Download A structural rationale for SV40 Vp1 temperature-sensitive mutants and their complementation

JOBNAME: PROSCI 15#9 2006 PAGE: 1 OUTPUT: Monday August 7 17:23:29 2006
csh/PROSCI/118160/ps0621956
FOR THE RECORD
A structural rationale for SV40 Vp1 temperature-sensitive
mutants and their complementation
HARUMI KASAMATSU,1 JENNIFER WOO,1 AKIKO NAKAMURA,1 PETER MÜLLER,2
M. JUDITH TEVETHIA,3 AND ROBERT C. LIDDINGTON4
1
Molecular Biology Institute and Department of Molecular, Cell and Developmental Biology, University of California,
Los Angeles, California 90095, USA
2
X-Ray Diffraction Facility, Department of Chemistry, Massachusetts Institute of Technology, Cambridge,
Massachusetts 02139, USA
3
Department of Microbiology and Immunology, Penn State College of Medicine, Hershey, Pennsylvania 17033, USA
4
Infectious and Inflammatory Disease Center, The Burnham Institute for Medical Research, La Jolla,
California 92037, USA
(R ECEIVED March 7, 2006; F INAL R EVISION May 26, 2006; ACCEPTED May 28, 2006)
Abstract
Two groups of temperature-sensitive (ts) mutants, termed ts B and ts C, have mutations in the major
capsid protein of SV40, Vp1. These mutants have virion assembly defects at the nonpermissive
temperature, but can complement one another when two mutants, one from each group, coinfect a cell.
A third group of mutants, termed ts BC, have related phenotypes, but do not complement other mutants.
We found that the mutations fall into two structural and functional classes. All ts C and one ts BC
mutations map to the region close to the Ca2+ binding sites, and are predicted to disrupt the insertion of
the distal part of the C-terminal invading arm (C-arm) into the receiving clamp. They share a severe
defect in assembly at the nonpermissive temperature, with few capsid proteins attached to the viral
minichromosome. By contrast, all ts B and most ts BC mutations map to a contiguous region including
acceptor sites for the proximal part of the C-arm and intrapentamer contacts. These mutants form
assembly intermediates that carry substantial capsid proteins on the minichromosome. Thus, accurate
virion assembly is prevented by mutations that disrupt interactions between the receiving pentamer and
both the proximal and distal parts of the C-arms, with the latter having a greater effect. The distinct
spatial localization and assembly defects of the two classes of mutants provide a rationale for their
intracistronic complementation and suggest models of capsid assembly.
Keywords: viral assembly; complementation; temperature-sensitive mutants; SV40; capsid
SV40 is a small DNA virus belonging to the polyomaviridae family. Virus particles are ;450 Å in diameter with
icosahedral symmetry. Viral capsids contain 360 copies of
a major structural protein, Vp1, arranged as 72 pentameric building blocks on the viral surface (Rayment et al.
1982). Mature virus particles also contain ;72 copies of
Reprint requests to: Robert C. Liddington, The Burnham Institute
for Medical Research, 10901 North Torrey Pines Road, La Jolla, CA
92037, USA; e-mail: [email protected]; fax: (858) 713-9925.
Article published online ahead of print. Article and publication date
are at http://www.proteinscience.org/cgi/doi/10.1110/ps.062195606.
the minor structural proteins Vp2 and Vp3; four host
histones (H2A, H2B, H3, and H4); and the viral genome,
a double-stranded, circular DNA of about 5200 base
pairs, together forming a ‘‘minichromosome.’’ The capsid
structure is known as atomic resolution (Liddington et al.
1991; Stehle et al. 1996). The all-pentamer organization
requires that the interactions between pentamers holding
the capsid together cannot conform to the Caspar-Klug
rules of quasisymmetry (Caspar and Klug 1962). Instead,
the capsid is tied together by long C-terminal arms
(C-arms) that emanate from each Vp1 and invade a
Protein Science (2006), 15:2207–2213. Published by Cold Spring Harbor Laboratory Press. Copyright Ó 2006 The Protein Society
ps0621956 Kasamatsu et al. FOR THE RECORD RA
2207
JOBNAME: PROSCI 15#9 2006 PAGE: 2 OUTPUT: Monday August 7 17:23:31 2006
csh/PROSCI/118160/ps0621956
Kasamatsu et al.
neighboring pentamer. The arms adopt alternate conformations between pentamers, but at their distal ends they
adopt identical conformations, wrapping around the body
of a neighboring pentamer and inserting into a clamp that
ends at a dual Ca2+ binding site.
