Download Human Origins

Chapter 13
The Structure of Genomes
Variations in genome anatomy in
different organisms
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contents





Differences in gene structure among the life domains
Variations in genome size
Isochores
Homology in noncoding regions
Noncoding DNA
 Pseudogenes
 Repeats
 Transposons
 Function of noncoding DNA
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Variation in genome structure
 Genetic code is almost universal, but genome structure
varies considerably from organism to organism
 Genomics reveals whole-genome view of organisms
 Sources of genome variation
 Duplication events (pseudogenes, genome duplications:
poplar, rice, Arabidopsis; polyploidy)
 Transposons (sequence elements that jump around
genome)
 Mutations (e.g., microsatellites) DNA replication is
prone to create and then delete base-pair repeats
 Biophysical constraints (repeats at centromeres,
telomeres: Structural roles)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
The three-domain system is a biological classification introduced by Carl Woese in 1990 based on 16S rRNA
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Comparison of genome structure
between life domains
 Bacteria
 No introns
 Circular chromosomes w/ plasmids
 Archaea
 Some introns
 TATA box–like binding sites (like Eukarya, unlike
Bacteria)
 Circular chromosomes with plasmids
 Eukarya
 Many introns and exons
 Chromosomes located inside nucleus
 Chromosomal DNA tightly bound to histones
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Range of genome size
 Eukaryotic genome
sizes vary by a factor of
200,000
 Genomes of flowering
plants vary a
thousandfold
 Greater than two
hundred–fold variation
in genome size among
vertebrates
C-value (pg)
10-4
10-2 101
103
Prokaryotes
Eukaryotes
Algae
Protozoa
Fungi
Vascular plants
Arthropods
Chordates
Fish, amphibians
Birds, mammals, reptiles
 Prokaryotic genomes
vary by a factor of only
10
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genome size and complexity
 Prokaryotes
Prokaryotes
 Eukaryotes
 No apparent
relationship between
complexity and
genome size
Simplicity due to advancement?
8,000
genes
 Encompass life
domains of Archaea
and Bacteria
 Linear relationship
between gene number
and genome size
0
0
4
8
genome size (Mb)
Eukaryotes
Amoeba dubia: 6 x 1011 bp
Homo sapiens: 3 x 109 bp
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Deletional bias in prokaryotic genomes
 Comparison of pseudogenes between prokaryotic taxa
shows more deletions than insertions over time
 Conclusion: Areas of genome not subject to selective
pressure get smaller over time
insertions
deletions
10,000
33
1,000
Genome size
bp
1
8
15
7
8
15
16
31
22
100
10
27
26
9
7
12
2
2
25
41
6
10
2
0
Prokaryotic
genera
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
The C-value paradox
Are bigger genomes richer in genes?
 Why is there a lack of correlation between
genome size and complexity in eukaryotes?
 Some things do correlate to genome size
 Duration of the cell cycle
 Minimum cell volume
 Presence of LTR transposon sequences in
various species of grasses increases their
genome size
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Hypotheses to explain the C-value
paradox
 Some hypotheses to explain the paradox




