Download Get PDF - Wiley Online Library

Blackwell Science, LtdOxford, UKMMIMolecular Microbiology0950-382XBlackwell Publishing Ltd, 2005? 200556512201233Original ArticleCPCR1 controls morphological differentiation in A. chrysogenumB. Hoff, E. K. Schmitt and U. Kück
Molecular Microbiology (2005) 56(5), 1220–1233
doi:10.1111/j.1365-2958.2005.04626.x
CPCR1, but not its interacting transcription factor
AcFKH1, controls fungal arthrospore formation in
Acremonium chrysogenum
Birgit Hoff, Esther K. Schmitt† and Ulrich Kück*
Lehrstuhl für Allgemeine und Molekulare Botanik,
Ruhr-Universität, Universitätsstraße 150, D-44780
Bochum, Germany.
fungal growth in biotechnical processes that require
defined morphological stages for optimal production
yields.
Introduction
Summary
Fungal morphogenesis and secondary metabolism
are frequently associated; however, the molecular
determinants connecting both processes remain
largely undefined. Here we demonstrate that CPCR1
(cephalosporin C regulator 1 from Acremonium
chrysogenum), a member of the winged helix/regulator factor X (RFX) transcription factor family that regulates cephalosporin C biosynthesis, also controls
morphological development in the b-lactam producer
A. chrysogenum. The use of a disruption strain, multicopy strains as well as several recombinant control
strains revealed that CPCR1 is required for hyphal
fragmentation, and
thus
the
formation
of
arthrospores. In a DcpcR1 disruption strain that
exhibits only hyphal growth, the wild-type cpcR1 gene
was able to restore arthrospore formation; a phenomenon not observed for DcpcR1 derivatives or nonrelated genes. The intracellular expression of cpcR1,
and control genes (pcbC, egfp) was determined by in
vivo monitoring of fluorescent protein fusions. Further, the role of the forkhead transcription factor
AcFKH1, which directly interacts with CPCR1, was
studied by generating an Acfkh1 knockout strain. In
contrast to CPCR1, AcFKH1 is not directly involved in
the fragmentation of hyphae. Instead, the presence of
AcFKH1 seems to be necessary for CPCR1 function
in A. chrysogenum morphogenesis, as overexpression of a functional cpcR1 gene in a DAcfkh1 background has no effect on arthrospore formation.
Moreover, strains lacking Acfkh1 exhibit defects in
cell separation, indicating an involvement of the forkhead transcription factor in mycelial growth of A.
chrysogenum. Our data offer the potential to control
Accepted 18 February, 2005. *For correspondence. E-mail:
[email protected]; Tel. (+49) 234 322 6212; Fax
(+49) 234 321 4184. †Present address: Novartis Institutes of BioMedical Research, Natural Product Unit, 4002 Basle, Switzerland.
© 2005 Blackwell Publishing Ltd
Conidiospores and arthrospores occur regularly during
the asexual cycle of many filamentous fungi. However,
they can clearly be distinguished from each other due to
their morphology and formation. Conidia arise from the
ends of conidiophores which are formed laterally from
substrate hyphae. In contrast, uni- or bicellular
arthrospores, also called ‘yeast-like’ cells, are generated
by direct fragmentation of swollen substrate hyphae during prolonged cultivation under limited nutrient supply
(Nash and Huber, 1971; Queener and Ellis, 1975).
Arthrospores represent metabolically active cells enriched
with intracellular organelles and lipid-containing vacuoles
(Bartoshevich et al., 1990). Recent studies show that
physiological changes during cultivation such as methionine addition or glucose depletion stimulate the formation
of arthrospores (Caltrider and Niss, 1966; Drew et al.,
1976; Karaffa et al., 1997; Sándor et al., 2001; Tollnick
et al., 2004). In the b-lactam producer A. chrysogenum
the differentiation into arthrospores coincides with the
maximum rate of cephalosporin C biosynthesis. Beside
that, arthrospore formation seems to be correlated with
high-yield cephalosporin C production (Nash and Huber,
1971; Bartoshevich et al., 1990). However, the molecular
mechanisms controlling hyphal fragmentation and
arthrospore formation remain mostly undefined.
Compared with pure vegetative growth, sporulation and
secondary metabolism were observed to require more
defined growth conditions (Sekiguchi and Gaucher, 1977).
