Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
KEYSTONE REVIEW 1 Biochemistry through DNA/protein synthesis Biochemistry • What is an atom? • An atom is the most basic unit of structure. Each element on the period table, such as carbon, hydrogen and oxygen, are made up of atoms. • Atoms consist of three particles • Protons: have a positive charge • Electrons: have a negative charge • Neutrons: have a neutral charge • What are compounds? • Compounds form when atoms join together, like water, which is hydrogen atoms and oxygen atoms bonded together. Biochemistry • What is a bond? • The sharing or transferring of electrons in the atom’s outer “shell” • Sharing electrons: covalent bond • Transferring electrons: ionic bond • Hydrogen bonds from between hydrogen atoms and other atoms Biochemistry • What’s so special about carbon? • Carbon has 4 electrons in it’s outer shell so it can form 4 bonds • Carbon is found in all of the macromolecules such as • Proteins • Lipids (fats) • Carbohydrates • Nucleic acids (DNA material) Biochemistry • What’s so special about water? • Water (hydrogen atoms + oxygen atoms) is a polar molecule • Polarity refers to the distribution of electrons between two atoms (that are sharing their electrons) • Water is considered polar because the hydrogen atom’s electrons are shared UNEQUALLY with the oxygen atom’s electrons • Polar Nonpolar Biochemistry • What’s so special about water? • It’s attracted to some substances and it repels others • Hydrophobic: water-hating. These substances don’t mix with water • Ex: Oil • Hydrophilic: water-loving. These substances DO mix and dissolve in water • Ex: Sugar Biochemistry • What’s so special about water? • Water is a natural buffer, meaning it stabilizes the pH of substances • Acid: any substance that releases hydrogen ions (H+) when dissolved in water • Ex: lemon juice, hydrochloric acid • Base: any substance that releases hydroxide ions (OH-) when dissolved in water • Ex: ammonia, bleach Biochemistry • What’s so special about water? • Water molecules have sticky properties • Adhesion: when water sticks to other surfaces • Think: water sticking to your car windshield • Cohesion: when water molecules stick to one another • Think; water forming droplets • Surface tension: when water forms a surface that resists external forces • Think: belly flopping off the diving board • Capillary action: when water flows against gravity up a plant stem • Think: paper towel soaking up water Biochemistry • Macromolecules • Proteins • Lipids • Carbohydrates • Nucleic acids • Made up of monomers (building blocks) • Macromolecules build together to make cell structures, which build together to make us! Biochemistry • Proteins • Monomer: amino acid • Elements that make up proteins: carbon (C), nitrogen (N), oxygen (O), hydrogen (H) and sometimes sulfur (S) • Function/propose: make up muscles, act as markers on cells (identify the cell as a special type), act as enzymes that speed up reactions, fight disease and transport materials into and out of cells • Reaction: amino acids are joined together through a reaction called dehydration synthesis. Two amino acids are joined together by a bond called a peptide bond Biochemistry • Amino acids are made up of a central carbon that is attached to a carboxyl group (COOH), a hydrogen, an amino group (NH2) and a “R” group • R groups differ from one amino acid to another, making each amino acid unique • There are 20 amino acids in existence Alanine Serine Biochemistry • When amino acids join together (through a reaction called dehydration synthesis, and by a bond called a peptide bond), they from a polypeptide • A polypeptide is a chain of amino acids • Polypeptides=proteins Biochemistry • Enzymes are types of proteins. Their job is to speed up reactions and act as catalysts. • Enzymes fit, like a lock and key, with a substrate. The place where they join is called the activation site. • A substrate is what the enzymes acts on. • EX: lactose intolerance • Lactose is a sugar found in dairy products. Normally, there is an enzyme that occurs naturally in a person’s body. When they consume dairy products, and their body is filled with the lactose sugar, the enzyme lactase acts on the lactose sugar and breaks it down so it can be digested. People with lactose intolerance are lacking the enzyme (or it doesn’t function properly) lactase, so when they eat dairy products and take in the lactose sugar, they are unable to