Junk DNA
Selfish DNA
Nucleoskeletal hypothesis: balanced growth
Nucleotypic hypothesis
 Developmental control
 Transposon hypothesis
 All are overlapping theories of deciphering a
puzzle
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Caveats
 Junk DNA and selfish DNA
 Lack of constant accumulation in many organisms with
large genomes
 Nucleoskeletal hypothesis
 Not compatible with sudden changes in genome size
 Nucleotypic hypothesis: cell volume and genome size
 Not always true across taxa
 Transposons
 Relationship not quite linear
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
The human genome organization
Human genome
3000 MB
Genes and related sequences
900 MB 30%
Coding DNA
90 MB 3%
Extragenic DNA
2100 MB 70%
Repetitive DNA
420 MB 14%
Non-coding DNA
810 MB 27%
Tandemly repeated DNA
pseudogenes
Low copy or unique DNA
1680 MB 56%
Interspersed repeats
Introns leaders, trailers
Satellite Minisatellite
Microsatellite
LTRs, TEs
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Common Euk Genome features
 Variations in base-pair content
 Isochores (GC rich or AT rich large regions)
 Duplicated genes
 Paralogous genes: gene duplication
 Pseudogenes: Lost functions
 Repetitive sequences
 Minisatellites (100 bp) and microsatellites (1-6 bp)
 Transposon sequences
 Foreign DNA
 DNA from other free-living organisms
 Viral DNA remnants
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Isochores (1970s)
 Isochore structure
 Variation of G+C content over large genomic areas >300 Kb
 Typical of mammals and birds
 Why do isochores exist? High GC stabilizes genomes?
 Extra thermal stability for homeotherms (warm blooded: mammals
and birds)? But bacterial expt. do not pan out of GC and optimal
growth conditions.
G+C
0.6
0.3
0
kb
4,000
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genome duplications
 A driving force in evolution?
 Large-scale duplication of genes
 Differentiation of function in duplicated genes over
time
 Evidence
 Polyploidy
 More than two copies per chromosome
 Endopolyploidy: cotyledons and salivary glands of fruit
flies, blood platelets with 64 times of the genomes
 Evidence of past genome duplications in diploid
organisms
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Polyploidy in plants and animals
 Plants
 Wheat (6n) Banana 3n
 ~50% of naturally
occurring flowering
plants are polyploid
 Polyploidy in animals
 Fish
 Amphibians
 Red viscacha rat (4n)
10 mm
Comparison of red viscacha
rat sperm (left) to sperm of
other rodent species
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Evidence of genome duplication in
Arabidopsis
 The Arabidopsis
genome shows evidence
of 4+ large genome
duplications
 Compare blocks of
genes that have related
sequences
1
2
3
4
5
 Blocks imply genome,
rather than gene,
duplication
 Distribution of block
ages points to multiple
duplications
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Junk DNA?
 Junk DNA
 Sequences that serve no apparent evolutionary function
 Is non-coding DNA junk?
 Evidence against junk DNA
 Statistical evidence of selection acting on noncoding
regions (high identity between mouse and human)
 Biological functionality for noncoding regions
AGACCAGGAACTTACAGCGACCTTGAACTGTTCCATTGCTCTTTTCCTGGGGCGG-GGGC
||||||||||||
||| || |||||||||||||||||||||||||||||||| |||
AGACCAGGAACTCGTGGCGGCCGTGAACTGTTCCATTGCTCTTTTCCTGGGGCGGAGGGA
Comparison of human and mouse intergenic regions
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Variations in the amount of noncoding DNA
 Prokaryotes
 Bacteria: ~15%
 Eukaryotes





Yeast (S. cerevisiae): 30%
Malarial parasite (P. falciparum): 50%
Flowering plant (A. thaliana): 70%
Nematode worm (C. elegans): 70%
Human (H. sapiens): 95%
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Classification of noncoding DNA
 Pseudogenes
 Duplicated genes that have accumulated too
many deleterious mutations to function
 Repeats
 Repeated units of DNA are 1–200 bp long
 Transposable elements
 Pieces of DNA that have the ability to jump
from place to place in the genome
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pseudogenes
 Pseudogenes can exist because a single
functioning copy of a gene is sufficient
 Processed pseudogenes lack a promoter and
introns
 Believed to derive from mRNA copy
 Reverse transcribed into cDNA
 Reintroduced into genome
 Pseudogenes can be quite common
 In C. elegans, there is one pseudogene for
every eight genes
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Minisatellites
Density centrifugation in 60’s
 Tandem repeats 7-100 bp long
 Generally GC rich
 Highly polymorphic (different in different organisms)
 Minisatellites in coding and non-coding regions
 Example: apolipoprotein family
 Association with specific lipoprotein depends on number
of repeats in coding minisatellite
 Minisatellites can also affect gene regulation of nearby
genes
 Found in wide range of eukaryotic organisms
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Instability in human minisatellites
 Minisatellites in humans are hypermutable
 Mutation rate > 0.5% per sperm per allele
 Not the case in mouse, rat, or pig genome
 Insertion of human minisatellites into mouse genome
does not increase germ line mutation rate
 Differences between minisatellites in humans and
other mammals
 90% of minisatellites are in highly recombinant regions
 66% of pig, 30% of rat, and 15% of mouse
minisatellites are in similar regions
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Minisatellite mutations
 Mutations involving minisatellites can be complex
 Mechanism not fully understood
 Minisatellites associated with fragile sites on
chromosomes
step 1
step 2
step 3
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Applications using minisatellites
 DNA fingerprinting
 Highly polymorphic,
thus ideal for
identifying individuals
 Studying the effects of
mutagens
 Used to count germ
line mutations in
children near
Chernobyl
 Chernobyl children had
double the mutation
rate of the controls
kB
–12
–10
–8
–6
udder
cultured
cells
Dolly
–4
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Forensics
 Alec Jeffreys and his technician Vickie Wilson found minisatellites by
chance in 1984. This is the story from “Genome” by Matt Ridley P.
132
 Jeffreys et al. were interested in gene evolution by
studying a muscle protein myoglobin from humans and
seals when they found a 12 bp long repeat in the middle of
the gene. They found that these repeats vary in number
between different individuals and can actually be used as
genetic fingerprinting like a barcode. They left working
with myoglobins but started working on the minisatellites.
 Immigration authorities got interested in using it for
checking if new immigrants have any undisclosed relatives
in that country.
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Actual story