In Aspergillus nidulans, a molecular link between asexual
sporulation and secondary metabolism was recently
reported (for review, see Calvo et al., 2002). A signalling
pathway including fadA and flbA, which encode a Ga subunit and its regulatory GTPase activating protein, respectively, regulates negatively secondary metabolite
production and conidiation at least in part via a cAMPdependent protein kinase catalytic subunit (PkaA) (Hicks
et al., 1997; Shimizu and Keller, 2001). The expression of
aflR, a gene coding for a regulator of sterigmatocystin
CPCR1 controls morphological differentiation in A. chrysogenum
biosynthesis, and brlA, encoding a conidiation-specific
transcription factor, are inhibited by activated FadA
(Adams et al., 1988; Yu et al., 1996). Recently, it has also
been described that the dominant activating fadA allele
stimulates transcription of the ipnA penicillin biosynthesis
gene from A. nidulans and increases penicillin production
(Tag et al., 2000). Because of the ubiquitous nature of the
G-protein signalling pathway in higher organisms, it
seems likely that A. nidulans has selected this pathway to
link morphogenesis with secondary metabolism. The
same mechanism can operate in other fungi that synthesize natural products at the onset of sporulation as was
shown for trichothecene production in Fusarium sporotrichioides (Tag et al., 2000). However, this signalling pathway might not be the only mechanism to co-ordinate
secondary metabolism and sporulation, as in shaking
submerged cultures, Aspergillus does not sporulate but
still produces mycotoxins. These examples underline the
complex nature of mutual connections between different
cellular processes in fungi (Calvo et al., 2002).
In A. chrysogenum, the biosynthesis of cephalosporin
C consists of eight enzymatic steps, which are catalysed
by seven different enzymes. The biosynthesis genes are
organized as three pairs of divergently oriented genes that
are localized in two clusters. Each gene pair encloses a
regulatory region affecting expression of either of the two
genes or of both genes simultaneously (Menne et al.,
1994; Ullán et al., 2002). The biosynthesis of cephalosporin C is not constitutive, but is subject to a complex
regulatory network. The transcription level of the biosynthesis genes greatly controls titres of antibiotic production
(Litzka et al., 1999). Therefore, transcription factors seem
to be important mediators of internal and external parameters affecting b-lactam biosynthesis (Schmitt et al.,
2004a).
Recently, four transcription factors involved in secondary metabolism have functionally been characterized from
A. chrysogenum. This includes the carbon catabolite
repressor CRE1, the pH-dependent regulator PACC, as
well as CPCR1 (cephalosporin C regulator 1 from A.
chrysogenum) and AcFKH1 (forkhead transcription factor
1 from A. chrysogenum), two members of subfamilies of
winged helix transcription factors (Jekosch and Kück,
2000; Schmitt and Kück, 2000; Schmitt et al., 2001;
2004b). Among filamentous fungi, the two latter proteins
were the first to be discovered in the b-lactam antibiotic
producer A. chrysogenum. The CPCR1 protein belongs
to the conserved family of eukaryotic regulatory factor X
(RFX) transcription factors (Emery et al., 1996; Gajiwala
and Burley, 2000) and binds to regulatory sequences in
the promoter region of the cephalosporin C biosynthesis
genes pcbAB-pcbC (Schmitt and Kück, 2000). So far, the
characterization of CPCR1 has shown its direct involvement in the transcriptional regulation of the early cepha© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
1221
losporin C biosynthesis gene pcbC (Schmitt et al., 2004c).
Transcription factor AcFKH1 was identified as an interacting partner of the CPCR1 protein using the yeast hybrid
system, in vitro GST pull-down assays and bimolecular
fluorescence complementation (Schmitt et al., 2004b;
Hoff and Kück, 2005). AcFKH1 belongs to the family of
forkhead proteins and is characterized by two conserved
domains, the forkhead-associated domain (FHA), which
might be involved in phospho-protein interactions, and the
C-terminal forkhead DNA-binding domain (FKH). AcFKH1
recognizes two forkhead consensus binding sites within
the pcbAB-pcbC promoter (Schmitt et al., 2004b).
