Download document 8294305

Chapter 2
The Prc and RseP proteases control
bacterial Cell-Surface Signalling
activity
Karlijn C. Bastiaansen1,2, Aurelia Ibañez1, Juan L. Ramos1,
Wilbert Bitter2, and María A. Llamas1
Department of Environmental Protection, Estación Experimental del
Zaidín-Consejo Superior de Investigaciones Científicas, C/ Profesor
Albareda 1, 18008 Granada, Spain; and 2Section of Molecular
Microbiology, Department of Molecular Cell Biology, VU University
Amsterdam, De Boelelaan 1085, 1081HV Amsterdam, the
Netherlands.
1
Published as:
Bastiaansen, K.C., Ibañez, A., Ramos, J.L., Bitter, W., and Llamas, M.A.
(2014) The Prc and RseP proteases control bacterial cell-surface
signalling activity. Environmental Microbiology 16: 2433-2443.
24
|
Chapter 2
Summary
Extracytoplasmic function (ECF) sigma factors play a key role in the regulation of vital
functions in the bacterial response to the environment. In Gram-negative bacteria, activity
of these sigma factors is often controlled by cell-surface signalling (CSS), a regulatory
system that also involves an outer membrane receptor and a transmembrane anti-sigma
factor. To get more insight into the molecular mechanism behind CSS regulation, we have
focused on the unique Iut system of Pseudomonas. This system contains a hybrid protein
containing both a cytoplasmic ECF sigma domain and a periplasmic anti-sigma domain,
apparently leading to a permanent interaction between the sigma and anti-sigma factor.
We show that the Iut ECF sigma factor regulates the response to aerobactin under iron
deficiency conditions and is activated by a proteolytic pathway that involves the sequential
action of two proteases: Prc, which removes the periplasmic anti-sigma domain, and RseP,
which subsequently removes the transmembrane domain and thereby generates the ECF
active transcriptional form. We furthermore demonstrate the role of these proteases in
the regulation of classical CSS systems in which the sigma and anti-sigma factors are two
different proteins.
Prc and RseP proteases control CSS
|
25
Introduction
Regulation of gene expression is an essential mechanism that allows bacteria to
rapidly adapt to alterations in their environment. Gene expression in bacteria is mainly
controlled at the level of transcription initiation. To achieve this control a number of
different mechanisms have evolved, one of which is the utilization of alternative sigma
factors. Sigma factors are small proteins that associate with the RNA polymerase core
(RNAPc) enzyme and direct it to specific promoter sequences, thereby initiating gene
transcription. All bacteria contain a constitutively expressed primary sigma factor (σ70),
which is responsible for the transcription of essential housekeeping genes. Moreover,
most bacteria also encode alternative sigma factors, which recognize alternative promoter
consensus sequences (Paget and Helmann, 2003). The activity of these alternative sigma
factors is transcriptionally and/or posttranslationally controlled in response to specific
environmental signals. The largest group of alternative sigma factors includes the so-called
extracytoplasmic function (ECF) sigma factors (Lonetto et al., 1994; Bastiaansen et al.,
2012). Most ECF sigma factors are co-transcribed with an anti-sigma factor that controls the
activity of the sigma factor posttranscriptionally. In Gram-negative bacteria, the anti-sigma
factors are usually transmembrane proteins that contain a large periplasmic C-terminal
domain and a short cytoplasmic N-terminal region that binds and sequesters the sigma
factor in absence of the stimulus. A special subclass of ECF sigma factors is formed by
the iron starvation group. Expression of these sigma factors is usually controlled by iron
through the Fur protein. In iron sufficient conditions the Fur-Fe2+ protein complex binds
to the Fur box in the promoter region of these sigma factor genes leading to repression of
their expression. This binding, and thus repression, is removed in iron deficient conditions
when Fur is no longer loaded with iron ions (Escolar et al., 1999). Iron starvation ECF
sigma factors usually regulate the (siderophore-mediated) uptake of iron (Staroń et al.,
2009; Bastiaansen et al., 2012) via a regulatory cascade that involves not only the ECF
sigma and anti-sigma factors but also a specific outer membrane receptor. Together, these
three proteins form the so-called cell-surface signalling (CSS) regulatory system (Braun
et al., 2006; Llamas and Bitter, 2010). The CSS outer membrane receptors belong to the
family of TonB-dependent receptors and they have a dual role: they participate both in
signal transduction and in siderophore uptake. Siderophores are produced and secreted
by most bacteria under low iron conditions to sequester and solubilize minute quantities
of iron present in the environment. In addition, bacteria can use siderophores produced
by other organisms, referred to as heterologous siderophores, and host iron complexes
(i.e. transferrin, lactoferrin, haem or haemoglobin), as iron sources (Wandersman and
Delepelaire, 2004). After binding iron, these iron-siderophore/haemophore complexes are
recaptured by the bacterium through TonB-dependent receptors. However, not all TonBdependent receptors are involved in CSS, only a subfamily known as TonB-dependent
transducers (Koebnik, 2005). This subfamily can be easily distinguished from other TonBdependent receptors on the basis of an N-terminal extension of approximately 70-80
amino acids (Schalk et al., 2004). This periplasmic extension interacts with the C-terminal
domain of the anti-sigma factor, but has no effect on the recognition and transport of
the siderophore (Koster et al., 1994). Binding of the environmental signal (i.e. ironsiderophore) to the outer membrane receptor activates the CSS pathway, which ultimately
leads to the activation of the ECF sigma factor and thereby to the transcription of a small
number of genes, usually including the one encoding the TonB-dependent transducer
2
26
|
Chapter 2
(Llamas et al., 2006; Llamas et al., 2008). However, the exact mode of action of CSS is
not completely understood. To get more insight into the mechanism of CSS ECF sigma
factor activation, we have focused on a unique, newly identified, CSS ECF sigma factor of
Pseudomonas putida. This sigma factor consists of a hybrid gene that seems to code for a
natural chimeric protein, combining both an ECF sigma factor and an anti-sigma factor
in a single polypeptide (Fig. 1A and S1). Our experiments show that this CSS ECF sigma
factor is functional and regulates the uptake of the heterologous siderophore aerobactin.
Activation of this ECF sigma factor occurs via a proteolytic cascade that involves both the
Prc and RseP proteases. We also demonstrate that these proteases are involved in the
regulation of classical CSS systems in which the ECF sigma and anti-sigma factors are two
different proteins, showing the general role of these proteases in CSS activity. In addition,
our results suggest that besides cleavage by Prc and RseP other proteases are involved in
the activation of classical CSS systems.
Results
Identification and analysis of a P. putida hybrid gene encoding both a sigma and an
anti-sigma domain.
In silico analysis of ECF sigma factors and cell-surface signalling (CSS) systems of P. putida
KT2440 revealed the presence of a unique hybrid gene (PP2192) combining a cytoplasmic
ECF sigma factor domain in the N-terminal part and a periplasmic anti-sigma factor domain,
separated by a single transmembrane (TM) domain (Koebnik, 2005; Llamas and Bitter,
2010) (Fig. 1A and S1). This hybrid sigma/anti-sigma factor gene is located next to a gene
(PP2193) putatively encoding a TonB-dependent transducer. We first wanted to determine
whether this unique sigma/anti-sigma hybrid gene was coding for a functional protein. By
analogy with other CSS systems (Llamas et al., 2006; Llamas et al., 2008) we hypothesized
that PP2192 would regulate the expression of the PP2193 transducer and constructed a
PP2193::lacZ transcriptional fusion to test PP2192 activity. Since overexpression of ECF
Figure 1. The P. putida PP2192
hybrid sigma/anti-sigma protein.
