Download RNA Structure

Class 5:
RNA Structure Prediction
.
RNA types
Messenger RNA (mRNA)
 Encodes protein sequences
 Transfer RNA (tRNA)
 Adaptor between mRNA molecules and amino-acids
(protein building blocks)
 Ribosomal RNA (rRNA)
 Part of the ribosome, a machine for translating mRNA to
proteins
 mi-RNA (micro-)
 Sn-RNA (small nuclear)
 RNA-I (interfering)
 Srp-RNA (Signal Recognition Particle)

Functions of RNAs
Information Transfer:
mRNA
Codon -> Amino Acid adapter:
Other base pairing functions:
Enzymatic Reactions:
Structural:
Metabolic: ???
Regulatory: RNAi
tRNA
???
RNA World Hypothesis
Before the “invention” of DNA and protein, early organisms
relied on RNA for both genetic and enzymatic processes
DNA was a selective advantage because it greatly
enhanced the fidelity of genetic replication
Proteins were a selective advantage because they make
much more efficient enzymes
Remnants of the RNA world remain today in catalytic RNAs
in ribosomes, polymereases and slicing molecules
Why is RNA structure important?
Messenger RNA is a linear, unstructured
sequence, encoding an amino-acid sequence
 Most non-coding RNA’s adopt 3D structures and
catalyse bio-chemical reactions.


Predicting structure of a new RNA => information
about its function
Terminology of RNA structure






RNA: a polymer of four different nucleotide subunits:
 adenine (A) , cytosine (C), guanine (G)and uracil (U)
Unlike DNA, RNA is a single stranded molecule folding
intra-molecularly to form secondary structures.
RNA secondary structure = set of base pairings in the
three dimensional structure of the molecule
G-C has 3 hydrogen bonds
A-U has 2 hydrogen bonds
Base pairs are almost always stacked onto other pairs,
creating stems.
Base Pairing in RNA
guanine
cytosine
adenine
uracil
Non-canonical pairs and pseudoknots



In addition to A-U and GC pairs, non-canonical
pairs also occur. Most
common one is G-U pair.
G-U is thermodynamically
favourable as WatsonCrick pairs (A-U, G-C) .
Base pairs almost always
occur in nested fashion.
Exception: pseudoknots.
Elements
of RNA
secondary
structure
RNA Secondary
Structure
(more…)
AGCTACGGAGCGATCTCCGAGCTTTCGAGAAAGCCTCTATTAGC
RNA Tertiary
Structure
•Do not obey
“parantheses
rule”
tRNA structure
Structure vs Sequence
Homologous RNA’s that have common secondary
structure without sharing significant sequence
similarity are important.
 It is advantageous to search conserved secondary
structure in addition to conserved sequence in
databases.

Example – R17 phage coat protein
Durbin, p. 264
Two Problems
1.
2.
RNA secondary structure for a single sequence.
The dynamic programming algorithms –
Nussinov and Zuker, SCFG algorithms.
Analysis of multiple alignments of families of
RNA’s.
Covariance Models – used for both multiple
alignment and database searches.
Problem I: Structure Prediction
 Input:
An RNA sequence X
 Output:
Most likely secondary structure of X
 Algorithms:
Nussinov, CYK, MFOLD, …
Problem II: RNA family modeling
A family for RNA sequence X1, …, XN
sharing a common secondary structure
 Aligned / Not aligned
 Input:
 Output:
A probabilistic generative model
representing the RNA family
 Model:
Covariance model