digest it and they have stomach “issues” as a result. Biochemistry • This is not the only function of enzymes. • Enzymes also speed up reactions so that your body doesn’t have to use all of it’s energy (that it gets from breaking down food) on simple tasks like breathing. • Enzymes are never used up, but can be affected by things like pH, temperature and salt concentration. These things can alter an enzyme’s shape, making it impossible for the substrate and the enzyme to fit properly. Biochemistry • Lipids are fats, oils, steroids, and waxes • Monomer: Fatty acid • Elements: Carbon (C), hydrogen (H), Oxygen (O). They have HIGH amount of hydrogen atoms (for every 1 carbon there are 2 hydrogens) • Function/purpose: Fats provide cells with protection and insulation, steroids are our hormones, waxes provide waterproof coverings (ear wax or waxy plant leaves like ivy). Lipids make up the cell membrane (lipid bilayer!) Biochemistry • Different types of lipids • Saturated: fats that have single (covalent) bonds between the carbon atoms • Unsaturated: fats that have some double (covalent) bonds between the carbon atoms. The electrons are shared twice, in a sense. • Polyunsaturated: fat that have many double (covalent) bonds between the carbon atoms. Biochemistry • Carbohydrates • Monomer: monosaccharide • Elements: Carbon (C), Hydrogen (H) and Oxygen (O) • Function/propose: main source of energy for the body • Reaction: Dehydration synthesis joins two monosaccharides together. Biochemistry • Disaccharides: two monosaccharides joined together • Polysaccharides: many monosaccharides joined together Biochemistry • Nucleic acids • Monomer: nucleotide • Elements: Carbon (C), Oxygen (O), Nitrogen (N), Phosphorus (P), and Hydrogen (H) • Base: Adenine, thymine, cytosine, and guanine • Sugar: a monosaccharide • Phosphate bonded to 3 hydrogens • Function/purpose: DNA (the heredity molecule that stores genetic information, RNA (like DNA’s simpler form), ATP and NAD (energy storing molecules involved in photosynthesis and cellular respiration reactions) Biochemistry • Two types of bases: pyrimidine and purines. • Adenine (A) and guanine (G) are purines • Thymine (T) and cytosine (C) are pyrimidine Cells • The cell membrane • Function: to control what enters and exits the cell • Composition: a phospholipid bilayer (two layers of fats) • Arranged tail to tail Cells • Also embedded in the cell membrane are • Proteins: help large molecules move into and out of the cell • Peripheral protein: on the surface of the cell (mostly involved in cell identification and recognition) • Integral protein: go the entire way through the membrane (helps molecules get into and out of the membrane, like a tunnel!) • Cholesterol: makes the membrane more rigid Cells • Transport into and out of the cell • Passive transport: doesn’t require energy • Molecules move by diffusion: the movement of molecules from a high concentration to a low concentration • THINK: does it take energy to ride a bike from high on a mountain to low on a mountain? • Solute: the solid substance being dissolved (sugar, salt etc.) • Solvent: the liquid substance doing the dissolving (usually water) Cells • Diffusion occurs when a “system” is not a equilibrium • Equilibrium is when all things are equal • Solutes move from high low until there is an equal amount on each side (of the cell, inside/out) • Things that affect diffusion • Temperature: a system at a higher temperature will cause diffusion to occur more quickly. THINK: does hot chocolate powder dissolve faster in hot water or cold water? • Size: larger solute molecules diffuse slower into/out of a system or a cell. THINK: human running through a jell-o wall vs. an ant Cells • Osmosis is the diffusion of specifically WATER into or out of a cell • Cells need water to live but too much water can be fatal • Types of tonicity • Hypertonic solutions: cause the cell to shrink because water is leaving the cell. • Why is water leaving? The concentration of water inside the cell is greater than the concentration of water outside of the cell, so the water moves from high to low OUT OF THE CELL • Hypotonic solutions: cause the cell to swell because water is entering the cell. • Why is water entering? The concentration of water inside the cell is lesser than the concentration of water outside the cell, so the water moves from high to low INTO THE CELL Cells • Isotonic solution: water moves into and out of the cell at an