(A) Schematic representation of the
protein domains of PP2192. The
length of the K1 to K3 constructs
is indicated as well as the
insertion point of the miniTn5-Km in
the iutY-Tn5 mutant. (B) Analysis of
PP2192 activity by β-galactosidase
assay. P. putida KT2440 (wildtype) cells bearing both the pMPK4
plasmid (PP2193::lacZ fusion) and
the pMMB67EH-derivated plasmids
pMMBK1, pMMBK2 or pMMBK3 were
grown 16h in LB with and without 1
mM IPTG (to induce expression of the
cloned genes from the Ptac promoter
by removing the repression exerted
by the LacIq repressor present in the
plasmid). Sequence-based topology
of the different PP2192 fragments
overexpressed from pMMB67EH (K1
to K3) is shown above the graph. P,
periplasm; CM, cytoplasmic membrane; C, cytoplasm.
Prc and RseP proteases control CSS
|
sigma factors usually leads to the expression of the ECF-regulated genes (Llamas et al.,
2006; Llamas et al., 2008), we analyzed PP2192 functionality by overexpressing PP2192
from a constitutive promoter (i.e. the Ptac promoter). Overexpression of the entire
PP2192 gene (K1 construct) increased PP2193 promoter activity ~10-fold, indicating that
PP2192 indeed encodes a functional protein with sigma factor activity (Fig. 1B). Activity
of PP2192 is already quite high in absence of IPTG, this is probably due to the leakiness
of the Ptac promoter allowing enough expression to measure β-galactosidase levels. Since
the anti-sigma domain of the PP2192 protein could inactivate the function of the cytosolic
ECF sigma factor domain, we tested the activity of two fragments of PP2192 of different
length by insertion of premature stop codons (Fig. 1A and S1B). Overexpression of only the
cytosolic ECF sigma factor domain of PP2192 (K2 construct) resulted in a large increase
in PP2193 expression (~200-fold, Fig. 1B), confirming the role of the C-terminal domain
of PP2192 as an anti-sigma factor. The other construct (K3), containing the ECF sigma
factor domain and the TM region, still increased PP2193 expression ~100-fold (Fig. 1B),
suggesting that the TM domain is not required for anti-sigma activity. These results show
that PP2192 is an active protein and that the C-terminal periplasmic anti-sigma domain
has to be removed for full activity.
The heterologous siderophore aerobactin induces this unusual CSS system.
Since a putative Fur box is present in the PP2192 promoter region (Fig. S2), we hypothesized
that this CSS system would be involved in the regulation of iron uptake. Moreover, the
PP2193 protein sequence has high sequence similarity with the aerobactin receptor IutA
of both Escherichia coli and P. aeruginosa (de Lorenzo et al., 1986; Cuív et al., 2006), and
it is known that P. putida is able to use the heterologous siderophore aerobactin to obtain
iron (Loper and Henkels, 1999). This prompted us to investigate whether aerobactin
could act as the inducing signal for the PP2192-PP2193 CSS system. Indeed, addition of
the supernatant of an iron-restricted culture of the aerobactin producing strain E. coli
C600 (ColV-K30), but not that of the control strain without the aerobactin biosynthetic
genes (de Lorenzo et al., 1986), resulted in high expression from the PP2193 promoter in
low iron conditions (Fig. 2). Addition of purified aerobactin to the medium also induced
PP2193 expression, confirming that it acts as the inducing signal for this unusual CSS
system (Fig. 2). Addition of iron to the medium inhibited PP2193::lacZ activity, showing
that both low iron and the siderophore are needed for activity (Fig. 2). Together these
results demonstrate that PP2193 expression is activated by the heterologous siderophore
aerobactin. By analogy with the E. coli aerobactin receptor, we propose to name the P.
putida PP2193 TonB-dependent receptor IutA and the PP2192 sigma/anti-sigma protein
IutY. To examine the role of the P. putida IutA and IutY proteins in the aerobactin-mediated
induction of iutA expression, we constructed null mutants and/or used miniTn5-Km
mutants derived from a transposon mutant library of P. putida KT2440 (Molina-Henares
et al., 2010). Deletion of the iutY gene (∆iutY mutant) abolished the response of P. putida to
aerobactin, showing that IutY is indeed required for iutA expression (Fig. 2). This mutation
could be fully complemented with the pMMBK1 plasmid containing the whole iutY gene
(Fig. 2). In fact, lacZ activity in response to aerobactin in the strains bearing this plasmid
was even higher, likely as a result of iutY overexpression. On the other hand, insertion of
the miniTn5-Km in the IutY C-terminal anti-sigma domain (after codon 256) (Fig. 1A and
S1B) leads to constitutive activity of IutY (Fig. 2), similar to the activity observed with the
K2 and K3 constructs (Fig. 1B). Insertion of a miniTn5-Km in the iutA gene results in a P.
27
2
28
|
Chapter 2
Figure 2. Identification of aerobactin as the inducing signal, and role of IutY and IutA in the
signalling pathway. β-galactosidase activity of P. putida KT2440 and the iutY-Tn5, ΔiutY and iutA-Tn5
mutants bearing the pMPK4 plasmid (iutA::lacZ fusion) and the pMMB67EH-derivate plasmids pMMBK1
or pMMB-iutA, from which the iutY or iutA gene is constitutively expressed. Strains were grown under
iron-restricted or iron-rich conditions without or with aerobactin containing supernatant, and/or
without or with 5 µM aerobactin.
putida mutant that is not able to respond to aerobactin (Fig. 2). Although Southern-blot
analysis showed that the transposon insertion was correct in this mutant (Fig. S3), the
mutation could, however, be only partially complemented with a plasmid bearing the full
iutA gene (Fig. 2). The response of the iutA-Tn5 mutant to aerobactin could also not be
restored by introducing the plasmid containing the whole iutY gene (Fig. 2), which shows
that IutA acts upstream IutY in the signalling pathway.
The RseP protease is required for activity of the Iut CSS system.
Our previous results showed that IutY sigma activity (σIutY) is induced by aerobactin
and that full activity is only obtained when removing (part of) the C-terminal antisigma domain of the IutY protein. This encouraged us to investigate whether proteolytic
activities were involved in the activation of σIutY. In E. coli and Pseudomonas aeruginosa
three proteases (namely RseP/MucP, DegS/AlgW and DegP) have been known to play a
role in the activation of stress-responsive ECF sigma factors (Bastiaansen et al., 2012), and
recently RseP has been shown to be involved in the activation of three CSS systems in P.
aeruginosa (Draper et al., 2011). Therefore, we decided to construct single knockouts and
check the function of these proteases. The ∆degP and ∆degS mutants responded similarly
to aerobactin as the wild-type strain (Fig. S4A), indicating that these proteases do not
play a role in the activation of σIutY. Interestingly, the deletion of the rseP gene completely
abolished the ability of P. putida to respond to aerobactin (Fig. 3A). This response was
restored when the ∆rseP mutation was complemented in trans (Fig. 3A).
The Prc protease is required for activity of the Iut CSS system.
Since RseP is a cytoplasmic membrane-located protease known to cleave transmembrane
domains of target proteins (Akiyama et al., 2004), we anticipated that another protease
might be responsible for the degradation of the periplasmic anti-sigma domain of IutY.