Five Ca2+-coordinating acidic residues are critical for the
formation of an infectious particle (Li et al. 2003). Assembly
of the closely related polyomavirus Vp1 pentamer in vitro
also requires Ca2+ ions (Salunke et al. 1986). The crystal
structure of a Vp1 pentamer in complex with a fragment of
the common C-terminal segment of Vp2 and Vp3 (hereafter
referred to as Vp3) has been determined for polyomavirus
(Chen et al. 1998). The Vp3 fragment inserts into the axial
cavity of the pentamer, and both the N- and C-terminal ends
extend toward the interior of the virus. The Vp3 fragment is
nearly identical in sequence to that of SV40, as is the
interaction site on Vp1, which is therefore likely to bind Vp3
in an analogous fashion. One Vp1 pentamer bound to one
Vp3 is presumed to initiate condensation of the minichromosome for virion assembly in the nucleus. Assembly
occurs sequentially, with capsid proteins arranging themselves on the viral minichromosome (Garber et al. 1978,
1980; Baumgartner et al. 1979; Coca-Prados and Hsu 1979;
Fernandez-Munoz et al. 1979; Fanning and Baumgartner
1980; Jakobovits and Aloni 1980; La Bella and Vesco 1980).
Correct icosahedral virion assembly requires selecting specific intrapentamer and interpentamer bonding, calcium
binding, and possibly Vp3 interaction.
Three classes of temperature-sensitive (ts) mutants
have been defined within the Vp1 gene: ts B, ts C, and
ts BC (Tegtmeyer and Ozer 1971; Chou and Martin 1974;
Dubbs et al. 1974; Lai and Nathans 1974; Robb et al.
1974; Tevethia et al. 1974; Tevethia and Ripper 1977;
Noonan and Butel 1978; Cosman and Tevethia 1981;
Mertz 1984). ts B mutants complement ts C mutants,
while ts BC mutants do not complement other mutants
(Chou and Martin 1974, 1975; Lai and Nathans 1975,
1976). Lai and Nathan have proposed that complementation occurs at the protein level, but the molecular basis
has not been explained. The block in assembly of ts
mutants leads to the accumulation of two classes of
assembly intermediates: 75S particles comprising SV40
minichromosomes with little or no capsid proteins, and
100–160S intermediates with extensive association of
capsid proteins (Garber et al. 1978, 1980; Bina et al.
1983a,b; Blasquez et al. 1983; Ng and Bina 1984). In
contrast, mature virions have a sedimentation coefficient
of 240S. Based on the observation of the intermediates,
nuclear virion assembly has been proposed to proceed in
an orderly and stepwise fashion involving the addition of
structural proteins to an SV40 minichromosome (Garber
et al. 1978, 1980; Bina et al. 1983a; Blasquez et al. 1983;
Ng and Bina 1984). Mapping the ts mutants onto the
capsid structure has allowed us to correlate them with
2208
Protein Science, vol. 15
their phenotypes, provide a rationale for intracistronic
(that is, within one gene) complementation, and to provide further clues into the assembly process.
Results and Discussion
We mapped Vp1 ts mutations onto the SV40 capsid
structure and onto a model of the Vp1–Vp3 complex
(see Materials and Methods). Twenty Vp1 ts mutants have
been previously sequenced (Behm et al. 1988), and seven
further mutants were sequenced in this study (Table 1); of
these, 21 are distinct Vp1 mutants. All mutations map to
structural elements that form inter- and intrapentamer
interactions within the viral capsid (Table 1). Table 1 also
lists the reported assembly intermediates that accumulate
at the nonpermissive temperature (Garber et al. 1978,
1980; Bina et al. 1983a,b; Blasquez et al. 1983; Ng and
Bina 1984). The mutation sites fall into two major
regions, I and II (shown in Figs. 1, 2, colored according
to their ts group), each with a distinctive phenotype at the
nonpermissive temperature. It is noteworthy that none of
the mutants are found in residues within the C-terminal
arms themselves. Presumably, such mutants are too
disruptive to be tolerated at any temperature.