On August 2, 1986 a young girl, Dawn Ashworth was found raped and murdered in a
small town of Narbourough. A week later Police arrested a man named Richard Buckland
who confessed to the murder. A case should have been closed but Police saw similarities
between Ashworth murder with another unsolved murder of Lynda Mann three years
earlier. The situation was so similar that Police were sure that the same man did that
murder too but Buckland was not ready to confess for that other murder.
So they decided to use DNA fingerprinting. All DNA samples were sent to Jeffreys and he
did the minisatellite testing in a week. What he found was most bizarre. Two semen
samples were identical but Buckland DNA did not match with the semen found at both
the murder sites. So he was lying and was cleared of both the murders. This was the first
time a man was released on the basis of DNA evidence.
So who did it?
Police thought Jeffreys made a mistake and must be wrong. So they repeated at their own
lab and result was the same. They did not give up. They took blood samples from 5,500
men in that village and did large scale fingerprinting. None matched with semen so this
must be work of an outsider.
A bakery man, Ian Kelly in another town boasted to his colleagues that he took the blood
test for a guy, Colin Pitchfork who lived in Narborough. Pitchfork requested Kelly to help
him since Police were trying to frame him. News went out and the Pitchfork DNA
samples matched with semen. Case closed!
Pitchfork got life in prison in January 1988. Murderer was now behind the bar!
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
More applications
 In Britain, 320,000 people have been typed and 28,000 were
used to link with crime. However, 60,000 were cleared of the
crime.
 Mini and microsatellites are used commonly but definitively.
 Josef Mengle’s remains were exhumed and confirmed!
 Presidential semen confirmed in Monica Lewinsky’s case
 In World Trade Center attacks, DNA fingerprinting was used
to provide death certificates.
 Illegitimate kids of Thomas Jefferson were identified.
 “IdentiGene” and “DNA diagnostics” services used and
flourishing for paternity tests that may wiggle some out of
paying child-support.
 Presence of pathogen’s in biological warfare also use another
kind of DNA fingerprinting.
 Molecular Biologists can become defense lawyers, patent
attorneys, and DNA experts. Bart Simpson case! (O. J.).
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Microsatellites (SSR)
 Definition
 Tandem repeats of 1–6
bp
 Also called simple
sequence repeats
(SSRs)
 Found in prokaryotes
and eukaryotes
 Slipped-strand
mispairing is the
biological process that
creates microsatellites
Examples from
human genome
Common
Rare
A
C
AT
CG
AAC
ACG
AGAT
CCCG
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Microsatellite utility in bacteria
 Microsatellites are unstable because of susceptibility
to slipped-strand mispairing
 Slipped-strand mispairing causes mutations that alter
protein function
 Virulent bacteria have microsatellites associated with
multiple genes (contingency genes)
 By maintaining genetic diversity within a small
population, bacteria can increase adaptability
 found in the bacterium N. gonorrhoeae, which causes
the sexually transmitted disease gonorrhea
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
An example of contingency genes
 Bacterium N. gonorrhoeae causes gonorrhea
 Opa genes code for surface proteins
 Allow infection by facilitating adhesion to epithelial
cells
 But also make bacteria susceptible to human
phagocytes
 Contain microsatellites with CTCTT repeats
 Repeat deletions cause frame-shift mutations
 Surface proteins no longer “sticky”
 N. gonorrhoeae can thereby avoid lethal phagocytes
 1 in 100–1,000 new cells will have CTCTT mutation
 Therefore, there is always a population of evasive and
infectious cells
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Microsatellites in the human genome
SSR density (bp/Mb)
1
6
chromosome
 More or less evenly
distributed among
chromosomes
 Some repeats more
common than others
 Trinucleotide repeats
responsible for a
number of diseases
12
18
x
y
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Trinucleotide repeats and human disease
 Expansion of trinucleotide repeats responsible
for over a dozen neurological diseases
 Examples: Huntington’s disease, fragile X
syndrome (mental retardation)
 Repeat motifs
 Mutations involving CGG, GCC, GAA, CTG,
and CAG account for 14 diseases
 Some located in noncoding areas
 Others located in coding regions
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Trinucleotide expansion in
Huntington’s disease
 Huntington’s disease
 Midlife onset of dementia (progressive decline in cognitive
function due to damage or disease in the brain), followed
by death
 Caused by expansion of CAG repeats in the coding region of
Huntingtin
 CAG repeats translated into polyglutamine tract (QQQ)
 6–35 repeats: no disease
 36–121 repeats: Huntington’s disease
 > 70 repeats: Huntington’s disease with juvenile onset
 Other diseases also caused by CAG expansion in coding region
 Polyglutamine tract believed to cause neurotoxic aggregates of
protein to form inside neurons
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Transposable elements
 DNA regions flanked by repeats that can jump around
the genome
 Transposable-element (TE) insertion can be faster than
chromosome replication
 Allows TEs to rapidly accumulate in genome
 44% of human genome sequence is TEs
 TEs can have different effects on the host
 Insertion into gene can destroy function
 TE can evolve into beneficial gene (insertion in lethal
gene)
 TE can affect gene expression by regulatory region
insertion
 But most TEs will have a neutral effect
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
TE content among species
 TE content varies greatly among species