Therefore, we selected specific P. putida miniTn5-Km mutants from a library (MolinaHenares et al., 2010) with insertions in genes encoding putative proteases and tested in
Prc and RseP proteases control CSS
|
total 14 mutants with transposons inserted in 11 different loci (Table S1). This screening
identified a mutant with a transposon insertion in the PP1719 gene that did not respond to
aerobactin (Fig. S4B). PP1719 codes for the tail-specific protease Prc (also known as Tsp),
a periplasmic serine endoprotease that recognizes non-polar C-terminal ends of target
proteins (Silber et al., 1992; Keiler et al., 1995). This result was confirmed by constructing
a null P. putida prc mutant (∆prc mutant). Total removal of prc indeed abolished the
aerobactin-mediated expression of iutA (Fig. 3A). Complementation of the ∆prc mutation
with a plasmid in which the prc gene is constitutively expressed restored the ability of
P. putida to respond to aerobactin (Fig. 3A). Interestingly, constitutive expression of prc
causes expression from the iutA promoter even in the absence of aerobactin (Fig. 3A),
which shows that the Prc protease has a direct effect on the P. putida aerobactin-mediated
CSS pathway.
The Prc and RseP proteases sequentially process the IutY protein.
These results suggest that IutY is subjected to RseP- and Prc-mediated proteolysis. To
investigate this further we constructed an N-terminally HA-tagged IutY protein. The
addition of the HA-tag did not affect the ability of the protein to respond to aerobactin
Figure 3. Function of the Prc and RseP proteases in the P. putida Iut CSS system.
(A) β-galactosidase activity of P. putida KT2440 and its isogenic Δprc and ΔrseP
mutants, bearing the pMPK4 plasmid (iutA::lacZ fusion) and the complementation
construct pBBR-PPprc and pBBR-PPrseP or the original pBBR1MCS-5 plasmid. Strains
were grown under iron-restricted conditions without or with aerobactin containing
supernatant. (B) Prc- and RseP-mediated cleavage of the IutY protein. The
indicated strains, all containing the pMMBK1-HA plasmid, and the indicated pBBR1MCS-5
derivatives, were grown overnight under iron-restricted conditions without (-) or with
(+) aerobactin containing supernatant. Proteins were detected using a monoclonal antiHA-tag antibody. The positions of the molecular size marker (in kDa) and the IutY protein
fragments are indicated. UC, uncleaved; CL, cleaved.
29
2
30
|
Chapter 2
(Fig. S5). HA-IutY has a predicted molecular mass of 41 kDa and a protein band of this
molecular weight was detected in all strains and conditions tested (Fig. 3B). Interestingly,
an N-IutY sub-fragment of approximately 23 kDa was also detected. This band was
present in increased amounts in cells grown in the presence of aerobactin and/or cells
overexpressing prc (Fig. 3B). Importantly, this protein fragment was not detected in the
∆prc mutant (Fig. 3B). Since the presence of the N-terminal IutY 23 kDa sub-fragment
correlates with maximal expression from the iutA promoter (Fig. 3A), it is likely that this
fragment, which contains the σIutY domain, is the one binding to the RNAPc and initiating
iutA transcription. Western-blot analyses in the ∆rseP mutant showed the presence
of a new N-IutY subfragment of approximately ~25 kDa when ∆rseP was grown with
aerobactin (Fig. 3B). This fragment is slightly larger than the previously observed N-IutY
fragment (~23 kDa) and probably represents the sigma factor domain with (part of the)
TM domain. In contrast to overexpression of Prc, overexpression of rseP did not result
in constitutive iutA expression (Fig. 3A). Moreover, activity was also not detectable upon
overexpression of prc in the ∆rseP mutant (Fig. 3A). Together these results suggest that
RseP is involved in the proteolytic cascade, but acts after Prc. To determine if the P. putida
IutY site-2 cleavage site was indeed located within the TM domain, the IutY-K2 (without
TM domain) and IutY-K3 (with TM domain) (Fig. 1A and S1B) protein constructs were
N-terminally HA-tagged and expressed in the different P. putida strains (wild-type, ∆prc
and ∆rseP). Introduction of the HA-tag did not affect the activity of these proteins (Fig.
S5). Expression of the HA-IutY-K2 construct resulted in the appearance of a single protein
band of ~21 kDa in all strains (Fig. 4). The size of this protein band corresponds to the
expected size of the complete HA-tagged IutY-K2 protein and is smaller than the natural
cleavage product of IutY (~23 kDa), indicating that the IutY-K2 protein is not subjected to
proteolysis. However, expression of the HA-IutY-K3 construct resulted in the production
of two protein bands in the wild-type strain and the ∆prc mutant upon induction with
aerobactin (Fig. 4). The upper band (~24.5 kDa) corresponds to the predicted size of the
full HA-tagged IutY-K3 protein (uncleaved, UC), whereas the lower band corresponds to
the N-IutY cleaved subfragment of ~23 kDa (Fig. 4). Importantly, only the upper band was
detected in the ∆rseP mutant, showing that the IutY-K3 protein is cleaved by RseP. These
results strongly suggest that the RseP site-2 cleavage of IutY, which produces an active
σIutY protein, occurs in the region comprising the K2 and K3 IutY-derivative proteins, and
therefore within or near the IutY TM domain (Fig. 1A and S1B).
Figure 4. Mapping the site2 RseP cleavage of IutY. The
indicated strains bearing the
pMMBK1-HA,
pMMBK2-HA
or pMMBK3-HA plasmids
were grown in iron-restricted
medium with aerobactin
containing supernatant and
1 mM IPTG. Proteins were
detected using a monoclonal
anti-HA-tag antibody. The
positions of the molecular
size marker (in kDa) and the
IutY protein fragments are
indicated. UC, uncleaved; CL,
cleaved.
Prc and RseP proteases control CSS
|
The Prc and RseP proteases are involved in the activation of other P. putida CSS
regulatory pathways.
To investigate whether the Prc and RseP proteases play a more general role in CSS
regulation in P. putida, we analyzed the effect of the prc and rseP mutations on the predicted
ferrioxamine (PP0160-PP0162) and ferrichrome (PP0350-PP0352) CSS pathways (Llamas
and Bitter, 2010). To check the activity of these P. putida CSS systems, first the promoter
region of the putative ferrioxamine and ferrichrome TonB-dependent outer membrane
transducers (PP0160-FoxA and PP0350-FiuA, respectively) was placed in front of a
promoterless lacZ reporter gene. Measurement of the activity of these constructs showed
that their expression was indeed induced by ferrioxamine and ferrichrome, respectively
(Fig. 5A and S6). To confirm that PP0160-FoxA and PP0350-FiuA are the receptors of
these signalling pathways, the lacZ activity was also measured in miniTn5-Km mutants
in these genes. As expected, activity of the foxA::lacZ and fiuA::lacZ transcriptional fusions
was completely abolished in their respective receptor mutants (foxA-Tn5 and fiuA-Tn5)
(Fig. 5A), which shows that these genes encode functional P. putida outer membrane
transducers similar to their orthologues in P. aeruginosa (Llamas et al., 2006). Importantly,
the activity of these transcriptional fusions in presence of their inducing siderophore was
significantly reduced in the ∆prc mutant and completely abolished in the ∆rseP mutant
(Fig. 5A), whereas it was not affected in the ∆degP and ∆degS mutants (S6A). Both the
prc and rseP mutations could be complemented by introducing an intact copy of these
genes (Fig. S6B). Together these results confirm the involvement of both proteases in the
activation of the P. putida ferrioxamine and ferrichrome CSS pathways and their general
role in the regulation of CSS systems in this bacterium.