Interaction with the proximal part of the invading arm is
required for accurate capsid assembly
Region I encompasses a contiguous region that includes
a small ‘‘jelly-roll’’ domain inserted between strands E
and F (which packs against the side of the CHEF b-sheet,
creating the acceptor site for the proximal part of the
invading C-arm), as well as surrounding loops on the
middle and upper surface of the pentamer. All 10 ts B
mutations and four out of five ts BC mutations map to this
region (Fig. 1). Of these, three ts B mutations (at Gly 163,
Ala 166, and Ala 195) and three ts BC mutations (at Thr
170, His 193, and Asp 200) map to the jelly-roll domain
itself; four ts B mutations (at Gln 54, Pro 58, Glu 83, and
Ala 71) and one ts BC mutation (at Pro 283) map to loops
and strands that make direct contact with the jelly roll
domain; three ts B mutations (at His 136, Gly 139, and
Ser 147) are more distant, and map to loops that interlock
neighboring monomers at the top of the pentamer. Region
I mutants share a common phenotype at the nonpermissive temperature: a defect in assembly leading to the
accumulation of intermediates of heterogeneous size
(100–160S) carrying substantial amounts of Vp1 (Table1)
(Bina et al. 1983a,b; Blasquez et al. 1983).
Given the conserved phenotype and spatial clustering
of the Region I mutations, the structural basis for the
assembly defect is likely to have the same origin:
compromised pentamer–pentamer contacts that are mediated by the proximal part of the invading arm. In 11 out
JOBNAME: PROSCI 15#9 2006 PAGE: 3 OUTPUT: Monday August 7 17:23:32 2006
csh/PROSCI/118160/ps0621956
SV40 intracistronic complementation
Table 1. Location of ts mutations on the Vp1 secondary and tertiary structure and their reported assembly intermediates
ts Mutant
C260d
C1641
B228
B218
B204, 211,265
B8e
B8e
B1640
B1606
B1603
B221
B201
BC1602,1607
BC223
B4
BC1605
C219
C240
C260d
BC208, 214,216,217,248,274
BC11
Residue/substitutiona
Structural elementb
Structural region
Assembly intermediate (S)c
Gly40 Glu1
Val47 Met2
Gln54 Lys1
Pro58 Arg1
Ala71 Val1
Ala71 Thr1
Glu83 Asp1
His136 Tyr2
Gly139 Asp2
Ser 147 Leu2
Gly163 Ala1
Ala166 Thr1
Thr170 Ile2
His193 Tyr1
Ala195 Val1
Asp200 Asn2
Pro212 Ser1
Leu244 Ile1
Pro252 Leu1
Pro283 Ser1
Lys287 Thr1
AB
B
BC1
BC1
BC2
BC2
BC2
DE
DE
DE
E9
E9E0
E9E0
E0
E0
E99E999
E999F
G2
G2
I
I
II
II
I
I
I
I
I
I
I
I
I
I
I
I
I
I
II
II
II
I
II
75
ND
100/160
100/160
100/160
ND
ND
ND
ND
ND
ND
100/160
ND
100/160
ND
ND
75
75
75
100/160
75
The nomenclature used is the same as that in Liddington et al. (1991) and Stehle and Harrison (1997).
a
Amino acid substitutions determined by Behm et al. (1988),1 or in this study.2
b
Secondary structural elements of a monomer are labeled: (b-strands) B, E9, E0, G2, and I; (loops) AB, BC1, BC2, DE, E9E0, E0E999, and E999F.
c
Types of assembly intermediates found at nonpermissive temperature, S, Svedberg value. (From Garber et al. 1978, 1980; Bina et al. 1983a,b; Blasquez
et al. 1983; Ng and Bina 1984.)
d
ts C260 has two amino acid substitutions.
e
ts B8 has two amino acid substitutions.
ND, Not known.
of 14 cases, this appears to be fairly direct, while in three
other cases we surmise that the effect is mediated through
a more global effect on pentamer integrity. The presence
of substantial amounts of capsid proteins in the assembly
intermediates suggests that the initial interaction of
pentamers with Vp3 and the minichromosome, as well
as cross-linking of the distal part of the invading arms
with the clamp and Ca2+ binding sites, can proceed with
some efficiency. However, we suggest that subsequent
steps in assembly, which require correct choices among
twofold and threefold subassemblies, are compromised.
The Ca2+ binding sites and distal C-arm interactions are
required for the initiation of minichromosome packaging
Region II mutations cluster at the base of the pentamer:
the region includes the clamp for the distal part of the Carm, the two Ca2+ binding sites that cross-link arms from
three pentamers, and residues that lie between the Ca2+
sites and the Vp3 binding surface (Figs. 1, 2). Region II
mutants comprise all four ts C mutants and one of the ts
BC mutants (at Lys 287) (Table 1). Assembly intermediates of three out of the four ts C mutants and the ts BC
mutant have been reported: they all have a severe assembly defect with few viral proteins attached to the mini-
chromosome (Table 1; Garber et al. 1978, 1980; Bina
et al. 1983a,b; Ng and Bina 1984). Closer inspection of
the mutants shows that some are clearly predicted to
disturb salt bridges that maintain the integrity of the Ca2+
binding sites (Fig. 2). This is consistent with our previous
finding that mutations of Ca2+-coordinating residues can
profoundly affect particle assembly (Li et al. 2003).