In this study, we demonstrate that the RFX transcription
factor CPCR1 is the first known regulator of morphogenesis in A. chrysogenum. Detailed microscopic analyses determined that the CPCR1 protein is required for
arthrospore formation in this b-lactam producer. In contrast, the interacting forkhead transcription factor AcFKH1
is not directly involved in the fragmentation of A. chrysogenum hyphae. Our results lead to the assumption that
CPCR1, likely in the form of a heterodimer with AcFKH1,
can be a molecular link between secondary metabolism
and fungal arthrospore formation. A greater knowledge of
determinants regulating hyphal morphology offers the
potential to control fungal growth in production processes,
which require a defined morphological stage for optimal
synthesis of secondary metabolites.
Results
Fungal recipient strains for investigating arthrospore
formation in A. chrysogenum
Acremonium chrysogenum strain A3/2 was selected from
a strain-improvement programme for its significantly
higher rate of cephalosporin C biosynthesis (about 100fold) (Radzio and Kück, 1997) compared with the
wild-type strain, and was used as recipient for our investigations. This strain is further characterized by the inability to generate any conidiospores, which were described
for the wild type (Onions and Brady, 1987). Further, knockout strain DcpcR1, which was obtained by transforming
A3/2 with a cpcR1::hph construct (Schmitt et al., 2004c),
served as recipient for the generation of different recombinant strains.
To determine the role of AcFKH1 in fungal morphogenesis, we constructed a DAcfkh1 knockout in A3/2. The
forkhead protein AcFKH1 interacts directly with the RFX
transcription factor CPCR1 in A. chrysogenum and they
individually bind common promoters of cephalosporin C
biosynthesis genes (Schmitt et al., 2004b). An Acfkh1
deletion strain was generated by transformation of the A.
chrysogenum semi-producer A3/2 with plasmid
pKOFKH1, in which sequences encoding amino acids
1222 B. Hoff, E. K. Schmitt and U. Kück
cpcR1 gene was amplified in both strains using specific
oligonucleotides (PCRcpcR1d).
Additionally, Southern hybridization using an Acfkh1
gene fragment as probe confirmed that the wild-type gene
has been replaced by the Acfkh1::hph disruption allele
(Fig. 1C). Only DAcfkh1 displayed a genomic restriction
pattern consistent with deletion of the Acfkh1 locus and
integration of a single copy of the knockout plasmid. This
pattern is clearly different from the one that was obtained
with recipient A3/2 and two transformants (T133, T25),
carrying multiple copies of the ectopically integrated
knockout plasmid pKOFKH1.
254–539 of the Acfkh1 gene were replaced by a hph
cassette as selectable marker (Fig. 1A). Plasmid
pKOFKH1 was previously digested at the EcoRI restriction
sites to increase the frequency of homologous integration
at the Acfkh1 locus in A. chrysogenum. One hundred and
twenty-four hygromycin B-resistant transformants were
screened by analytical polymerase chain reaction (PCR)
for the double cross-over event.
One strain was identified that displayed genomic alterations consistent with replacement of the Acfkh1 locus
with the hph disruption construct. As seen in Fig. 1B,
PCR1 resulted in a 0.8 kb amplicon from the Acfkh1 gene
in recipient A3/2, while the transgenic strain DAcfkh1
yielded a 1.4 kb fragment (PCR1*) representing the hph
cassette located between these two primers. Using primer
pair 3 ¥ 4, a 0.7 kb fragment (PCR2) was amplified from
recipient A3/2. A dashed line in Fig. 1A (PCR2*) indicates
the lack of an amplicon in disruption strain DAcfkh1, as
binding of primer 3 was prevented due to the homologous
integration of pKOFKH1 into genomic DNA, and thus,
deletion of the Acfkh1 gene sequence. As control for the
functionality of the PCR reaction, a 0.6 kb fragment of the
Deletion of the cpcR1 gene prevents arthrospore
formation in A. chrysogenum
During cultivation of the DcpcR1 knockout strain, significant macroscopical differences concerning mycelial
growth were observed in liquid batch cultures compared
with the A3/2 recipient and DAcfkh1. The same phenotype
was observed when we investigated two other independently isolated DcpcR1 deletion strains (Schmitt et al.,
A
StuI
32
P-Acfkh1
EcoRI
WT
StuI
EcoRI
Acfkh1
7.6 kb
PCR1
1
2
3
PCR2
4
PCR3
5
4
StuI
EcoRI
StuI
DAcfkh1
EcoRI
hph
8.2 kb
PCR1*
2
3
4.0
3.0
2.0
1.5
1.0
0.7
0.5
A3/2
DAcfkh1
5x4
A3/2
DAcfkh1
A3/2
A3/2
DAcfkh1
kb
DAcfkh1
10.0
8.0
T25
P-Acfkh1
A3/2
kb
3x4
DAcfkh1
32
B
PCRcpcR1d
300 bp
4
C
1x2
4
PCR2*
PCR3*
5
T133
1
Fig. 1. Disruption of the Acfkh1 gene in
A. chrysogenum.
A. Schematic representation of the Acfkh1
genomic locus before (WT) and after homologous integration (DAcfkh1) of an hph cassette.