equal rate Cytosol is the gel-like fluid inside a cell (in this case, a red blood cell) Cells • Facilitated diffusion: molecules that need help crossing the membrane use proteins as tunnels. They still move from a high concentration to a low concentration. Glucose High concentration Phospholipid bilayer Integral protein Low concentration Low Concentration Cell Membrane High Concentration Glucose molecules Protein channel Cells • Active transport: requires energy to move molecules from a low concentration to a high concentration • THINK: does it require energy to move a bike from low on a mountain to high on a mountain? • Pumps are required to move the molecules Cells • Endocytosis - cell membrane engulfs and takes in materials • Phagocytosis - solid material taken in • Pinocytosis - liquid material take in Cells • Vesicles, sacs that are carrying either solid or liquid materials, fuse with the cell membrane and release their contents or take in contents Cells • Types of cells • Prokaryotic cells: cells that lack a nucleus and other internal organelles. • Ex: bacteria • Eukaryotic cells: cells that contain a nucleus and other internal organelles • Ex: plant cells and animal cells • Organelles: “tiny organs” inside the cell that help the cell carry out various processes and functions to keep it alive Organelles • Cell membrane • Found in both plant and animal cells (and prokaryotic cells like bacteria) • Surrounds the cell and provides protection • Controls what enters and exits the cell Organelles • Cell wall • Found surrounding plant cells (eukaryotic) and bacteria cells (prokaryotic) • Provides extra support and structure for the cell Organelles • Nucleus • Found in both plant and animal cells • Brain of the cell. Controls all cell functions. Where DNA is located • Has a membrane around it, called the nuclear membrane • Material (such as RNA) can enter and leave the nucleus • Has an inner core known as the nucleolus where ribosomes are made Organelles • Mitochondria • Found in both plant and animal cells • Known as the powerhouse of the cell because it makes energy for the cell. Involved in cellular respiration. • Has two membranes surrounding it • Has folds inside, which are called cristae Organelles • Vesicles • Found in both plant and animal cells • Small sacs or pouches that transport materials around the cell • Involved in exocytosis and endocytosis • Types • Peroxisomes: found in both plant and animal cells. They break down fatty acid chains • Lysosomes: found in only animal cells. Contain digestive enzymes that help clean up the cell Organelles • Ribosomes • Found in both plant and animal cells • Made by the nucleolus • Attach themselves to the rough endoplasmic reticulum • Responsible for attaching to RNA and aiding in translation, which is the process of making proteins Organelles • Rough endoplasmic reticulum • Called rough ER for short • Found in both plant and animal cells • Responsible for transporting proteins. • Smooth endoplasmic reticulum • Called the smooth ER for short • Found in both plant and animal cells • Responsible for breaking down fats and toxic substances Organelles Organelles • Golgi body (apparatus) • Found in both plant and animal cells • Responsible for modifying proteins that are made by the rough ER and ribosomes and then packaging them for distribution by vesicles Organelles • Chloroplasts • Found only in plant cells • Responsible for preforming photosynthesis • Green in color because they contain the pigment chlorophyll Organelles • Vacuole • Found in both plant and animal cells • Responsible for storing water and other important materials • Can expand or shrink depending on the needs of the cell PHOTOSYNTHESIS Reactants Sunlight + 6CO2 + 6H2O C6H12O6 + 6O2 Products Photosynthesis • The process of taking light energy and converting it into chemical energy ( sugars) • 3 stages of photosynthesis • Energy capture from sunlight • Light energy is converted into chemical energy and stored in a molecule of ATP or NADPH • Chemical energy stored in ATP or NADPH is used to make organic compounds ( sugars) ATP A nucleotide with two extra energy-storing phosphate groups H20 + ATP ADP + P + energy Water + ATP adenosine diphosphate + phosphate + energy Cell use the energy released by this reaction to power metabolism. Plant parts • Stomata: openings in plant leaves and stems where gas exchange occurs • Mesophyll: plant tissues • Chloroplasts: organelle that does