* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Media:ATPsynthase
Survey
Document related concepts
Transcript
ATP Synthase: Subunit Gamma Lauren Ivey • Resveratrol binds to gamma, alpha, beta – Hydrolysis and synthesis • Hydrophobic pocket between beta and gamma subunit • Gamma – Because beta most likely more highly conserved – Alpha, beta in larger scale project ATP synthase animation Grape to blueberry Blueberry hits from grape • TAGTCCGAAACCGGATGAAGAGTGTGAAGAATATC CAGAAAATTACTAAGGCCATGAAAA • TGGTTGCAGCATCTAAGCTGCGAGCTATTCAAGTTA GGGCTGAGAATTCCCGTGGCCTAT • GGCAGCCATTTACTGCACTTCTTGG • GTTCTGTTCAATGCTGTCTTGGAGAATGCTACCAGT GAGCAAGGAGCAAGGATGTCTGCC • ATGGATAGCTCCAGCAGAAATGCTGGAGACATGCT TGACCGCCTCACGCTTACTTATAAC Blueberry to bovine Grape to Bovine Blueberry to human Next Steps • Amino acid sequences – Bovine, grape, blueberry • Beta and alpha • Interactions with resveratrol structure • Hypothesis: No hydrophobic pocket and resveratrol does not bind to ATP synthase in blueberry and grape Why do we care? • cardiovascular disease and neurological disorders • cardiac ischemia– Prevents hydrolysis of ATP • apoptosis • Selective induction • Normal cells change binding sites Gledhill, J.R et al. Mechanism of inhibition of bovine F1-ATPase by resveratrol and related polyphenols. PNAS. 2007; 104(34): 13632-13637.