For other region II mutations, notably at Leu 244 and
Pro 252, it is possible that the assembly defects arise from
disturbing the interaction with Vp3 (Fig. 2). Leu 244 and
Pro 252 are on the G strand, and orient a small sevenamino acid loop, colored green in Figure 2; two such
loops, from neighboring Vp1 monomers within the
pentamer, make contact with the two ends of the Vp3
helix. The mutations may dislocate these loops, affecting
the Vp1–Vp3 interaction. However, Leu 244 also packs
against Pro 252, which in turn, packs against the loop
containing the Site II Ca2+ coordinating residue, Glu 157,
whose integrity influences virion assembly (Li et al.
2003). We therefore cannot distinguish between these
two sources of the assembly defect by simple inspection
of the structure. However, we have studied the role of
Vp3 in virion formation by mutating the Vp1–Vp3
contact sites predicted by our three-dimensional model
(see Materials and Methods), and shown that virion
www.proteinscience.org
2209
JOBNAME: PROSCI 15#9 2006 PAGE: 4 OUTPUT: Monday August 7 17:23:33 2006
csh/PROSCI/118160/ps0621956
Kasamatsu et al.
Figure 2. Close-up of the paired Ca2+ binding sites, I and II, at the
interface between two Vp1 monomers within a pentamer (in gray and
orange), an invading arm (marine blue), and Vp3 (in red). ts C mutants are
in green, and the ts BC mutant, Lys 287, is in blue. Primed numbers
indicate residues from a neighboring Vp1 within a pentamer. Two pairs of
ts C mutations, at L244 and P252, from neighboring Vp1 monomers,
contact either end of the VP3 helix. Ca2+ coordinating residues are in dark
gray. Underlined numbers indicate Ca2+ coordinating residues from the
invading arm. The two Ca2+ ions are shown as blue spheres. Vp3 residues
are circled.
Figure 1. Mapping of Vp1 ts mutants onto an SV40 pentamer. In the
center, a Vp1 pentamer is shown as a space-filling model with Vp1
monomers in different colors. A single invading arm from a neighboring
pentamer is in marine blue. The C-arms emanating from the central pentamer
are omitted for clarity. The upper zoom is a cutaway view of the upper part
of the pentamer, showing one Vp1 monomer as b-strands and loops (in gray).
The small ‘‘jelly-roll’’ domain is shown in a darker gray. All tsB (red) and
three tsBC (blue) mutation sites are shown. Mutations are predicted to disrupt
interactions with the proximal part of the invading arm (shown as a red
dotted line), either directly via destabilization of the acceptor groove created
by the packing of the small jelly-roll domain against the CHEF sheet of Vp1,
or indirectly, via a more global destabilization of the pentamer. There are no
tsC mutation sites in this region. The lower zoom shows a similar cutaway of
the lower part of the pentamer, with the invading C-arm in marine blue, tsC
mutation sites in green, and one tsBC mutation site (at K287) in blue. Primed
numbers indicate residues from a neighboring Vp1 within the pentamer.
There are no tsB mutations in this region. These mutations are predicted
to disrupt interactions between either the Ca2+ binding sites (white
arrow) and the C-arm or between the interior of the pentamer and Vp3
(see Fig. 2).
2210
Protein Science, vol. 15
Figs. 1,2 live 4/C
assembly can occur in the presence of small or negligible
amounts of Vp3 (Nakanishi et al. 2006). While this
preliminary result favors the notion that disruption of
the Ca2+ coordination sites has a greater effect on capsid
assembly than disruption of Vp1–Vp3 interactions, it
does not formally rule out the possibility that a dysfunctional (rather than absent) Vp1–Vp3 interaction could be
the cause of aberrant capsid assembly in the case of Leu
244 and Pro 252 mutations.
Given the consistent and severe assembly defects of the
Region II mutants, we speculate that pentamer–pentamer
cross-linking mediated by the distal parts of the invading
C-arms and the Ca2+ binding sites is a critical early step
in the addition of pentamers to the minichromosome.