Role of Prc and RseP proteases in CSS regulation of other bacteria.
Next, we analyzed whether the two identified proteases were involved in CSS regulation
in another bacterial species. Therefore, we made prc and rseP deletion mutants in P.
aeruginosa. P. aeruginosa foxA::lacZ and fiuA::lacZ transcriptional fusions (Llamas et al.,
2006) were used to check the response of these mutants to the siderophores. As shown
in Figure 5B, lacZ expression from the foxA and fiuA promoters was strongly induced by
ferrioxamine and ferrichrome, respectively, in the PAO1 wild-type strain. However, this
induction was significantly lower in the ∆prc mutant of P. aeruginosa (Fig. 5B), similar to
the effect observed with the ∆prc mutant of P. putida (Fig. 5A), and completely abolished in
the P. aeruginosa ∆rseP mutant as recently described by Draper et al. (Draper et al., 2011).
These results imply a requirement for Prc and confirm the role of RseP in the activity of
these P. aeruginosa CSS pathways, indicating that both these proteases have a broad role
in bacterial CSS regulation.
Discussion
Cell-surface signalling (CSS) is an important mechanism used by Gram-negative bacteria
to respond to the environment by translating a specific extracellular signal into a
cytoplasmic regulatory response. The importance of CSS lies not only in its crucial role
in regulating a vital function such as iron uptake, but also in controlling the expression
of virulence functions in response to pathogen’s hosts (Aldon et al., 2000; Llamas et al.,
2009). Previously it was hypothesized that conformational changes of the CSS proteins
were responsible for this signal transduction pathway (Braun et al., 2003). In this work
31
2
32
|
Chapter 2
Figure 5. Function of Prc and RseP
in the P. putida and P. aeruginosa
ferrioxamine- and ferrichromemediated
CSS
pathways.
β-galactosidase activity of (A) P. putida
KT2440 and its indicated isogenic
mutants bearing the pMP-PPfoxA
or pMP-PPfiuA plasmids (P. putida
foxA::lacZ and fiuA::lacZ transcriptional
fusions, respectively) and (B) P.
aeruginosa PAO1 and its isogenic
Δprc and ΔrseP mutants bearing the
pMPR8b or pMPFiuA plasmids (P.
aeruginosa foxA::lacZ and fiuA::lacZ
transcriptional fusions, respectively). The strains bearing the foxA::lacZ fusions were grown under ironrestricted conditions with 1 µM (for P. aeruginosa) or 5 µM (for P. putida) ferrioxamine, and the ones bearing
the fiuA::lacZ fusions with 40 µM ferrichrome. The p-values obtained when comparing the mutant activity
with the wild-type are indicated by asterisks (*** p < 0.001, ** p < 0.01, and * p < 0.05).
we report that, in response to its cognate environmental signal, CSS is activated by a
proteolytic cascade that requires the function of at least two proteases, Prc and RseP. To
determine this, we focused on the unique Iut CSS system of P. putida, which contains a
protein that combines a sigma and an anti-sigma factor domain in a single polypeptide.
This system responds to the heterologous siderophore aerobactin, which results in the
cleavage of the hybrid protein IutY and a concomitant activation of the IutY ECF sigma
factor domain (σIutY). The C-IutY anti-sigma domain is removed by these proteases in a
sequential manner, a model that is represented in Figure 6.
The involvement of RseP is perhaps not unexpected, because it has been documented
previously to be implicated in the activation of various ECF sigma factors. However, the
crucial role of Prc in CSS regulation shown in this work is more surprising. Prc proteases,
also known as tail-specific proteases (Tsp) or carboxyl-terminal processing proteases (Ctp),
have been reported previously to be implicated in the activation of two stress-responsive
ECF sigma factors, but these systems are (i) not controlled by CSS and (ii) Prc is not involved
in the first cleavage event and only in trimming the product of the site-1 protease (Reiling
et al., 2005; Qiu et al., 2007; Heinrich et al., 2009) (Fig. S7A). In our system, Prc seems to
be however directly responsible for the site-1 cleavage of C-IutY: deletion of the P. putida
prc gene completely abolished the cleavage of IutY and no additional products besides the
41 kDa full-length IutY protein can be detected (Fig. 3B). Moreover, overexpression of Prc
results in the activation of σIutY even in absence of aerobactin (Fig. 3), suggesting that a prior
site-1 proteolytic event is not required. In addition, the two site-1 proteases with a role in
ECF sigma factor activation identified to date, PrsW in B. subtilis and DegS/AlgW in E. coli
and P. aeruginosa (Fig. S7), do not seem to be involved in the aerobactin-mediated CSS
pathway of P. putida. A P. putida ∆degS mutant responds to aerobactin in a similar manner
as the wild-type strain (Fig. S4A), and in silico analyses show that this bacterium does not
contain a homologue of the PrsW protease. How exactly Prc is activated to cleave IutY in
response to aerobactin remains an open question. The DegS site-1 protease, involved in
the activation of the stress-responsive σE factor, is activated by the binding of unfolded
proteins, present in the periplasm of stressed cells, to its PDZ domain (Fig. S7B) (Ades,
2008). A similar mechanism might lead to the activation of Prc. Alternatively, IutY could
be protected from proteolysis by an additional protein that would bind the C-IutY domain
in the absence of aerobactin, thereby blocking Prc-mediated degradation and preventing
the system from being activated in the absence of the siderophore (Fig. 6). This situation is
Prc and RseP proteases control CSS
|
found in the mechanism activating E. coli σE, in which a periplasmic protein (RseB) binds
to the periplasmic domain of the anti-σE factor RseA and inhibits the proteolytic cascade
and σE activation in unstressed cells (Fig. S7B) (Ades, 2008). The involvement of such a
protein could also explain why overexpression of IutY results in ~10-fold induction of the
iutA promoter activity in the absence of aerobactin (Fig. 1B and 2, pMMBK1 plasmid). In
this situation, there might simply not be enough of the protecting protein in the periplasm
to prevent the C-terminal degradation and the activation of the excess amounts of IutY.
Prc-mediated degradation of C-IutY produces the substrate for the site-2 RseP protease, a
second proteolytic step necessary to render an active σIutY protein. Using shorter versions
of the IutY protein, in which the C-terminal domain was partially removed (IutY-K2 and
-K3 constructs), we could roughly map the RseP cutting site (Fig. 4). Our results strongly
suggests that RseP cleaves into the TM region of IutY, which is in agreement with previous
results showing that this cytoplasmic membrane protease cleaves TM sequences of several
proteins, including the anti-σE factor RseA (Akiyama et al., 2004) (Fig. S7B). Our analyses
also show that cytoplasmic proteases, such as Clp and Lon, are not involved in the activation
of σIutY (Fig. S4). Clp proteases have been shown to degrade the cytoplasmic domain of
some anti-sigma factors upon perception of the inducing signal, a last proteolytic step that
releases and activates the ECF sigma factor (Fig. S7). It is not surprising that this step is not
necessary to activate σIutY since the IutY hybrid protein does not contain the cytoplasmic
domain of classical anti-sigma factors (Fig. S1D).