Humans: 44%
Maize: > 50%
Drosophila: 15%
Arabidopsis, C. elegans, yeast: < 5%
 TEs tend to be concentrated in particular
genomic regions: Human X chromosomes high
TEs
 In maize, TEs have doubled the size of the
genome over the last few million years
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Intraspecies variations in TE content
 Wild barley plants examined in Israeli canyon
containing distinct microclimates (center of origin)
 Copies of BARE-1 transposon vary in individual wild
barley plants
 8,300–22,000 copies per plant (1.8%–4.7% of the total
genome)
 BARE-1 copy number (and genome size) found to
positively correlate with dryness and altitude
 Biological significance
 Large genome correlates with increased cell volume
 Large cell volumes make growth more efficient in
cooler weather of higher altitudes with slower cell
division
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Autonomous, nonautonomous, and
inactive transposons
 Autonomous
 Has all genes required
for transposition
Autonomous
 Nonautonomous
 Degraded autonomous
sequence
 Move around using
autonomous proteins
Nonautonomous
 Inactive (relics)
 Stationary
 Sequence too degraded
for transposition
Inactive
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Class I transposable elements
 Use RNA to transcribe themselves
 Types
 Long terminal repeat (LTR) retrotransposons
 Non-LTR retrotransposons
 Class I transposable elements in the human genome
account for ~42% of the total genome sequence
 while a reverse transcriptase gene has been found in
almost all eukaryotic genomes examined to date, it is
found in only a minority of Bacteria and in almost no
Archaea
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
LTR retrotransposons (autonomous)
 Flanked by long terminal repeats (LTR)
 Genes code for transposition machinery
 Gag: capsid-like protein
 Pol: polymerase (reverse-transcriptase activity) and
protease activity
RT and
protease long
long
terminal
repeats
terminal
repeats
Gag
Pol
Example: BARE-1 (~8.9 kb)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Non-LTR retrotransposons
(autonomous)


Flanked by 6- to 20-bp target-site duplications (TSDs) (Short)
Also 5’ and 3’ untranslated regions (UTR)

Transcription machinery coded by ORF-1 and ORF-2

L1 retrotransposons make up over 15% of the human genome. Most of them are
nonfunctional, but of the 500,000 total copies, 40–60 are considered to be active. In
contrast, the mouse genome has up to 5,000 active non-LTR retrotransposons,
which accounts for the fact that roughly 10% of the spontaneous-mutation rate in
mice is due to TE insertions.
 3’ UTR characterized by AATAAA and poly(A) tail
 ORF-2 contains reverse transcriptase
RT
TSD
ORF 1
TSD
ORF 2
3’ UTR
5’ UTR
Example: Line1 element (6 kb)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Nonautonomous retrotransposons
 Alu elements (no function known)