The orientation of the Acfkh1-ORF and hphORF is indicated by a black and white arrow
respectively. 1–5 represent oligonucleotides
used in three different PCR experiments to confirm Acfkh1 gene disruption. The grey bar
above denotes the Acfkh1 region, which is used
as probe for Southern analysis.
B. Agarose gel electrophoresis showing the
PCR amplicons obtained with primer pairs
1 ¥ 2, 3 ¥ 4 and 5 ¥ 4 (A) and genomic DNAs
isolated from the recipient A3/2 and the knockout strain DAcfkh1 as templates. As control, a
0.6 kb fragment of the cpcR1 gene was amplified in both strains using oligonucleotides
cpcR1D1s and cpcR1D1a (PCRcpcR1d). In all
cases, PCR reactions were performed without
DNA as control (/).
C. Southern analysis of the recipient A3/2, the
knockout transformant DAcfkh1, and two transgenic strains (T133, T25), carrying multiple copies of the ectopically integrated knockout
plasmid pKOFKH1. The genomic DNAs were
digested with StuI and hybridized with a radiolabelled fragment of the Acfkh1 gene (A). The
knockout strain DAcfkh1 gave the predicted
band size of 8.2 kb, resulting from the homologous integration event depicted in (A).
6.0
5.0
4.0
3.5
3.0
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
CPCR1 controls morphological differentiation in A. chrysogenum
2004c) (Fig. S1). For example, the formation of aggregated mycelium seemed to be different in the DcpcR1
strains (data not shown). To better analyse the cellular
morphology of these fungal strains during prolonged
batch cultivation, light microscopic analyses were performed and growth curves were produced in order to
quantify the microscopic observations. Figure 2A presents representative micrographs taken from the recipient
A3/2 as well as the knockout strains DcpcR1 and DAcfkh1
after a period of 48–168 h of cultivation. In liquid shaken
culture (180 r.p.m.), the mycelium of recipient A3/2 typically consists of branched and septated filaments which
display defined stages of vacuolation. After 96 h of cultivation, A. chrysogenum filaments swell, lay down additional septa and are highly vacuolated. After 120 h, a
nearly complete fragmentation of hyphae was observed.
The amount of round-ended short hyphal fragments with
one or two cell compartments (inset of Fig. 2A) was significantly increased, whereas branched, long vegetative
hyphal filaments disappeared. The same phenotype was
observed in the A. chrysogenum wild-type strain (ATCC
14553) after 168 h of cultivation (Fig. S2). This fragmentation is an active developmental process in cellular differentiation of A. chrysogenum and results in the
formation of spherical cells called arthrospores (Nash and
Huber, 1971; Queener and Ellis, 1975; Drew et al., 1976).
The growth characteristics of recipient A3/2 are reflected
in the corresponding growth curve depicting the biomass
expressed as mg dry cell weight per ml plotted against
cultivation time (Fig. 2B). The biomass increases rapidly
in the exponential phase of growth, reaches its maximum
at 72 h of cultivation, and decreases continuously
between 96 and 168 h in the deceleration phase (Sándor
et al., 2001). This loss of biomass correlates with the
fragmentation of hyphae.
1223
The phenotype of DcpcR1 is clearly different compared
with recipient A3/2. The mycelium of the DcpcR1 knockout
strain did not form swollen hyphae nor short bicellular or
unicellular arthrospores. Even after 168 h of cultivation,
no fragmentation of hyphae was observed; the mycelium
still comprised slender branched hyphal filaments (insets
of Fig. 2A, Table 1). The corresponding growth curve
showed significant differences compared with the recipient. The accumulated biomass was greater than that of
A3/2, which became obvious during the growth period of
72–168 h. After 168 h of batch cultivation, the DcpcR1
knockout strain acquired about 160% of the biomass of
A3/2.