Importantly, our work shows the involvement of the Prc and RseP proteases in the
activation of other, more conventional, CSS systems (Fig. 5). The involvement of RseP in
the control of CSS activity was already proposed for the E. coli iron-citrate uptake system
(Braun et al., 2006), and the haem-uptake pathway of Bordetella bronchiseptica (KingLyons et al., 2007). Recently, its role in CSS activation was experimentally demonstrated
for three different systems of P. aeruginosa: the pyoverdine (Pvd), ferrioxamine (Fox) and
ferrichrome (Fiu) CSS systems (Draper et al., 2011). In addition these authors showed,
quite unexpectedly, that the anti-sigma factors of these CSS systems are already cleaved
prior to perception of the inducing signal. However, the protease responsible for this initial
cleavage has not been identified yet. The site-1 DegS/AlgW and the DegP proteases did
not seem to be involved in this process, since mutations in these genes do not affect the
bacterial response to ferrioxamine and ferrichrome (Fig. S6A). On the other hand, since
Prc did not seem to be involved in the P. aeruginosa pyoverdine CSS pathway, the authors
assumed that Prc also does not play a role in the activation of the Fox and Fiu CSS pathways
(Draper et al., 2011). Our work has, however, demonstrated that Prc is involved in the
activation of these CSS systems in both P. putida and P. aeruginosa (Fig. 5). Interestingly,
overexpression of Prc not only strongly induces the aerobactin system in the absence of
a signal, but has a similar, albeit if more moderate, effect on the activity of the P. putida
ferrichrome system (Fig. S6B). While deletion of the prc gene completely abolishes the
P. putida aerobactin-induced signalling activity, it was not essential for the activity of the
ferrioxamine and ferrichrome signalling systems in both P. putida and P. aeruginosa (Fig.
5). However, in all cases a highly significant reduction in activity was observed. Therefore,
Prc seems to play an important, but less clear-cut role in the activation of the P. aeruginosa
ferrioxamine CSS system, as compared to the aerobactin-mediated pathway of P. putida.
It is likely that there is a case of redundancy and that other proteases (partly) take over
the role of Prc. Therefore, it seems that the regulation of classical CSS systems is more
33
2
34
|
Chapter 2
complex and involves additional proteases that will hopefully be identified in the future.
In conclusion, our results indicate that activation of bacterial CSS ECF sigma factors is
controlled by a proteolytic network consisting of multiple proteases, including RseP and
Prc.
Figure 6. Scheme of the proteolytic cascade involved in the activation of the P. putida aerobactinmediated CSS system. In the uninduced state (left panel, absence of aerobactin) the C-terminal part of the IutY
sigma/anti-sigma hybrid protein is protected from proteolysis via an unknown mechanism. The extracellular
presence of aerobactin (right panel) is sensed by the IutA receptor and transduced to the IutY protein. This
induces a proteolytic cascade that involves two proteases: Prc first degrades the C-terminal periplasmic part
of IutY and produces the substrate for RseP, which subsequently removes the TM region of the protein. These
proteolytic steps produce an active σIutY protein that associates with the core of the RNAP and initiates
transcription of the iutA gene. OM, outer membrane; P, periplasm; CM, cytoplasmic membrane; C, cytoplasm.
Experimental procedures
Bacterial growth conditions. Bacteria were grown in liquid LB or CAS media (Llamas
et al., 2006), the latter supplemented with 100-200 mM of 2,2’-bipyridyl (iron-restricted
conditions) or with 50 µM FeCl3 (iron-rich conditions). Aerobactin containing supernatant
was obtained from iron-restricted cultures of E. coli C600 (ColV-K30) (de Lorenzo et
al., 1986), and aerobactin-negative supernatant from E. coli C600 lacking the ColV-K30
plasmid. For induction experiments, supernatants were added in 1:1 proportion to ironrestricted cultures. Pure iron-free aerobactin was obtained from EMC microcollections
GmbH, and iron-free ferrichrome and ferrioxamine B from Sigma-Aldrich. When required,
antibiotics were used at the following final concentrations (µg ml-1): ampicillin (Ap), 100;
kanamycin (Km), 50; piperacillin (Pip), 25; gentamycin (Gm), 10; streptomycin (Sm), 100;
tetracycline (Tc), 20.
Plasmid construction and molecular biology. Plasmids used are listed in Table S1 and
primers in Table S2. PCR amplifications were performed using Phusion® Hot Start HighFidelity DNA Polymerase (Finnzymes) or Expand High Fidelity DNA polymerase (Roche).
All constructs were confirmed by DNA sequencing and transferred to P. putida or P.
aeruginosa by electroporation (Choi et al., 2006). Southern blot analyses were performed
as described (Llamas et al., 2000).
Bacterial strains and mutants construction. Strains used are listed in Table S1. P.
putida KT2440 and the miniTn5-Km transposon mutants were derived from the P. putida
transposon mutant library at the EEZ-CSIC (Molina-Henares et al., 2010). Mutation was
confirmed by PCR and sequencing, and Southern blot. Construction of null mutants was
performed by allelic exchange using the suicide vector pKNG101, which contains both a
Sm resistance gene as a selectable marker for the cointegration event and the Bacillus
Prc and RseP proteases control CSS
|
subtilis sacB gene as a counter selectable marker to select for the allelic exchange (Kaniga
et al., 1991). The pKNG101 derivative plasmids were constructed by amplifying ~1-1.4 Kb
DNA fragments upstream and downstream of the respective deleted gene. These fragments
were ligated using an EcoRI site generated in the PCR reactions, and used as template in
a second PCR reaction with the outer set of the primers of the first reactions. The final
fragment, which contains XbaI-BamHI restriction sites, was cloned into the compatible
restriction sites of pKNG101 (Kaniga et al., 1991). All constructs were sequenced to exclude
the presence of point mutations in the sequences flanking the chromosomal deletion, and
transferred to P. putida or P. aeruginosa by triparental mating using the E. coli HB101
(pRK600) helper strain (de Lorenzo and Timmis, 1994). Pseudomonas transconjugants
bearing a cointegrate of the plasmid into the chromosome were selected on M9 minimal
medium (Sambrook et al., 1989) with 0.3% (w/v) citrate as the sole carbon source and
100 µg/ml Sm. Sm-resistant transconjugants were analysed by PCR with primers flanking
the gene to be deleted. Those in which both the wild-type and the mutated gene product
were amplified were selected and cultured in liquid LB medium without antibiotic during
5-6 h to promote the second crossover and the allelic exchange to occur. To select this
process, colonies were plated on LB with 15 % (w/v) sucrose. Sm-sensitive/sucroseresistant colonies were analysed by PCR and southern-blot to confirm the chromosomal
gene deletion.
Enzyme assay. β-galactosidase activities in soluble cell extracts were determined using
ONPG (Sigma-Aldrich) as described (Llamas et al., 2006). Activity is expressed in Miller
units. Each assay was run in duplicate at least three times and the data given are the
average. Error bars in all graphs indicate SD.
SDS-PAGE and immunoblot. Bacteria were grown until late log phase and pelleted by
centrifugation. The pellets were solubilized in Laemmli buffer and heated for 5 min at 95°C.
Protein levels were normalized according to the OD660 of the bacterial cultures and 0.1 OD
unit was loaded in each lane. Proteins were separated by SDS-PAGE containing 12-15%
(w/v) acrylamide, electrotransferred to nitrocellulose membranes and immunodetected
with a monoclonal antibody directed against the influenza hemagglutinin epitope (HA.11,
Covance). The second antibody, horseradish peroxidase-conjugated rabbit anti-mouse
(DAKO), was detected using the SuperSignal® West Femto Chemiluminescent Substrate
(Thermo Scientific). Blots were scanned and analyzed using the Quantity One version 4.6.5
(Bio-Rad).