Type of short interspersed nuclear element (SINE)
Transposed by L1 retrotransposon
TSDs like non-LTR transposons
Left (L) and right (R) monomers and poly(A) tail
 One million copies in human genome
TSD
A(n)
L
TSD
R
Example: Alu element (0.3 kb)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Effects of active retrotransposons
 Cis retrotransposition (copy and insert itself
throughout the genome)
 Trans retrotransposition (copy others)
 L1 retrotransposons replicate Alu elements
 Insertional mutagenesis
 Retrotransposon inserts into coding region of gene
 Unequal homologous recombination
 Duplications and deletions in chromosome regions
 Effects on gene expression
 Some L1 sequences have acquired enhancer function
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Class II transposable elements




Use DNA-based method of transposition not RNA
DNA transposons are typically unable to copy themselves
Approximately 200,000 copies of this type of TE in the human genome
Class II also includes P-element transposons in Drosophila and
activation-dissociation (Ac/Ds) elements in maize
 Transposes functions in the excision of the TE from one region and its
integration into another
TSD
TSD
transposase
inverted
terminal
repeats
Example:
Tc1-mariner (1.4 kb)
inverted
terminal
repeats
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Miniature inverted transposable
elements (MITEs) (unusual)
 Commonly found in plants (6% rice), insects,
nematodes, and humans (high copy number)
 Nonautonomous class II transposons
 Small (< 500 bp), less disruptive, size possibly
responsible for high copy number
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
PING and PONG







For many years, MITEs were a mystery to biologists, because their high copy
number implied active (or autonomous) elements, but none had been found.
The sequencing of the rice genome gave researchers the opportunity to intensify the
search for active MITEs, and in 2003, three separate groups of researchers
published proof that MITEs can move about the rice genome.
Plant MITEs fall into two categories: stowaway-like and tourist-like.
Stowaway-like MITEs are moved about the genome by autonomous class II
transposons similar to the TC1-mariner element described in the previous slide.
Tourist-like elements have as their autonomous partners a newly described class of
active MITE called PIF/Pong. The previous figure in the slide compares the
sequences of Pong and a nonautonomous MITE called Ping.
The red and green regions represent homologous terminal regions among a variety
of degraded Ping elements (mPings in the figure) and Pong elements. Unlike active
Pong sequences, Ping elements have degraded ORF-1 genes. While the function of
ORF-1 is not fully understood, the ORF-2 gene is believed to code for the
transposase that is responsible for making Ping elements mobile.
The high copy number of MITEs is very unusual for a class II transposon. The
small size of MITEs (typically less than 500 bp) is believed to be the reason that
these transposons are so common. Insertions of MITEs in the genome would
presumably be less disruptive than insertions of larger TEs and hence would not be
selected against as strongly.
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
TEs and X-chromosome inactivation
 X-chromosome inactivation (mammalian)
 One X chromosome in each somatic cell inactivated
 Occurs during embryonic development in female
mammals
 Regions of X chromosome that are inactivated are rich
in L1 elements
 10% of X chromosome that escapes inactivation is in
region with low L1 density
 L1 elements on X chromosome dated to 100 million
years ago (emergence of mammals)
 Correlations suggest L1 elements might be involved in
X-chromosome inactivation
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary I
 Genome structure varies tremendously
 Genome size and complexity
 Linear relationship in prokaryotes
 No clear relationship in eukaryotes
 Genome features
 Statistical features
 Isochores: regions of elevated G+C content
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary II
 Coding regions
 Bacteria: no introns
 Archaea: some introns, TATA boxes
 Eukarya: many introns and exons, TATA boxes
 Noncoding regions
 Pseudogenes
 Repetitive sequences
 Minisatellites
 Microsatellites
 Endogenous viral sequences
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary III
 Transposons
 Class I
 RNA intermediate
 Frequent replication
 Class II
 DNA intermediate
 Rare replication
 MITEs
 DNA intermediate
 High copy number in plants
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary IV
 Forces affecting genome structure





Point mutations
Gene and genome duplications
Viral infection
Transposable elements
Tandem repeat–associated mutations
 Functions of noncoding DNA
 Gene regulation
 Adaptation to environmental conditions
 Co-opting for new gene function
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458