Previous work from others has identified the importance
of calcium in stabilizing the structure of preassembled
particles (Brady et al. 1977; Christiansen et al. 1977;
Stehle et al. 1996). Furthermore, we have previously
described a Ca2+-coordinating mutant, E330K, which
forms particles but is unable to bind cells or penetrate
into the cytoplasm (Li et al. 2003), and proposed that the
substituted lysine makes salt bridges with the side chains
of the Ca2+-coordinating Glu 48 and Glu 216, thus
displacing the Ca2+ ion from site 1. We hypothesize that
the failure of this mutant to infect cells arises from its
inability to break this salt bridge. Therefore, our work
provides further support for the role of Ca2+ ions, both
JOBNAME: PROSCI 15#9 2006 PAGE: 5 OUTPUT: Monday August 7 17:23:51 2006
csh/PROSCI/118160/ps0621956
SV40 intracistronic complementation
their binding and release, in multiple steps of the viral
life cycle.
Structural basis for intracistronic complementation
The existence of two classes of mutants that are structurally
distinct and that influence virion assembly in distinct and
consistent ways may provide a rationale for the ability of
certain ts B and ts C mutants to complement each other.
Complementation analysis was established to facilitate the
genetic analysis of a number of ts mutants of SV40, and
revealed the presence of more than one complementation
group in genes that are expressed late in viral infection
(Tegtmeyer and Ozer 1971; Chou and Martin 1974). The two
complementation groups, ts B and ts C arise from mutations
in one gene (encoding Vp1), and thus complementation is
termed ‘‘intracistronic.’’ Such complementation occurs when
two mutants are introduced simultaneously into a cell and
allowed to replicate through multiple rounds of infection
(Tevethia et al. 1974, 1981; Tevethia and Ripper 1977;
Cosman and Tevethia 1981), enabling the mixing of mutants
Vp1 pentamers synthesized in the cytoplasm prior to transport into the nucleus. Complementation does not occur when
viral replication is limited to a single replication cycle at the
restrictive temperature (Tevethia et al. 1974, 1981; Tevethia
and Ripper 1977; Cosman and Tevethia 1981), since no such
mixing of mutant pentamers can occur. To provide a molecular rationale for this complementation, we examined the
relationship between pairs of mutants in which intracistronic
complementation has been documented (Table 2; Chou and
Martin 1974; Tevethia and Ripper 1977; Tevethia et al.
1981). We find that all known complementing pairs carry
amino acid substitutions in distinct structural regions (i.e.,
one in region I, the other in region II).
The simplest model of intracistronic complementation
is to postulate the assembly of heterotypic Vp1 pentamers
in the cytoplasm of coinfected cells prior to trafficking
to the nucleus; this would allow that a fraction of the
pentamer–pentamer contacts forming during capsid assembly contain a wild-type element in both the donor and
acceptor elements, which could be sufficient to promote
accurate assembly, presumably a highly cooperative process. We do not have direct evidence for or against the
formation of such heterotypic pentamers, although we
note that complementation occurring between two separate gene products has been previously observed for
SV40, that of Vp1 and a mutant Vp3, in which a functional Vp1 nuclear localization signal promotes nuclear
entry of the mutant Vp3 via a heterotypic Vp1–Vp3
complex (Ishii et al. 1994). If pentamers are homotypic,
then the intracistronic complementation model needs to
be more sophisticated, and dependent on the details of the
assembly process (which have not been fully elucidated),
and thus we can only speculate at this point. One
Table 2. Vp1 structural region and intracistronic
complementation
Structural
region
ts Mutant
(mutation)
Structural
region
B228 (E54K)
I
B218 (P58R)
I
B204, 211, 265 (A71V)
I
B8 (A71T, E83D)
B1640 (H136Y)
B1606 (G139D)
B1603 (S147L)
B221 (G163A)
I
I
I
I
I
B201 (A166T)
I
C219 (P212S)
C240 (L244I)
C260 (G40E, P252L)
C219
C240
C260
C219
C240
C260
C1641 (V47M)
C219
C219
C219
C219
C240
C260
C219
C240
C260
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
ts Mutant (mutation)
Complementing pairs are from Chou and Martin (1974), Tevethia and
Ripper (1977), and Tevethia et al. (1981). ts mutants listed on the left
column with amino acid substitution in parentheses complement ts mutants
listed on the right column.
possibility is that if, as has been proposed (Liddington
et al. 1991), assembly is initiated by a series of ‘‘five
pentamers around one’’ subassemblies, it is possible to
envision five region II pentamers making initial crosslinks around a central region I pentamer via its wild-type
Ca2+ binding sites; lateral interactions between the five
region II pentamers (involving wild-type interactions with
the proximal parts of the invading arms) might then be
sufficient to generate a subassembly with the correct
curvature; 12 such subassemblies might then complete the
capsid.