Computer-assisted analyses. Sequence analyses of the Pseudomonas genomes were
performed at http://www.pseudomonas.com, BLAST analyses at NCBI, prediction of
transmembrane domains with HMMTOP, and sequence alignments with ClustalW. P-values
were calculated by unpaired Two-tailed t-Test using GraphPad Prism version 5.01 for
Windows; *** p < 0.001, ** p < 0.01, and * p < 0.05.
Acknowledgements
We thank E. Duque and J. de la Torre for providing us with the P. putida miniTn5-Km mutants
and J. Luirink and P. van Ulsen for helpful discussions. KCB acknowledges financial support
from the Netherlands Organization for Scientific Research (NWO) through an ECHO grant
(2951201). Research in MAL’s lab is supported by the EU through a Marie Curie CIG grant
(3038130), and the Spanish Ministry of Economy with grants inside the Ramon&Cajal
(RYC2011-08874) and the Plan Nacional for I+D+i (SAF2012-31919) programs.
35
2
KT2440 carrying a miniTn5-Km in the iutY (PP2192) gene (insertion after codon 256); RifR, KmR
KT2440 carrying a miniTn5-Km in the clpB gene (insertion after codon 279); RifR, KmR
KT2440 carrying a miniTn5-Km in a gene encoding a putative cytoplasmic protease (insertion after
codon 403); RifR, KmR
KT2440 carrying a miniTn5-Km in the sspB gene (insertion after codon 148); RifR, KmR
PP0680-Tn5
KT2440 carrying a miniTn5-Km in the prc gene (insertion after codon 624); RifR, KmR
KT2440 carrying a miniTn5-Km in the lon-1 gene (insertion after codon 105); RifR, KmR
PP1719-Tn5
PP1443-Tn5(2)
KT2440 carrying a miniTn5-Km in the lon-1 gene (insertion after codon 11); RifR, KmR
KT2440 carrying a miniTn5-Km in the clpB gene (insertion after codon 610); RifR, KmR
PP1443-Tn5(1)
PP1321-Tn5
PP0625-Tn5(2)
KT2440 carrying a miniTn5-Km in the fiuA gene (insertion after codon 253); RifR, KmR
PP0625-Tn5(1)
PP0350-Tn5
KT2440 carrying a miniTn5-Km in the foxA gene (insertion after codon 205); RifR, KmR
PP0160-Tn5
hsdR1, wild-type strain; RifR
KT2440 carrying a miniTn5-Km in the iutA (PP2193) gene (insertion after codon 438); RifR, KmR
iutY-Tn5
KT2440
iutA-Tn5
Wild-type strain
Markerless PAO1 null mutant in the prc (PA3257) gene
Markerless PAO1 null mutant in the rseP (PA3649) gene
PAO1
∆prc
∆rseP
P. putida
P. aeruginosa
F- tonA21 thi-1 thr-1 leuB6 lacY1 glnV44 rfbC1 fhuA1 λ-; RifR
∆(ara-leu) araD ∆lacX74 galE galK phoA20 thi-1 rpsE rpoB argE recA1, lysogenized with lpir; RifR
supE44 ∆(lacZYA-argF)U169 f80 lacZ∆M15 hsdR17 (rK- mK+) recA1 endA1 gyrA96 thi1 relA1; NalR
F´[lacIq, Tn10 (TetR)] mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara leu) 7697
galU galK rpsL (StrR) endA1 nupG; TcR
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Franklin et al., 1981)
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Jacobs et al., 2003)
This study
This study
(Hanahan, 1983)
(Herrero et al., 1990)
(Hanahan, 1983)
Invitrogen
Reference
|
C600
CC118lpir
DH5a
TOP10F’
Table S1. Bacterial strains and plasmids used in this studya
Strain
Characteristics
E. coli
36
Chapter 2
KT2440 carrying a miniTn5-Km in a putative periplasmic protease (insertion after codon 107); RifR, KmR
KT2440 carrying a miniTn5-Km in the hslU gene (insertion after codon 295); RifR, KmR
pK∆rseP
pK∆prc
pK∆iutY
pK∆degS
pBSL141
pKNG101
pK∆degP
Plasmid
ColV-K30
pBBR1MCS-5
pBBR-PPprc
pBBR-PPrseP
∆degP
∆degS
∆iutY
∆prc
∆rseP
PP5058-Tn5
Characteristics
Plasmid containing the aerobactin biosynthetic pathway
oriTRK2; GmR
pBBR1MCS-5 carrying in BamHI a 2.6-Kb PCR fragment containing the P. putida prc (PP1719) gene; GmR
pBBR1MCS-5 carrying in XhoI-HindIII a 1.6 Kb PCR fragment containing the P. putida rseP (PP1598)
gene; GmR
Source of the Gm cassette; ApR, GmR
Gene replacement suicide vector, oriR6K, oriTRK2, sacB; SmR
pKNG101 carrying in XbaI-BamHI a 2.1-Kb PCR fragment containing the regions up- and downstream
the P. putida degP (PP1430) gene; SmR
pKNG101 carrying in XbaI-BamHI a 2.3-Kb PCR fragment containing the regions up- and downstream
the P. putida degS (PP1301) gene; SmR
pKNG101 carrying in XbaI-BamHI a 2.3-Kb PCR fragment containing the regions up- and downstream
the P. putida iutY (PP2192) gene; SmR
pKNG101 carrying in XbaI-BamHI a 2.6-Kb PCR fragment containing the regions up- and downstream
the P. putida prc (PP1719) gene; SmR
pKNG101 carrying in XbaI-BamHI a 1.9-Kb PCR fragment containing the regions up- and downstream
the P. putida rseP (PP1598) gene; SmR
Markerless KT2440 null mutant in the degP (PP1430) gene; RifR
Markerless KT2440 null mutant in the degS (PP1301) gene; RifR
Markerless KT2440 null mutant in the iutY (PP2192) gene; RifR
Markerless KT2440 null mutant in the prc (PP1719) gene; RifR
Markerless KT2440 null mutant in the rseP (PP1598) gene; RifR
KT2440 carrying a miniTn5-Km in a putatative C-terminal protease (insertion after codon 62); RifR, KmR
KT2440 carrying a miniTn5-Km in the clpA gene (insertion after codon 128); RifR, KmR
PP5001-Tn5
PP4008-Tn5(2)
KT2440 carrying a miniTn5-Km in the clpA gene (insertion after codon 80); RifR, KmR
PP4008-Tn5(1)
KT2440 carrying a miniTn5-Km in the pfpI gene (insertion after codon 18); RifR, KmR
PP3922-Tn5
PP2725-Tn5
KT2440 carrying a miniTn5-Km in the lon-2 gene (insertion after codon 615); RifR, KmR
PP2302-Tn5
This study
This study
This study
This study
(Alexeyev et al., 1995)
(Kaniga et al., 1991)
This study
Reference
(de Lorenzo et al., 1986)
(Kovach et al., 1995)
This study
This study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
(Molina-Henares et al., 2010)
and this study
This study
This study
This study
This study
This study
Prc and RseP proteases control CSS
|
37
2
This study
This study
