* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Chapter 17.
Survey
Document related concepts
Transcript
Mutations AP Biology 2007-2008 Genes Genes code for proteins the order of A, T, C & G Proteins create traits DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC protein aa aa aa aa aa aa aa aa AP Biology trait Transcription & Translation Genes code for proteins through… transcription translation AP Biology trait Mutations Mutations are changes in DNA sequences changes to the order of A, T, C & G different order = different amino acid in protein different protein structure = different protein function AP Biology BB Bb bb Mutations Point mutations single base change silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon AP Biology Point mutation leads to Sickle cell anemia What kind of mutation? AP Biology Missense! Sickle cell anemia Primarily Africans recessive inheritance pattern strikes 1 out of 400 African Americans AP Biology Mutations Frameshift shift in the reading frame insertions changes everything “downstream” adding base(s) deletions AP Biology losing base(s) Where would this mutation cause the most change: beginning or end of gene? Frameshift mutations THERATANDTHECATATETHEREDBAT Deletion THERTANDTHECATATETHEREDBAT Insertion THERAATANDTHECATATETHEREDBAT AP Biology Cystic fibrosis Primarily whites of European descent strikes 1 in 2500 births normal allele codes for a membrane protein that moves Cl- across cell membrane AP Biology 1 in 25 whites is a carrier (Aa) mutant channel limit movement of Cl- (& H2O) across cell membrane thicker & stickier mucus coats cells mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections without treatment children die before 5; with treatment can live past their late 20s Chloride channel Effect on Lungs normal lungs airway Cl- transports chloride through protein channel out of cell Osmotic effects: H2O follows ClCl- channel H 2O cells lining lungs cystic fibrosis ClH 2O bacteria & mucus build up thickened mucus hard to secrete AP Biology mucus secreting glands AP Biology What’s the value of mutations? AP Biology 2007-2008 Point mutation leads to Sickle cell anemia What kind of mutation? AP Biology