Materials and methods
PCR amplification
Most ts mutations have been mapped to specific regions of the
viral genome by rescuing each mutation with certain restriction
endonuclease fragments of the wild-type DNA (Lai and Nathans
1974, 1975). The sequence alterations of 20 mutants have been
identified by Bina and colleagues (Behm et al. 1988). Mutations
in ts B1602, ts B1603, ts BC1605, ts BC1606, ts BC1607,
ts BC1640, and ts C1641 were determined in this study. The
wild-type F fragment from HindII–HindIII digestion can rescue
the ts phenotypes of all but ts BC1605 and ts C1641. ts C1641
can be rescued by the wild-type K fragment (Tevethia et al.
1981). For sequence determination PCR amplification was
performed in a GeneAmp PCR System 9700 (Perkin-Elmer)
using ;30–50 ng of the mutant DNAs (0.014–0.026 mg/mL,
stored at –20°C) as template DNA. Herculase DNA polymerase
www.proteinscience.org
2211
JOBNAME: PROSCI 15#9 2006 PAGE: 6 OUTPUT: Monday August 7 17:23:52 2006
csh/PROSCI/118160/ps0621956
Kasamatsu et al.
(Stratagene) and 2 mM dNTPs were used. The initial denaturation was performed at 92.0°C for 2 min, followed by 30 cycles
of the following: 92.0°C for 30 sec, renaturation at 55.0°C for
30 sec, and extension for 1 min at 72°C, with the final extension
at 72°C for 10 min. The reaction was done in triplicates for
assurance of the nucleotide alteration. For ts C1641, a Hirt
lysate of cells infected with the mutant was used as the template.
For ts B1602, ts B1603, ts BC1606, ts BC1607, and ts BC1640,
the following two primer pairs were used: forward 59 1623–1641
(CTGGAGTAGACAGCTTCAC) and reverse 59 2182–2163
(TGTGTAGGTTCCAAAATATCTA), and forward 59 1567–
1581 (AGTGCAAGTGCCAAA) and reverse 59 2666–2652
(CTTGTTTATTGCAGC). The first primer set was used initially
to amplify just the F region, while the second primer set amplified a larger region including the F fragment, yielding equivalent levels of amplification. Sequencing of the PCR products
was performed as instructed by Laragen using 59 1567–1581
(AGTGCAAGTGCCAAA) and 59 2188–2163 (CCCACCTGTG
TAGGTTCCAAAA). For ts BC1605 and ts C1641, the entire
Vp1 gene was amplified using forward 59 1320–1339 (CAGTA
TTCAGCAAGTAACTG) and reverse 59 2666–2652 primers,
followed by sequencing using 59 1320–1339 for ts C1641 and
59 2671–2652 (GTTAACTTGTTTATTGCAGC) for ts B1605.
A homology model of the SV40 Vp1
pentamer–Vp3 complex
The crystal structure of the polyomavirus Vp1 pentamer–Vp3
complex is known (Chen et al. 1998), and the structure of SV40
and polyomavirus pentamers are well conserved (Liddington
et al. 1991; Stehle et al. 1994, 1996). Based on these structures
(PDB codes 1CN3 and 1SVA) we built a homology model in the
following way. The polyoma complex was superimposed onto
the Vp1 pentamer of SV40 by overlaying the Ca positions of the
b-sheets of Vp1 (the backbone can be superimposed with a rootmean-square deviation of ;0.5 Å). The ordered region of Vp3
observed in the polyoma structure (151–187) is highly conserved within SV40 Vp3 (154–187), and the side chains with
library torsion angles were replaced with their SV40 counterparts using TURBO-FRODO. In this model, the first ordered
residue of the Vp3 fragment is Phe 157. Phe 157 and Ile 158
nestle into the hydrophobic neck at the top of the conical interior
of one Vp1 pentamer. Residues upstream of Phe 157 may extend
through the neck and be exposed on the surface of the virion, or
fold back toward the base of the Vp1 pentamer, as suggested by
Chen et al. (1998). Residues Pro 164, Gly 165, and Gly 166
form a tight turn where they pack into a crevice between the two
main b-sheets of Vp1. Residues Trp 175 through Tyr 184 form
a hydrophobic a-helix at the base of the pentamer. Vp3 residues
Leu 177 and Leu 181 make hydrophobic contacts with Vp1
residues Val 243 and Leu 245, respectively. Based on this model
we altered Vp3 residues (Phe 157, Ile 158, Pro 164, Gly 165,
Gly 166, Leu 177, and Leu 181) and Vp1 residues (Val 243 and
Leu 245), and determined the effect of substitutions on the Vp1–
Vp3 interaction and on infectivity of the mutant particles to the
new host. The mutations either reduced or eliminated the
incorporation of minor capsid proteins into mutant particles.