(Llamas et al., 2006)
(Llamas et al., 2006)
This study
This study
This study
(Spaink et al., 1987)
This study
This study
This study
This study
(Fürste et al., 1986)
This study
This study
This study
(de Lorenzo and Timmis,
1994)
a
ApR, GmR, KmR, NalR, RifR, SmR and TcR, resistance to ampicillin, gentamycin, kanamycin, nalidixic acid, rifampicin, streptomycin and tetracycline, respectively
pRK600
pMP-PPfiuA
pMP-PPfoxA
pMPR8b
pMPFiuA
pMMBK1-HA
pMMBK2-HA
pMMBK3-HA
pMP220
pMPK4
pMMBK3
pMMBK2
pMMBK1
pMMB67EH
pMMB-iutA
pK∆PArseP
pKNG101 carrying in XbaI-BamHI a 2.1-Kb PCR fragment containing the regions up- and downstream
the P. aeruginosa prc (PA3257) gene; SmR
pKNG101 carrying in XbaI-BamHI a 1.8-Kb PCR fragment containing the regions up- and downstream
the P. aeruginosa rseP (PA3649) gene; SmR
IncQ broad-host range plasmid, lacIq; ApR
pMMB67EH carrying in EcoRI-HindIII a 2.7-Kb PCR fragment containing the P. putida iutA (PP2193)
gene; ApR
pMMB67EH carrying in EcoRI-HindIII a 1.7-Kb PCR fragment containing the P. putida iutY (PP2192)
gene; ApR
pMMB67EH carrying in EcoRI-HindIII a 0.92-Kb PCR fragment containing a partial P. putida iutY gene
(amino acids 1-171); ApR
pMMB67EH carrying in EcoRI-HindIII a 0.99-Kb PCR fragment containing a partial P. putida iutY gene
(amino acids 1-194); ApR
pMMBK1 in which the iutY gene has been N-terminally HA-tagged; ApR
pMMBK2 in which the iutY K2 fragment gene has been N-terminally HA-tagged; ApR
pMMBK3 in which the iutY K3 fragment gene has been N-terminally HA-tagged; ApR
IncP broad-host-range lacZ fusion vector; TcR
pMP220 carrying in EcoRI-BamHI the P. putida iutA (PP2193) promoter region cloned upstream the lacZ
gene; TcR
pMP220 carrying in EcoRI-BamHI the P. aeruginosa fiuA (PA0470) promoter region cloned upstream the
lacZ gene; TcR
pMP220 carrying in EcoRI-BamHI the P. aeruginosa foxA (PA2466) promoter region cloned upstream the
lacZ gene; TcR
pMP220 carrying in EcoRI-BamHI the P. puitda foxA (PP0160) promoter region cloned upstream the lacZ
gene; TcR
pMP220 carrying in EcoRI-BamHI the P. putida fiuA (PP0350) promoter region cloned upstream the lacZ
gene; TcR
Helper plasmid, oriColE1, mobRK2, traRK2; CmR
|
pK∆PAprc
38
Chapter 2
pKΔdegP
pBBR-PPrseP
degP (PP1430)
rseP (PP1598)
pKΔrseP
pKΔdegS
degS (PP1301)
fiuA (PP0350)
pMP-PPfoxA
foxA (PP0160)
pMP-PPfiuA
pKΔPArseP
rseP (PA3649)
P. putida KT2440
pKΔPAprc
prc (PA3257)
Pr-PP0160F-E
Pr-PP0160R-X
Pr-PP0350F-E
Pr-PP0350R-X
PP1303F-X
ΔdegSR-E
ΔdegSF-E
PP1300R-B
rseBF-X
∆degPR-E
∆degPF-E
PP1431R-B
PP1598F-X
PP1598R-H
PP1598F-X
∆PP1598R-E
∆PP1598F-E
PP1598R-B
PA3256F-X
ΔPAprcR-E
ΔPAprcF-E
PA3258R-B
PA3650F-X
ΔPArsePR-E
ΔPArsePF-E
PA3648R-B
Table S2. Sequence of the primers used in this study
Gene (or promoter
Plasmid
Primer name
region)
P. aeruginosa PAO1
AATGAATTCTGCTACCGCAGACGTTGCC
TGCTCTAGATTCGGGCTGAAAGTGTGGG
AAAGAATTCGGCATACGCAGTGGTGGG
AACTCTAGATATGATCAACGGCACGGG
AACTCTAGATTCCTCGACCATCTTGTCGC
AATGAATTCTGGCAGTGGGGCATGAGCG
AAAGAATTCGCCAGGAAGAGAAATAAACCC
AAAGGATCCGAGGGCTACGTGTTCGC
AAATCTAGACTCAAGGGCACTGAAACCG
AAAGAATTCAAAGACCCCTGCACAACGC
CCAGAATTCAATAAGCAGTTTCGCAAGGC
TTAGGATCCAGCGAGGAGTCGTTCAGGG
AAACTCGAGATCGCGGGTATGATCGAACAGGTA
TTTAAGCTTTGGCAATAAACAACCTGCCGTCAC
TATTCTAGATCCTGCTTACCGCGTCCG
AACGAATTCCGCTGTCATGTCCATCTCCG
ATAGAATTCATAGGGGTGATGTTGCTCGC
TATGGATCCTCTTCGGTCTTGGTGTTGCC
AAATCTAGAGCCAGACCTTCAACCCCAG
CCAGGAATTCTGGGCGCTG
TAAGAATTCACTGAGTTCAGCGGGAGCG
TAAGGATCCGATGGACGATGCCGATGGG
AACTCTAGATCCTCTTGACCGCCTCCG
AAAGAATTCGTGGAACGTCACCAGC
GAGTCGTCTGTAGTCATGTTGAATTCG
AATGGATCCGGTGTAGCCCTCGTTGCCC
Primer sequence (5’>3’)a
Prc and RseP proteases control CSS
|
39
2
PP1719F-X
PP1719R-B
PP1720F-X
ΔPP1719R-E
ΔPP1719F-E
PP1718R-B
PP_2192F-E
PP_2192R-H(1)
PP_2192F-E
PP_2192R-H(3)
PP_2192F-E
PP_2192R-H(2)
NHA-PP2192-E
AAATCTAGAGCAAACGCGGTCACCCACG
TTTGGATCCCCCGGCCCTCATATTTCACG
pKΔprc
GAATCTAGACGAGGAATGACTTGCCGTT
TTAGAATTCATTGATCACGCATAGTAGGC
AAAGAATTCAAGAAGTAAGGCACCTCAGC
TATGGATCCTACTGGCTTCTTTGAGTGCG
iutY (PP2192)
pMMBK1
AACGAATTCTGCCCCTGCTGGTCACTGAC
GAGAAGCTTAAGTCGTAAATGAGAATGGG
pMMBK2
AACGAATTCTGCCCCTGCTGGTCACTGAC
GATAAGCTTCAACCCGCCTGCTTCAGCC
pMMBK3
AACGAATTCTGCCCCTGCTGGTCACTGAC
TCTAAGCTTCAGGCCAGCAGTATCGGGGC
pMMBK1-HA
AAAGAATTCATGTACCCGTACGACGTGCCGGAC
TACGCGTGCCTGACTTCACCCATGTCGGGCC
PP2192R-X
TTTTCTAGATCAATGCACCACGGCCAACCACGGCAG
pMMBK2-HA
NHA-PP2192-E
AAAGAATTCATGTACCCGTACGACGTGCCGGAC
TACGCGTGCCTGACTTCACCCATGTCGGGCC
PP_2192R-H(3)
GATAAGCTTCAACCCGCCTGCTTCAGCC
pMMBK3-HA
NHA-PP2192-E
AAAGAATTCATGTACCCGTACGACGTGCCGGAC
TACGCGTGCCTGACTTCACCCATGTCGGGCC
PP_2192R-H(2)
TCTAAGCTTCAGGCCAGCAGTATCGGGGC
pKΔiutY
PP2190F-X
TAATCTAGAACTCGTCCTCGTCAATGGG
ΔPP2192R-E
ATAGAATTCAGCATGATTGGGGAACAGCC
ΔPP2192F-E
ATTGAATTCCTGTTCCGGCCTCTTAGC
PP2193R-B
GTTGGATCCTAGATACCCGTGCTGCCG
iutA (PP2193)
pMMB-iutA
PRPP_2193F
TTAGAATTCATTGATCAGCCTGTTCCG
PP2193R-H
CCTAAGCTTGCCACCACAATCAGTAAGCC
pMPK4
PRPP_2193F
TTAGAATTCATTGATCAGCCTGTTCCG
PRPP_2193R
GGATCTAGACAAGTCGTAAATGAGAATGG
a
The sequences of the restriction sites are indicated in bold and the annealing region is underlined
pBBR-PPprc
|
prc (PP1719)
40
Chapter 2
Prc and RseP proteases control CSS
|
41
2
42
|
Chapter 2
Figure S1. PP2192 sequence analyses. (A) Conserved domains detected in the PP2192 protein. (B) PP2192
protein sequence and motifs prediction. The predicted cytoplasmic sigma domain (amino acids 1-169) is
depicted in red with the domains 2 and 4 characteristic of ECF sigma factors underlined and double underlined,
respectively. The TM domain (amino acids 170-186) is shown in grey, and the predicted periplasmic anti-sigma
domain (amino acids 187-374) in blue. The length of the different K1 to K3 constructs is indicated in the sequence