A different picture is seen with DAcfkh1 (Fig. 2A). In the
first 144 h of cultivation, the mycelial morphology was
changed. The hyphae were swollen and highly septated,
but the cells remained attached to each other in a branching pattern comparable to the yeast pseudohyphal growth
(Bensen et al., 2002). The appropriate growth curve
showed that the biomass of DAcfkh1 remained nearly
constant during this period of cultivation. A loss of biomass was not observed before the fragmentation of
hyphal filaments (Fig. 2B). Only after 168 h of cultivation
this strain formed arthrospores, which accumulated after
192 h. A similar accumulation was seen in the recipient
A3/2 already after 120 h. Thus, the AcFKH1 forkhead
transcription factor seems to be involved in cell separation
of A. chrysogenum. These observations also emphasize
our assumption that the transformation event itself is not
responsible for the significant changes in mycelial morphology of the different DcpcR1 strains.
To exclude the possibility that the observed differences
concerning the arthrospore formation in A. chrysogenum
are caused by pH changes, we measured the pH value of
the culture media at all times of cultivation. As observed
Table 1. Summary of all recipient and recombinant strains as well as the corresponding results of DIC microscopic analyses.
Recipient
Transgene
24 h
48 h
72 h
96 h
120 h
144 h
A3/2
A3/2
A3/2
A3/2
A3/2
DcpcR1
–
cpcR1
Acfkh1
cpcR1–egfp
egfp
–
f
f+a
f
f
f
f
f
f+a
f
f+a
f
f
f
a
f+a
a
f
f
f+a
a
a
a
f+a
f
a
a
a
a
a
f
a
a
a
a
a
f
a
a
a
a
a
f
DcpcR1
DcpcR1
DcpcR1
DcpcR1
DcpcR1
DAcfkh1
DAcfkh1
D Acfkh1
cpcR1
cpcR1–egfp
cpcR1DBD–egfp
Acfkh1–eyfp
pcbC–egfp
–
Acfkh1
cpcR1–egfp
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f
f+a
f+a
f
f
f
f
f+a
f
a
a
f
f
f
f
a
f
a
a
f
f
f
f+a
a
f+a
a
a
f
f
f
a
a
a
f, filaments; f+a, filaments and beginning of arthrospore formation; a, arthrospores.
Shading indicates the time frame during which arthrospores can be observed.
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
168 h
1224 B. Hoff, E. K. Schmitt and U. Kück
Fig. 2. Deletion of the A. chrysogenum cpcR1
gene prevents arthrospore formation.
A. The recipient A3/2 as well as the two knockout strains DcpcR1 and DAcfkh1 were grown at
27∞C and 180 r.p.m. in liquid CCM medium over
a period of 168 h. At the assigned time (48–
168 h), mycelial morphology was analysed by
DIC microscopy and representative microscopic fields are depicted. Insets show an
enlargement (2.5-fold) of characteristic mycelial
structures and black frames indicate the beginning of arthrospore formation. Scale bar represents 40 mm.
B. Growth curves of the recipient A3/2 (black,
) as well as the knockout strains DcpcR1
(light-grey, ) and DAcfkh1 (grey, ) determined as mg dry cell weight (DCW) per ml
liquid CCM medium. pH curves collected from
cultures of the recipient A3/2 (black, ), the
DcpcR1 (light-grey, ) and the DAcfkh1 (grey,
) strains to determine the physiological environment. In all cases, three independent experiments were carried out.
DCW (mg ml–1)
B
Cultivation time (h)
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
CPCR1 controls morphological differentiation in A. chrysogenum
in Fig. 2B, the pH curves of all three strains are nearly
identical up to 120 h of cultivation. Thus, the arthrospore
formation in A3/2 after 96 h does not result from significant changes of the environmental pH. Therefore, an
involvement of the transcription factor PACC in this developmental process seems to be unlikely.
