form polymers •polymers •large molecules made up of monomers Lipid Bilayer Phospholipids make up the outer layer of all cells Fluid Mosaic Model Fluid: all components move around freely Mosaic: many different types of proteins on the surface make a mosaic pattern Membrane Proteins Cell Proteins serve many different purposes Diffusion Facilitative Diffusion Active Transport Endocytosis Exocytosis Pinocytosis Animal Cell DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2. 3. Nitrogenous Base Base Pairs: A–T C–G DNA Organization •Chromatin organized: •DNA •Histones One Duplicated Chromosome Human Chromosomes A Pair of Duplicated Chromosomes Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes •they are the same - code for same type of trait •they are different - code for different version of trait Understanding the Numbers •1 chromosome is 1 large DNA molecule •a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG •1000-5000 genes per chromosome •30,000-100,000 genes per human genome DNA Functions •Pass on Genetic Material •Replication •Mitosis •Meiosis •Protein Synthesis •Transcription •Translation Replication •Making an exact copy of DNA •Occurs just prior to cell division •Double helix unwinds •DNA polymerase adds bases •Two exact copies are made Protein Synthesis •Transcription •DNA to mRNA •Translation •mRNA to Protein From Gene to Protein DNA RNA Protein Genetic Code Codons three base code Code for specific amino acids Point Mutation Spontaneous Mutation Environmental Insult •Mutagenesis •Carcinogenesis Mutation is corrected Point Mutation Mutation is not corrected Mutation is corrected Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: •one from mom •one from dad If one is bad, this increases your chance of getting the disease Animal Tissues •Epithelial Tissue •Connective Tissue •Muscular Tissue •Nervous Tissue Epithelial Tissue •Function •filtration •lubrication •secretion •Classification •simple •stratified •squamous •cuboidal •columnar Simple Epithelial Tissue •Squamous •Cuboidal •Columnar Stratified Squamous Epithelium Connective Tissue •Function •binds together tissues and organs •supports tissues and organs •strengthens other tissues and organs •protects other tissues and organs •insulates other tissues and organs •Composed of •cells •matrix •ground substance •fibers (collagen, elastic, reticular) Connective Tissue •Loose Connective Tissue •Dense, Irregular Connective Tissue •Dense, Regular Connective Tissue Connective Tissue •Cartilage •Bone •Adipose Tissue Muscle Tissue •Function •provides organismic or organ movement •organismic posture •thermogenic •Classification •skeletal •smooth •cardiac Muscle Tissue •Skeletal Muscle Tissue •Smooth Muscle Tissue •Cardiac Muscle Tissue Nervous Tissue •Function •converts environmental and internal stimuli into nerve impulses •stimulates or inhibits cells or glands •Classification •neurons •neuroglia (glia) Neuron Organ Systems