The loss of minor capsid proteins in the particles accompanied
the reduction in viability, and the particles with no detectable
Vp3 were nearly noninfectious (Nakanishi et al. 2006), indicating that the SV40 homology model constructed here
reflects the Vp1–Vp3 interaction occurring in vivo. The Vp1–
Vp3 complex was built and inspected using TURBO-FRODO
(http://afmb.cnrs-mrs.fr/rubrique113.html). Figures were made
2212
Protein Science, vol. 15
using PyMOL Molecular Graphics System (DeLano 2002,http://
www.pymol.org). The model of the Vp1–Vp3 complex, as well
as a detailed description of the environments of all the mutations
sites, is available from the corresponding author on request.
Acknowledgments
We thank Margaret Kowalczyk Wright and Kosi Gramatikoff for
help with illustrations, Peggy Li for stimulating discussion, and
Peony Liu for editorial help. This work was supported by Public
Health Service Grants CA50574 to H.K., CA24694 to M.J.T.,
and CA30199 to R.C.L. from the NIH.
References
Baumgartner, I., Kuhn, C., and Fanning, E. 1979. Identification and characterization of fast-sedimenting SV40 nucleoprotein complexes. Virology 96:
54–63.
Behm, M., Lowman, H., Ng, S.C., and Bina, M. 1988. Analysis of temperaturesensitive mutations in the simian virus 40 gene encoding virion protein 1.
Proc. Natl. Acad. Sci. 85: 9421–9425.
Bina, M., Blasquez, V., Ng, S.C., and Beecher, S. 1983a. SV40 morphogenesis.
Cold Spring Harb. Symp. Quant. Biol. 47: 565–569.
Bina, M., Ng, S.C., and Blasquez, V. 1983b. Simian virus 40 chromatin
interaction with the capsid proteins. J. Biomol. Struct. Dyn. 1: 689–704.
Blasquez, V., Beecher, S., and Bina, M. 1983. Simian virus 40 morphogenetic
pathway. An analysis of assembly-defective tsB201 DNA protein complexes. J. Biol. Chem. 258: 8477–8484.
Brady, J.N., Winston, V.D., and Consigli, R.A. 1977. Dissociation of polyoma
virus by the chelation of calcium ions found associated with purified
virions. J. Virol. 23: 717–724.
Caspar, D.L. and Klug, A. 1962. Physical principles in the construction of
regular viruses. Cold Spring Harb. Symp. Quant. Biol. 27: 1–24.
Chen, X.S., Stehle, T., and Harrison, S.C. 1998. Interaction of polyomavirus
internal protein VP2 with the major capsid protein VP1 and implications for
participation of VP2 in viral entry. EMBO J. 17: 3233–3240.
Chou, J.Y. and Martin, R.G. 1974. Complementation analysis of simian virus 40
mutants. J. Virol. 13: 1101–1109.
———. 1975. Products of complementation between temperature-sensitive
mutants of simian virus 40. J. Virol. 15: 127–136.
Christiansen, G., Landers, T., Griffith, J., and Berg, P. 1977. Characterization of
components released by alkali disruption of simian virus 40. J. Virol. 21:
1079–1084.
Coca-Prados, M. and Hsu, M.T. 1979. Intracellular forms of simian virus 40
nucleoprotein complexes. II. Biochemical and electron microscopic analysis of simian virus 40 virion assembly. J. Virol. 31: 199–208.
Cosman, D.J. and Tevethia, M.J. 1981. Characterization of a temperaturesensitive, DNA-positive, nontransforming mutant of simian virus 40.
Virology 112: 605–624.
Dubbs, D.R., Rachmeler, M., and Kit, S. 1974. Recombination between
temperature-sensitive mutants of simian virus 40. Virology 57: 161–174.
Fanning, E. and Baumgartner, I. 1980. Role of fast-sedimenting SV40
nucleoprotein complexes in virus assembly. Virology 102: 1–12.
Fernandez-Munoz, R., Coca-Prados, M., and Hsu, M.T. 1979. Intracellular
forms of simian virus 40 nucleoprotein complexes. I. Methods of isolation
and characterization in CV-1 cells. J. Virol. 29: 612–623.
Garber, E.A., Seidman, M.M., and Levine, A.J. 1978. The detection and
characterization of multiple forms of SV40 nucleoprotein complexes.
Virology 90: 305–316.
———. 1980. Intracellular SV40 nucleoprotein complexes: Synthesis to
encapsidation. Virology 107: 389–401.
Ishii, N., Nakanishi, A., Yamada, M., Macalalad, M.H., and Kasamatsu, H.