Overexpression of cpcR1 results in strains with
accelerated arthrospore formation
To further confirm the regulatory role of CPCR1 in morphogenesis, we pursued a second approach. The recipient A3/2 was transformed with four different plasmid
constructs to generate recombinant strains carrying about
three to eight additional gene copies. These fungal strains
were analysed using differential interference contrast
(DIC) microscopy and their hyphal growth was monitored
as mg dry cell weight per ml culture. The transgenic strain
A3/2:cpcR1, which contains six additional copies of the
cpcR1 gene, exhibits swollen and highly branched hyphae
already after 48 h of cultivation. After 72 h, a sudden and
complete fragmentation of the mycelium was observed
(Fig. 3, Table 1). The resulting fragments of hyphae were
short and no longer branched, and arthrospores were
formed. The strain retained this morphology for the
remaining experimental period. Further, the biomass
reached the maximum already after 48 h, and subsequently decreased drastically up to 168 h (data not
shown). In parallel, strain T13mc (Schmitt et al., 2004c)
was investigated, carrying only a single extra copy of
the cpcR1 gene. In this strain, arthrospore formation
1225
occurred already after 72 h of cultivation (Fig. S3). Strain
A3/2:cpcR1–egfp, which contains multiple copies of the
chimeric cpcR1–egfp gene under the control of the strong
gpd promoter of A. nidulans, also displayed an accelerated arthrospore formation (Fig. S4). Interestingly, a
similar effect was observed in the wild-type ATCC 14553,
carrying multiple copies of the cpcR1–egfp gene (D.
Janus, unpublished data). The expression of the transgene and the production of the recombinant protein were
demonstrated using confocal laser microscopy (Fig. 4).
This is a prerequisite to test the functionality of the protein.
Fluorescence mediated by the fusion protein was
observed in the nuclei of hyphae and arthrospores at all
cultivation times (48–168 h). Thus, overexpression of the
cpcR1 gene stimulates the arthrospore formation in A.
chrysogenum.
In the multicopy strain A3/2:Acfkh1, we determined a
slightly accelerated arthrospore formation. As can be
seen in Fig. 3, after 96 h of cultivation the strain showed
an increased number of arthrospores compared with the
recipient A3/2. To reduce the possibility that the integration
of multiple gene copies generally results in changes of the
mycelial morphology in A. chrysogenum, a control strain
was investigated, carrying multiple copies of the egfp
gene (A3/2:egfp). This strain did not show changes in
mycelial morphology (Fig. 3), indicating that only the overexpression of cpcR1 is responsible for the shape of fungal
hyphae. After analysing physiological parameters like the
pH, we observed that the values were nearly identical in
all cultures up to 96 h of cultivation. These data evidence
that the accelerated fragmentation of hyphae is not
Fig. 3. Arthrospore formation accelerates
severely in A3/2 recipient strains carrying multiple copies of the cpcR1 gene. Recipient A3/2
and the multicopy strains A3/2:cpcR1,
A3/2:egfp and A3/2:Acfkh1 were grown as
described in the legend to Fig. 2. At the
assigned time, mycelial morphology was analysed by DIC microscopy and representative
microscopic fields are depicted. Insets show an
enlargement (2.5-fold) of characteristic mycelial
structures and black frames indicate the beginning of arthrospore formation. Scale bar represents 40 mm.
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
1226 B. Hoff, E. K. Schmitt and U. Kück
Fig. 4. Merged images of DIC and fluorescence microscopy from transgenic strains producing filamentous hyphae and arthrospores.
The appropriate strains were grown as
described in the legend to Fig. 2 and expression of the chimeric constructs was analysed
using confocal laser microscopy at the
assigned time. Both the filamentous and yeastlike growth forms show the CPCR1–EGFP protein localized in the nucleus. The cpcR1DBD–
egfp, egfp, pcbC–egfp and Acfkh1–eyfp constructs are expressed in the DcpcR1 background and the corresponding proteins are
localized in the cytoplasm or the nuclei of mycelial cells at all cultivation times (48–168 h).
Scale bars represent 5 mm.
induced by significant changes of the environmental conditions (data not shown).
cpcR1 but no derivatives or non-related genes can
restore the recipient phenotype in the DcpcR1
disruption strain
To confirm that the phenotype of DcpcR1 was due to the
disruption of cpcR1 and not to an unlinked mutation, a
series of control strains was generated and analysed
using DIC and confocal laser microscopy. Additionally, the
pH values of all cultures were measured to exclude the
possibility that this physiological parameter causes
changes in A. chrysogenum morphogenesis (data not
shown). The DcpcR1 knockout strain was retransformed
with a genomic fragment carrying the full-size cpcR1 locus
(Schmitt et al., 2004c) or the chimeric cpcR1–egfp gene
expressed under the control of the A. nidulans gpd promoter. This approach resulted in complementation of the
knockout strain by ectopic reintegration of the cpcR1 gene
and the cpcR1–egfp fusion respectively. Microscopic
examinations revealed that the mycelial morphology of
both strains, DcpcR1:cpcR1 and DcpcR1:cpcR1–egfp,
does not differ from that of the recipient A3/2 (Fig. 5A).
