Download old strand - TeacherWeb

What is DNA
DNA is also know as
DNA is the basic “building Block” of life.
But what does that mean? and how does
something soooo small make up ALL that
is you?
Perhaps when you think of DNA, you think of
something out of a sci fi film. Like poor Bryant
here…
So let’s Look at the Basic’s
DNA is held in your nucleus. It never leaves (copies get
sent out to do the dirty work but NEVER the DNA itself.)
The subunit of DNA is made of a
Basic’s
There are 4 Nitrogenous
Bases:
Adenine (____)
Guanine (____)
A always bonds with T
G always bonds with C
Think – “A Tall Girl Called”
Thymine (____)
Cytosine (____)
G
C
T
A
C
G
A
T
How is DNA kept in your Cells?
You have roughly 3’ of DNA in each of your
billions of cells.
They need to be tightly coiled like a phone cord
(remember those things) then coiled around
protein.
These are the structures you see as
chromosomes.
Chromosomes
Karyotype
When a women has a
child they can do
what is called a
_______________
This is a picture of the
baby’s DNA before
they are born.
They pair up all the
Chromosomes to see
if there are any
abnormalities.
DNA fingerprints?
Everyone’s DNA is unique to them.
Unless, they are an identical twin.
I’m sure you’ve seen on CSI, they take
DNA evidence.
They do this by doing a DNA Gel
Electrophoresis. (we will be doing one too)
On the following slide you will see a
picture of several twin’s DNA fingerprints.
Twin DNA
Fingerprints
How do you make more?
Well we know you are more then the one cell you
started at.
And every cell you have has the same DNA, so
how do you make more DNA?
It’s called DNA Replication.
You’re DNA is in the shape of a Double Helix –
like a twisted ladder. This shape is not really the
best in aiding the replication process.
What to do, what to do …
Replication
First you ______________ a section
Then you must ______________
This is done by breaking the ____________ bonds
between the nitrogenous bases.
Now you find a new “______________________”
partner (A with T, G with C)
Once a section has been partnered up it
____________________
Replication
Closer look
at
Replication
This is a
_________________
replication because
each new strand has
half of the old strand.
The old strand is
used as a
____________or
guide of where to put
the new bases
But how does DNA control Cell
functions?
Well like any building site – there are a set of
blue prints. You don’t want to hand out the
original, you have to make a copy to give the
plumber, electrician, mason, etc.
So we make a messenger molecule called RNA.
RNA is kind of like DNA in that it is made up of
nucleotides (remember – sugar, phosphate,
base)
RNA
However, RNA’s bases are
Adenine (____)
Guanine (____)
Cytosine (____)
URACIL (____)
Also RNA is single Stranded, that’s how it can fit
out of the nuclear pores.
The process in which we make RNA from DNA is
like replication but the RNA strand leaves, and the
DNA just retwists
Transcription
Transcription
So now you keep the original In the nucleus,
and the copy goes out into the cytoplasm.
The code is an exact copy of the DNA’s code
(with the exception of U’s instead of T’s)
So it looks something like AUGUUUAAAGGGCCCUAGCGCUUAAGGUUAAGGCCUUUGUAUUAAUAG
OK so how does that RNA tell our
cells what to do?
So now the RNA code is in the cytoplasm. A
ribosome bonds to an initiation site.
The ribosome “reads” this code and figures out
what amino acids to put together to make a
protein.
The proteins made are what influences the cells
behavior.
So let’s look at TRANSLATION in detail.
The Ribosome reads the RNA three letters at
a time. This is called the codon.
If you look at the amino acid chart you will
see there are 20 amino acids but 64 different
codon possibilities. That means that several
codons code for the same amino acid.
A T-RNA with the anti-codon brings the
appropriate amino acid to the M-RNA and
links the amino acids together.
Codon - Amino Acid Chart
Translation
In the codon chart, you saw the amino acid
sequences. The ribosome knows where to start
reading based on the initiation codon AUG, and
where to end based on three termination
sequences: UAA, UGA, UAG
You saw in that second picture that the ribosome
held two T-RNA. The first one holds the chain of
amino acids, while the second one brings in the
new amino acid.
The following is an animation of the ribosome
traveling down the Messenger RNA
Translation
Here’s an animation of translation I
found online
Many ribosomes can read the RNA
strand at one time.
What’s the big deal making
proteins?
Proteins are what controls the activities
going on in your cells.
Remember, enzymes are protein too.
IMPORTANT :
the sequence of the amino acids
determines the SHAPE of the protein
The SHAPE determines the FUNCTION
of the protein
If the DNA changes (a mutation), the
AMINO ACID could change, which
WOULD change the shape, which WOULD
change the function.
Remember since some codons code for
the same amino acid, substituting one
letter for another MAY change the amino
acid. It is not a guarantee. However, If
you delete or add a letter that would
change the reading frame and would
change almost all the amino acids.
Overview of Transcription and
Translation
Types of Mutations
• Point mutations – occurs when a single
nucleotide is substituted by another
nucleotide.
• THE CAT ATE THE RAT – original
• THE BAT ATE THE RAT - mutation
• THE CAT ATE THE BAT - mutation
• Frame Shift Mutation – addition or deletion
that involves the loss or addition of a
single nucleotide
• THE CAT ATE THE BAT – original
• THC ATA TET HEB AT – mutation
• THE CAA THT HEB AT – mutation
• THG ECA TAT ETH EBA T - mutation