* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download EOC Review #3 - christophersonbiology
Survey
Document related concepts
Transcript
Wake-up 1. Explain the difference between prokaryotic and eukaryotic cells. 2. Explain what would happen to a clown fish (Nemo from the ocean) if it was placed in freshwater. 3. What is #2 an example of, hypertonic or hypotonic? Explain. EOC Review #3: Photosynthesis, Cell Respiration, DNA, Mitosis, and Protein synthesis Christopherson Photosynthesis Photosynthesis I Photosynthesis Function To produce glucose (food) for producers The formula for glucose: C6H12O6 Photosynthesis: How? Plants absorb sunlight energy, carbon dioxide and water to make glucose Organisms that Undergo Photosynthesis: Plants Bacteria Protists – ex/ Green Algae Photosynthesis: Location Chloroplast Chlorophyll: Pigment Producer Leaf Leaf Cross-section Pigments Found inside the thylakoid Absorb sunlight energy and give plants their color. Photosynthesis Summative Equation (Formula) Sunlight Energy CO2 + H2O C6H12O6 + O2 Reactants What is needed Products What is produced Cell Respiration I: ATP and Anaerobic Respiration Christopherson Purpose of Cell Respiration The process in which glucose (food) is broken down into ATP (usable energy) C6H12O6 C6H12O6 ATP Nucleic Acid Function Usable form of energy (ATP) Cell Respiration Summative Equation (Formula) C6H12O6 + O2 CO2 + H2O + ATP Reactants Need? Products Produced? Anaerobic Respiration Respiration that occurs without oxygen present Organisms that undergo Anaerobic Respiration: All living things Anaerobic (Complex Organisms) Glucose is broken down into pyruvate and ATP. The pyruvate is then moved to the mitochondria for AEROBIC RESPIRATION to make more ATP. C-C-C and C-C-C Pyruvate (To the mitochondria) (ATP) C6H12O6 C-C-C-C-C-C Anaerobic (Simple Organisms) FERMENATATION: Breaking down pyruvate into waste (trash) C-C-C and C-C-C Pyruvate (ATP) C6H12O6 C-C-C-C-C-C (Fermentation) Lactic Acid and Alcohol Breaking down of Pyruvate Simple Organisms Bacteria Yeast Type of Fermentation Lactic acid Fermentation Lactic Acid Fermentation: Explanation Pyruvate is broken down into lactic acid; a waste product Type of Fermentation Alcohol Fermentation Alcohol Fermentation: Explanation Pyruvate is broken down into ethanol (alcohol) and carbon dioxide Aerobic Respiration Respiration that occurs with oxygen present Organisms that undergo Aerobic Respiration: Complex Organisms (Everything BUT Bacteria and Yeast) Location Mitochondria: Breaks down sugar into ATP (usable form of energy); Powerhouse of the cell Aerobic Respiration: Process 1. A consumer/producer takes in oxygen through respiration O2 C-C-C and C-C-C Pyruvate Aerobic Respiration: Process 2. A carbon is broken off of pyruvate; combines with O2 and leaves as CO2 O2 CO2 C-C and C-C-C Pyruvate Aerobic Respiration: Process 3. Pyruvate is stored energy (from sun); when break off a carbon; ATP is created O2 CO2 C-C and C-C-C Pyruvate ATP ATP Aerobic Respiration: Process 4. The process continues a total of six times; MANY ATP’s are created O2 O2 CO2 C and C-C-C Pyruvate ATP ATP ATP CO2 Aerobic Respiration: Process 4. The process continues a total of six times; MANY ATP’s are created O2 O2 O2 CO2 C-C-C Pyruvate ATP ATP ATP ATP ATP CO2 CO2 Aerobic Respiration: Process 4. The process continues a total of six times; MANY ATP’s are created O2 O2 O2 O2 CO2 C-C Pyruvate ATP ATP ATP ATP ATP ATP CO2 CO2 CO2 Aerobic Respiration: Process 4. The process continues a total of six times; MANY ATP’s are created O2 O2 O2 O 2 O2 CO2 C