After 120 h of cultivation, a nearly complete fragmentation
of hyphae was observed; thus indicating that cpcR1
restores the wild-type phenotype in DcpcR1 (Table 1). The
synthesis of the CPCR1–EGFP fusion protein was confirmed using confocal laser microscopy. As shown in
Fig. 4, the recombinant protein was targeted to the nuclei
of hyphae, and in later developmental stages, in the nuclei
of uni- and bicellular arthrospores.
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
CPCR1 controls morphological differentiation in A. chrysogenum
1227
Fig. 5. Arthrospore formation in retransformants using DcpcR1 or DAcfkh1 as recipient
strain.
A. Retransformation of the cpcR1 gene
restores wild-type cellular morphology to the
DcpcR1 strain. Using light microscopic analyses, knockout strain DcpcR1 and the retransformants DcpcR1:cpcR1, DcpcR1:cpcR1–egfp,
DcpcR1:cpcR1DBD–egfp and DcpcR1:Acfkh1–
eyfp were analysed.
B. AcFKH1 is involved in arthrospore formation
of A. chrysogenum as was shown by investigating strains DAcfkh1, DAcfkh1:Acfkh1 and
DAcfkh1:cpcR1–egfp. For further details see
the legend to Fig. 3.
In
contrast,
the
retransformed
strain
DcpcR1:cpcR1DBD–egfp, carrying a modified cpcR1–
egfp fusion in which only the DNA-binding domain is
deleted, cannot restore the DcpcR1 phenotype (Fig. 5A
and S5). These results demonstrate that the deletion of
the DNA-binding domain is essential not only for the
nuclear localization (Fig. 4) but also for the functionality of
the transcription factor CPCR1.
To further determine whether the overexpression of
Acfkh1 in the DcpcR1 background affects the morphological phenotype, we generated strain DcpcR1:Acfkh1–eyfp,
harbouring additional copies of the chimeric Acfkh1–eyfp
gene under the control of the gpd promoter. As seen in
Fig. 4, the corresponding fusion protein was synthesized
and localized in the nuclei of hyphae during the experimental period. However, this recombinant strain still maintains the DcpcR1 phenotype possessing slender hyphal
filaments and lacking arthrospores even after 168 h of
cultivation (Fig. 5A and S5). This indicates that overexpression of Acfkh1 alone is not sufficient for a slightly
accelerated arthrospore formation. Thus, the presence of
CPCR1 is essential to control the fragmentation of hyphae.
Additionally, retransformation of the DcpcR1 disruption
strain with the chimeric pcbC–egfp gene construct encoding isopenicillin N synthase, an enzyme of the b-lactam
biosynthesis pathway, resulted in the recombinant strain
DcpcR1:pcbC–egfp, in which the formation of
arthrospores is still prevented (Table 1, Fig. S6). This
suggests that the transformation event itself was not
responsible for the observed changes in mycelial mor© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
phology of the strains DcpcR1:cpcR1 and DcpcR1:cpcR1–
egfp respectively.
AcFKH1 is involved in arthrospore formation of
A. chrysogenum
The recently detected interaction of CPCR1 with the forkhead transcription factor AcFKH1 (Schmitt et al., 2004b)
prompted us to determine the role of AcFKH1 in fungal
morphogenesis. For this purpose, two different recombinant strains were generated using the DAcfkh1 disruption
strain as recipient. In the first approach, DAcfkh1 was
transformed with plasmid pKSFKH1 harbouring a
genomic fragment with the full-size Acfkh1 locus to generate DAcfkh1:Acfkh1 with the ectopically reintegrated
Acfkh1 gene. As seen in Fig. 5B, the recipient phenotype
was restored in strain DAcfkh1:Acfkh1 and arthrospores
appeared after 120 h of cultivation as in A3/2 (Table 1).
These data indicate that the DAcfkh1 phenotype was fully
complemented by reintroduction of the Acfkh1 gene.