1994. Functional complementation of nuclear targeting-defective mutants
of simian virus 40 structural proteins. J. Virol. 68: 8209–8216.
Jakobovits, E.B. and Aloni, Y. 1980. Isolation and characterization of various
forms of simian virus 40 DNA–protein complexes. Virology 102: 107–118.
La Bella, F. and Vesco, C. 1980. Late modifications of simian virus 40
chromatin during the lytic cycle occur in an immature form of virion.
J. Virol. 33: 1138–1150.
Lai, C.J. and Nathans, D. 1974. Mapping temperature-sensitive mutants of
simian virus 40: Rescue of mutants by fragments of viral DNA. Virology
60: 466–475.
JOBNAME: PROSCI 15#9 2006 PAGE: 7 OUTPUT: Monday August 7 17:23:53 2006
csh/PROSCI/118160/ps0621956
SV40 intracistronic complementation
———. 1975. A map of temperature-sensitive mutants of simian virus 40.
Virology 66: 70–81.
———. 1976. The B/C gene of simian virus 40. Virology 75: 335–345.
Li, P.P., Naknanishi, A., Tran, M.A., Ishizu, K., Kawano, M., Phillips,
M., Handa, H., Liddington, R.C., and Kasamatsu, H. 2003. Importance of
Vp1 calcium-binding residues in assembly, cell entry, and nuclear entry of
simian virus 40. J. Virol. 77: 7527–7538.
Liddington, R.C., Yan, Y., Moulai, J., Sahli, R., Benjamin, T.L., and
Harrison, S.C. 1991. Structure of simian virus 40 at 3.8-Å resolution.
Nature 354: 278–284.
Mertz, J.E. 1984. A detailed genetic analysis of the late complementation
groups of simian virus 40. Virology 132: 173–185.
Nakanishi, A., Nakamura, A., Liddington, R., and Kasamatsu, H. 2006.
Identification of amino acid residues within simian virus 40 capsid proteins
Vp1, Vp2 and Vp3 that are required for their interaction and for viral
infection. J. Virol. (in press).
Ng, S.C. and Bina, M. 1984. Temperature-sensitive BC mutants of simian virus
40: Block in virion assembly and accumulation of capsid–chromatin
complexes. J. Virol. 50: 471–477.
Noonan, C.A. and Butel, J.S. 1978. Temperature-sensitive mutants of simian
virus 40 I. Isolation and preliminary characterization of B/C gene mutants.
Intervirology 10: 181–195.
Rayment, I., Baker, T.S., Caspar, D.L., and Murakami, W.T. 1982. Polyoma
virus capsid structure at 22.5 Å resolution. Nature 295: 110–115.
Robb, J.A., Tegtmeyer, P., Ishikawa, A., and Ozer, H.L. 1974. Antigenic
phenotypes and complementation groups of temperature-sensitive mutants
of simian virus 40. J. Virol. 13: 662–665.
Salunke, D.M., Caspar, D.L., and Garcea, R.L. 1986. Self-assembly of purified
polyomavirus capsid protein VP1. Cell 46: 895–904.
Stehle, T. and Harrison, S.C. 1997. High-resolution structure of a polyomavirus
VP1-oligosaccharide complex: Implications for assembly and receptor
binding. EMBO J. 16: 5139–5148.
Stehle, T., Yan, Y., Benjamin, T.L., and Harrison, S.C. 1994. Structure of
murine polyomavirus complexed with an oligosaccharide receptor fragment. Nature 369: 160–163.
Stehle, T., Gamblin, S.J., Yan, Y., and Harrison, S.C. 1996. The structure of
simian virus 40 refined at 3.1 Å resolution. Structure 4: 165–182.
Tegtmeyer, P. and Ozer, H.L. 1971. Temperature-sensitive mutants of simian
virus 40: Infection of permissive cells. J. Virol. 8: 516–524.
Tevethia, M.J. and Ripper, L.W. 1977. Biology of simian virus 40
(SV40) transplantation antigen (TrAg) II. Isolation and characterization
of additional temperature-sensitive mutants of SV40. Virology 81: 192–211.
Tevethia, M.J., Ripper, L.W., and Tevethia, S.S. 1974. A simple qualitative spot
complementation test for temperature-sensitive mutants of SV40. Intervirology 3: 245–255.
Tevethia, M.J., Slippey, A.E., and Cosman, D.J. 1981. Mapping of additional
temperature-sensitive mutations (1600 series) on the genome of simian
virus 40 by marker rescue. Virology 112: 789–794.
www.proteinscience.org
2213