Pyruvate ATP ATP ATP ATP ATP ATP ATP ATP CO2 CO2 CO2 CO2 Aerobic Respiration: Process 4. The process continues a total of six times; MANY ATP’s are created O2 O2 O2 O2 O 2 O2 CO2 ATP ATP ATP ATP ATP ATP ATP ATP ATP ATP ATP ATP CO2 CO2 CO2 CO2 CO2 Which process produces the MOST ATP? Anaerobic (Glycolysis) or Aerobic Respiration? DNA Structure and Discovery Christopherson DNA: Deoxyribonucleic Acid DNA is a Nucleic Acid Monomer: Nucleotide Structure of a Nucleotide 1. Phosphate 2. Deoxyribose a. Adenine b. Thymine c. Cytosine d. Guanine 3. Nitrogen Base Structure of DNA – aka Double Helix Steps; Rungs Deoxyribose Nitrogen Base Hydrogen Bond Handles; DNA Backbone Phosphate Matching Strands of DNA Remember that A=T and G=C ATGCTTACATGCTACTTAAC TACGAATGTACGATGAATTG What is a GENE? Cook book for everything in our body Portion of the DNA that “codes” (has the directions) for a specific trait. Where is a Gene? •Within DNA •The nitrogen bases spell out the instructions RNA Ribonucleic Acid Make up of Nucleotides Contains Phosphorus RNA Nucleotide A Phosphate Nitrogen Base C B Ribose Guanine Cytosine Adenine Uracil How is DNA different from RNA? DNA versus RNA: # of Strands 2 strands 1 strand DNA versus RNA: Sugar Deoxyribose Ribose DNA versus RNA: Bonds with Adenine DNA Adenine Thymine RNA Adenine Uracil What are the types of RNA? mRNA Function Copy a message from a gene on DNA DNA mRNA tRNA Function Carries amino acids to mRNA mRNA Brief summary of Protein synthesis A protein is made from a gene on DNA Brief Summary of Transcription Make mRNA from a gene on DNA Transcription Animation #2 Transcribe the following DNA TAC GGC AAA TAG GAT TTT CCA TTA AGT AUG CCG UUU AUC CUA AAA GGU AAU UCA mRNA Location of Translation Ribosome Brief Summary of Translation Make a protein from mRNA Translation Animation #1 TAC GGA CAT GAC GGG AAA ACT DNA AUG CCU GUA CUG CCC UUU UGA mRNA Met – Pro – Val – Leu – Pro – Phe - STOP Amino Acid Mutations Mutations What is a mutation? Change in the DNA nitrogen base sequence of a gene How do Mutations Occur? Damaged DNA caused by agents such as sunlight, smoke, radiation; It can also be inherited Category of Mutation: Point Change in one base of the DNA sequence. Original: The fat cat ate the wee rat Point mutation: The fat hat ate the wee rat Example of Point Mutation: Sickle Cell Anemia Sickle Cell Anemia: Point Mutation Category of Mutation: Frameshift Addition or deletion of a DNA base resulting in a different sequence of DNA. Original: The fat cat ate the wee rat Frameshift mutation: The fat ata tet hew eer at Tay Sachs Disease: Frameshift Mutation Cell Cycle Summary What is a Body Cell? All the cells that make up the “body” of an organism. Total Number of Chromosomes in a Human Body Cell Purpose of the Cell Cycle To grow, replace old cells, or reproduction Location of the Cell Cycle Within an organisms body cells 1st Step of the Cell Cycle Interphase: Cell prepares to divide by making more organelles and cytoplasm (G1 and G2); Replicates DNA (S) 2nd Step of the Cell Cycle Mitosis: The replicated DNA is separated Made up of PMAT Prophase, Metaphase, Anaphase, Telophase 3rd Step of the Cell Cycle Cytokinesis: The cell divides the organelles and cytoplasm into the new cell End Result of the Cell Cycle Two identical cells with the same number of chromosomes Interphase Mitosis Cytokinesis If an organism has 50 chromosomes and it undergoes mitosis, how many chromosomes will be present in the new cells? If an organisms diploid number chromosome is 100, how many chromosomes will be present in the new cells?