photosynthesis Stroma: gel-like fluid inside chloroplasts Granum: stacks of thylakoids Thylakoid: site of photosynthesis Lumen: empty space inside thylakoid What is chlorophyll? • A pigment that absorbs red and blue light, and reflects green light • This is why plants appear green • Chlorophyll is responsible for capturing the energy from the sun Photo 1- light dependent reactions • Stage 1 • Energy capture from sunlight • Pigments are in disc-shaped structures called thylakoids • When light strikes a thylakoid, energy is transferred to electrons in chlorophyll • This causes the electrons to have extra energy, they are said to be “excited” Photo 1- light dependent reactions • Excited electrons jump to other molecules in the thylakoid membrane • The electrons that left must be replaced • They are replaced by e- from water splitting apart • The oxygen left over is released into the atmosphere as gas (we breathe it!) 1. Light strikes thylakoid=excites electrons EEE- O2 gas H+ electrons H2O Thylakoid 2. H20 splits a part. H+ is used to replace the electrons. O2 is released into the atmosphere • Stage 2 • Electron transport chains move the excited electrons along the thylakoid membrane Photo 2- light dependent reactions • Electron transport chains • Excited electrons pass through pumps in the thylakoid membrane. They lose some of their energy • That energy is used to pump hydrogen (H+) ions into the thylakoid • This creates a higher concentration of H+ inside than outside, so they DIFFUSE back out of the thylakoid 2. The energy is used to pump H+ ions into the thylakoid 1. Electrons leave the thylakoid. This creates energy EEE- H+H+ H+H+ Thylakoid 3. H+ ions diffuse out. This triggers the ATP reaction Photo 2- light dependent reactions • The H+ ions pass through carrier proteins in the membrane. (facilitated diffusion) • The carrier proteins create a reaction in which a phosphate group is added to the chemical ADP, making ATP! • This ATP is used to power the third stage of photosynthesis Thylakoid ADP + P ATP Photo 2- light dependent reactions • There is a second electron transport chain that provides energy to make another chemical called NADPH • NADPH is an electron carrier that provides the high energy electrons needed to make carbon-hydrogen bonds in the third stage of photosynthesis Overview of light dependent reactions • Pigment molecules in the thylakoids of chloroplasts • • • • absorb light energy Electrons in the pigments are excited by light and move through electron transport chains in the thylakoid membranes These electrons are replaced by electrons from water molecules which are split Oxygen atoms and from water splitting combine to form oxygen gas Hydrogen ions accumulate inside thylakoids and then diffuse out which provides the energy to make ATP Stage 3-light independent reactions • Does not require light • Carbon atoms from carbon dioxide (in the atmosphere) are used to make organic compounds sugars! • Carbon dioxide fixation: transfer of carbon dioxide to organic compounds Photo 2- Light independent reactions Stage 3 The Calvin cycle (4 steps) 1. in carbon dioxide fixation, each molecule of carbon dioxide (CO2) is added to a five-carbon compound by an enzyme. 2. The resulting six-carbon compound splits into 2 3-carbon compounds. Phosphate groups from ATP and electrons from NADPH are added to these compounds, forming three-carbon sugars 3. One of the resulting three-carbon sugars is used to make organic compounds (starch and sucrose) which is stored by the organism 4. The other three-carbon sugars are used to regenerate the initial five-carbon compound, completing the cycle 1.C-C-C-C-C 2.CO2 + C-C-C-C-C 3. C-C-C Stored as sugar for plant to use as food C-C-C Starts the carbon dioxide fixation process over again Factors that affect photosynthesis • The rate of photosynthesis increases as the intensity of light increases, until all the pigments are being used. • At this “saturation point”, the Calvin cycle cannot move any faster • Same thing happens after the saturation point of carbon dioxide is reached OVERVIEW • Changing light energy into chemical energy • Requires CO2 and H2O • Oxygen and glucose are the products CELLULAR RESPIRATION Transferring energy from organic compounds (sugars) to ATP Stages of Cellular Resp. • Stage 1: Called Glycolysis. Glucose is broken down into a compound called pyruvate, producing a small amount of ATP and NADH • Stage 2: Has different names depending on if