as well as the insertion point of the miniTn5-Km in the iutY-Tn5 mutant. (C) Alignment of the PP2192 (IutY) Nterminal domain with the E. coli FecI, P. aeruginosa FoxI and P. putida PupI ECF sigma factors. The PP2192 Ndomain contains the domains 2 and 4 characteristic of sigma factors belonging to the ECF subfamily (shaded). (D)
Alignment of the PP2192 (IutY) C-terminal domain with the E. coli FecR, P. aeruginosa FoxR and P. putida PupR
anti-sigma factors. The PP2192 C-domain resembles the C-terminal domain of TM anti-sigma factors but lacks
the N-terminal cytoplasmic domain (first 100 amino acids), which is the domain of (normal) anti-sigma factors
that binds the sigma factor. The PP2192 TM domain is shaded.
Prc and RseP proteases control CSS
|
43
2
Figure S2. PP2192 promoter region. Sequence of the putative FUR box in the PP2192 (iutY) promoter
region is surrounded. Residues matching with the FUR box consensus sequence (below) are indicated in
bold. The PP2192 start codon and the putative -10 and -35 regions are indicated.
44
|
Chapter 2
Figure S3. Southern-blot analyses of the iutY-Tn5 and
iutA-Tn5 mutants. The restriction map of both the P. putida
iutY-Tn5 and iutA-Tn5 chromosomal region at the point of the
miniTn5-Km transposon insertion is shown. The kanamycin
resistance gene was used as a probe to determine the size of
the BamHI and PstI, respectively, chromosomal fragments.
The sizes of such fragments are indicated in the scheme. For
the Southern blot analyses, total DNA was prepared from P.
putida KT2440 (wild-type, WT), and the iutY-Tn5 and iutATn5 mutants, and digested either with BamHI or with PstI.
After electrophoresis on agarose gel, the digested DNA was
transferred to a nylon hybridization membrane. The probe
was labelled with digoxigenin-dUTP (Roche). For DNA prehybridization and hybridization, high-stringency conditions
(42ºC, 50% [v/v] formamide) were used. The digoxigeninlabelled hybrid DNA was detected by using an enzyme
immunoassay according to the manufacturer’s instructions
(Roche).
Prc and RseP proteases control CSS
|
45
2
Figure S4. Screening to identify proteases involved in the
P. putida aerobactin-mediated CSS pathway. The P. putida
KT2440 wild-type strain and its isogenic null ΔdegP and
ΔdegS mutants (A) and miniTn5-Km mutants (B) bearing the
pMPK4 plasmid (iutA::lacZ fusion) were grown under ironrestricted conditions without or with aerobactin containing
supernatant. β-galactosidase activity was measured as
described in Experimental procedures.
46
|
Chapter 2
Figure S5. Activity of the HA-tagged
IutY proteins. The P. putida ΔiutY mutant
bearing the pMPK4 plasmid (iutA::lacZ
fusion) and the indicated pMMB67EHderivative plasmids, in which the inserted
gene product was or not HA-tagged, were
grown under iron-restricted conditions
with aerobactin containing supernatant.
β-galactosidase activity was measured as
described in Experimental procedures.
Figure S6. Activity of the P. putida ferrioxamine- and ferrichromemediated CSS pathways. (A) Activity of the ferrioxamine- and
ferrichrome-mediated CSS systems in the P. putida ΔdegP and ΔdegS
mutants, and (B) complementation of the Δprc and ΔrseP mutations for
the ferrichrome induced pathway. The indicated strains were grown
under iron-restricted conditions without or with the siderophores.
β-galactosidase was measured as described in Experimental procedures.
Prc and RseP proteases control CSS
|
47
2
Figure S7. Model for regulated intramembrane proteolysis (RIP) in the activation of stressresponsive ECF sigma factors. (A) Activation of the B. subtilis ECF sigma factor σW. In unstressed
cells, σW is bound to the RsiW anti-sigma factor and inactive. In response to stress, the site-1 protease
PrsW cleaves in the C-terminal end of the periplasmic domain of RsiW. Subsequently, periplasmic bulk
proteases like Prc are required for trimming the rest of the C-terminal domain of the anti-sigma factor and
for producing the substrate for the site-2 protease RasP (RseP homologue). RasP cleaves in the TM region
of RsiW and the remaining cytosolic portion of the protein is degraded by cytosolic proteases such as ClpXP.
Consequently, σW is free to associate with the RNAP core enzyme and drive transcription of the σW regulon.
(Figure adapted from Heinrich et al., 2009) (B) Activation of the E. coli ECF sigma factor σE. In unstressed
cells, σE is inactive through its interaction with the RseA anti-sigma factor. The DegS and RseP proteases
are inactive through inhibitory interactions with their own PDZ domains, RseB that binds and protects
the periplasmic domain of RseA, and a glutamine-rich region of RseA. In stressed cells, unfolded proteins
accumulate in the periplasm and activate the DegS protease by binding its PDZ domain. RseB is in this
situation displaced from the RseA protein and DegS cleaves the periplasmic domain of the anti-sigma
factor. This site-1 cleavage removes the inhibitory interaction between RseP and RseA, and enables RseP
to cleave in the TM region of RseA. The remainder of RseA is degraded in the cytosol by ClpXP proteases,
upon which σE is free to interact with the RNAP core enzyme and direct transcription of its target genes.
The σE regulon mainly encodes proteins that are involved in the restoration of the proper folding of outer
membrane proteins. The P. aeruginosa σE, RseA, RseB, DegS and RseP homologues (σAlgT, MucA, MucB,
AlgW and MucP, respectively) are indicated between brackets. CW, cell wall; OM, outer membrane; P,
periplasm; CM, cytoplasmic membrane; C, cytoplasm.