oxygen is present and used in the process • Krebs Cycle: aerobic, oxygen is present • Fermentation: anaerobic, oxygen is absent Stage 1: glycolysis • Glucose is broken down in the CYTOPLASM (gel-like fluid that surrounds all the organelles inside the cell) • Does not require oxygen, anaerobic • NADH plays the same role in cellular respiration that it did in photosynthesis • It’s an electron carrier Steps of glycolysis • 1) phosphate groups from 2 ATP molecules are transferred to a glucose molecule • 2) the resulting 6-carbon compound is broken down into 2, 3-carbon compounds, each with a phosphate group • 3) two NADH molecules are produced • 4) each 3-carbon compound is converted to a 3-carbon pyruvate, producing 4 ATP molecules Stage 1: glycolysis • Glycolysis uses 2 ATP, but generates 4 • Glycolysis is followed by another set of reactions that use the energy temporarily stored in NADH to make more ATP Glycolysis reactants & products Stage 2: Aerobic • Aerobic means that oxygen is required to run the process • We call aerobic respiration of stage 2, the Kreb’s Cycle Kreb’s Cycle • 1) Acetyl-CoA combines with a 4-carbon compound, forming a 6-carbon compound and releasing coenzyme A Kreb’s Cycle • 2) carbon dioxide, CO2, is released from the 6-carbon compound, forming a 5-carbon compound. Electrons are transferred to NAD+, making a molecule of NADH • 3) carbon dioxide is released from the 5-carbon compound, resulting in a 4-carbon compound. A molecule of ATP is made, and a molecule of NADH is also produced Kreb’s Cycle • 4) the existing 4-carbon compound is converted to a new 4-carbon compound. Electrons are transferred to an electron acceptor called FAD, making a molecule of FADH2 (electron carrier) • 5) The new 4-carbon compound is then converted to the 4-carbon compound that began the cycle. Another molecule of NADH is produced Chemicals and their jobs • Electron Acceptors: NAD+ and FAD • Electron Carriers: NADH and FADH2 • Chemical form of energy: ATP • Equations • NAD+ + electron NADH • FAD + electron FADH2 • ADP + P ATP Electron Transport Chains • 1) Hydrogen ions (H+) are pumped out of the inner part of the mitochondria • 2) Electrons and hydrogen ions combine with oxygen, forming water • 3) ATP is produced as hydrogen ions diffuse into the inner part of the mitochondria through a channel protein (facilitated diffusion) Stage 2: anaerboic • Anaerobic means that oxygen is not required to run the process • Anaerobic respiration occurs when there is not enough oxygen to run the Kreb’s Cycle • This process is called Fermentation. There are two types • Lactic Acid Fermentation • Alcoholic Fermentation • In this process, NAD+ is recycled and allows glycolysis to continue. A small amount of ATP is produced Lactic Acid Fermentation • A 3-carbon pyruvate is converted to a 3-carbon lactate through lactic acid fermentation • Lactate is the ion of an organic acid called lactic acid • Fermentation enables glycolysis to continue producing ATP as long as the glucose supply lasts. • Lactic acid builds up in your muscles and is removed by your blood. Lactate can build up in your muscle cells if it is not removed quickly enough, sometimes causing sore muscles! • Bacteria and other animals that are anaerobic use LAF Alcoholic Fermentation • The 3-carbon compound pyruvate is broken down to ethanol, a 2-carbon compound. • Carbon dioxide is released during the process • Alcoholic fermentation by yeast, a fungus, has been used in the preparation of many foods and beverages • Wine and beer making • Carbon dioxide released by yeast causes dough to rise Carbon dioxide released by yeast causes carbonation in beer ATP Production • Glycolysis: 2 ATP molecules gained • Aerobic respiration: 2 ATP molecules gained • Electron transport chain: 34 ATP molecules gained •TOTAL= 38 • Fermentation produces a small amount of ATP DNA • Name: Deoxyribonucleic Acid • Structure: • Double helix “twisted ladder” • Phosphate and sugar “backbone” • Nitrogen bases that form complimentary pairs • Adenosine (A) Thymine (T) • Guanine (G) Cytosine (C) • Hydrogen bonds join the bases together • A and G are purines • T and C are pyrimidines DNA DNA • Function: • Carries a genetic code (order of the bases like agctatgca…) • This genetic code is the recipe for how to make specific proteins • Those proteins assemble into parts of the cell and body to make up unique traits such as hair color, eye color and skin color DNA • Genes • Genetic code: the order of the bases. • Different order=different people and even different species! • Gene: a segment of DNA that codes for a protein • Chromosome: a long chain of DNA all coiled up • Humans have 46 chromosomes, each with 1,000’s of genes on them • Other species have different amount of chromosomes DNA • Making more DNA= DNA replication • DNA needs to make copies of itself so that every new cell that is made, has a copy of DNA • You make new cells all the time (new skin cells daily!) • How does DNA replicate? • 1. An enzyme, called DNA helicase, binds to DNA and unzips it • 2. DNA helicase unzips the DNA molecule by breaking hydrogen bonds between the bases • 3. Another enzyme, DNA polymerase, binds to DNA and adds NEW bases to each side of the DNA “ladder” ATGGCTAATCCGT TACCGATTAGGCA TAGGCCT DNA helicase ATCCGGA ATGGCTAATCCGTTAGGCCT TACCGATTAGGCAATCCGGA TACCGATTAGGCAATCCGGA DNA polymerase ATGGCTAATCCGTTAGGCCT DNA • Sometimes, DNA polymerase makes mistakes • A G by accident! • Proof-reader enzymes are responsible for checking the newly added strand for such mistakes DNA • One of DNA’s roles is the recipe for making protein • How does DNA make proteins? • First off, DNA cannot leave the nucleus. Proteins can only be made in the cell’s cytoplasm and if DNA enters the cytoplasm, it will start to break down. • So, to solve this problem, the cell uses another molecule that is similar to DNA. This molecule carries DNA’s recipe or message into the cytoplasm so that proteins can be made • The molecule is called RNA RNA • Name: Ribonucleic Acid • Structure: • A single helix (one sided “ladder”) • A phosphate and sugar “backbone” • Nitrogen bases that form complimentary pairs • Adenosine Uracil (NOT THYMINE) • Guanine Cytosine Transcription • Transcription occurs when RNA makes a copy of DNA • Why does this happen? Because DNA cannot leave the nucleus, and protein are made OUTSIDE of the nucleus, in the cell’s cytoplasm • Steps • 1. DNA is unzipped by the enzyme DNA helicase • 2. The enzyme RNA polymerase, begins to add complimentary RNA bases to ONE STRAND of DNA • 3. The newly made RNA strand detaches, and leave the nucleus • This strand of RNA is specifically called messenger RNA, or mRNA Transcription Translation/protein synthesis • What happens to RNA after it leaves the nucleus? • It travels into the cell’s cytoplasm and the process of translation begins. • Translation is also called protein synthesis (the making of proteins) • What are the steps of translation? • 1. mRNA hooks up to a ribosome • 2. A different type of RNA, transfer RNA (tRNA) brings complimentary bases and attaches to the mRNA • 3. tRNA is also carrying amino acids. Amino acids are the building blocks for proteins • 4. When the bases of mRNA and tRNA are joined, the amino acid carried by tRNA pops off • 5. Amino acids start to form chains, called polypeptides (a.k.a proteins) Translation/protein synthesis • When tRNA attaches to mRNA, it does so through anticodons • mRNA has codons, which are a group of 3 bases • AUG • tRNA has anticodons, which are a group of 3 bases that are complimentary to the codons on mRNA • UAC • A codon is what “codes” for one amino acid • mRNA codons • Amino acids Translation/protein synthesis • Amino acids • There are 20 amino acids • Some codons “code” for the same amino acid • Some codons “code” for the cell to stop or start producing amino acids tRNA Nucleus Amino acid mRNA Anticodon Cytoplasm Ribosome Chain of amino acids= polypeptide Mutations • There can be mistakes that occur along the way • During DNA replication • During Transcription • During Translation • Types of mutations • Point mutations-one base of DNA/RNA is altered • Substitution, insertion, deletion • Can cause a frame-shift mutation • Chromosome mutation-a segment or whole chromosome is altered Mutations • Substitution: when one base is substituted for another • Deletion: when one, or more, base is deleted • Insertion: when one, or more, base is added • Both insertions and deletions can cause frame-shift mutations • Frame-shift mutations cause codons to be read differently. These changes can cause different amino acids to be coded for, which will lead to incorrect protein assembly Mutations • Chromosome mutations • Deletion- part of a chromosome is deleted • Duplication- part of a chromosome is doubled • Inversion- part of a chromosome flips around and reattaches • Translocation- non- homologous pairs exchange chromosome segments