In a second approach, multiple copies of the chimeric
cpcR1–egfp gene were introduced ectopically into the
genomic DNA of the DAcfkh1 knockout strain to generate
strain DAcfkh1:cpcR1–egfp. Expression of the chimeric
construct under the control of the A. nidulans gpd promoter was verified using confocal laser microscopy. The
CPCR1–EGFP fusion protein was predominantly targeted
to the nuclei of septated hyphae, demonstrating its presence in the DAcfkh1 background during the experimental
period (48–168 h) (Fig. 4). In contrast to the situation in
1228 B. Hoff, E. K. Schmitt and U. Kück
strain A3/2:cpcR1, overexpression of the cpcR1 gene has
no observable effect on arthrospore formation in the
Acfkh1 deletion strain (Fig. 5B). DAcfkh1:cpcR1–egfp
possesses swollen arthroconidiating hyphae which are
highly septated during the first 144 h of cultivation
(Fig. S7). Like DAcfkh1, a fragmentation of hyphae was
observed only after 168 h (Table 1).
The data represented here clearly demonstrate that the
winged helix transcription factor CPCR1 is a central coordinator of morphogenesis and growth in A. chrysogenum. Microscopic analyses of liquid batch cultures established that the specific deletion of cpcR1 prevents
arthrospore formation in A. chrysogenum, while overexpression of cpcR1 results in an accelerated fragmentation
of hyphae. Only retransformation of the full-length cpcR1
gene restored the recipient phenotype in the DcpcR1 disruption strain.
Discussion
As in many other deuteromycetes, the morphological differentiation in A. chrysogenum is diverse and its development in submerged culture is characterized by
morphological forms that change throughout the cell cycle
(Bartoshevich et al., 1990). In the exponential phase of
growth, the hyphal filaments extend in a highly polarized
manner by inserting new cell wall material exclusively at
the extending hyphal tip and septation leads to the generation of individual compartments within the hyphae
(Harris and Momany, 2004). In contrast, the appearance
of arthrospores or ‘yeast-like’ cells occur at the end of the
exponential phase as described first by Gams (1971) for
ageing colonies of A. chrysogenum. Arthrospore formation resembles arthroconidiation in the human pathogen
Penicillium marneffei which occurs when growth temperature is shifted from 25∞C to 37∞C. Recent investigations
have shown that among others conserved components of
signal transduction pathways play a major role in the
switch between hyphal and yeast-like growth (Borneman
et al., 2001; Zuber et al., 2003).
Much evidence suggests that secondary metabolism
and morphogenesis are linked in A. chrysogenum. During
improvement of cephalosporin C production strains by
classical mutagenesis, arthrospore formation appears to
be correlated with high-yield cephalosporin C production.
Additionally, the phase of hyphal differentiation into
arthrospores was reported to coincide with the maximum
rate of b-lactam biosynthesis (Nash and Huber, 1971;
Bartoshevich et al., 1990). Queener and Ellis (1975)
describe similar observations; however, according to
these authors, there is no one-to-one correspondence
between the ability of A. chrysogenum strains to form
arthrospores and to synthesize the b-lactam antibiotic
cephalosporin C. Mutants unable to produce cepha-
losporin C exhibit no different fragmentation behaviour,
and conversely, reduction of disulphide bridges within the
cell walls enhanced fragmentation without changes in the
b-lactam production (Crabbe, 1988). These reports indicate that a morphological differentiation in Acremonium is
co-regulated with b-lactam biosynthesis. However, on the
other hand, cephalosporin C production is not strictly
dependent on arthrospore formation.
Recently, we have demonstrated that CPCR1 acts as a
regulator of cephalosporin C biosynthesis gene expression, as the DcpcR1 strain showed a decreased expression of the cephalosporin C biosynthesis gene pcbC, and
thus a striking reduction in the production of the biosynthesis intermediate penicillin N. Further, homologues of
the cpcR1 gene have been identified in genomes of different filamentous fungi, such as Neurospora crassa and
Fusarium graminearum, indicating that this transcription
factor may fulfil different regulatory functions, which are
not restricted to b-lactam biosynthesis (Schmitt et al.,
2004a,b). Thus, the winged helix transcription factor
CPCR1 is likely to be the molecular link mediating both
the regulation of cephalosporin C biosynthesis and
morphogenesis.
Among filamentous fungi and some filamentous bacteria, the biosynthesis of secondary metabolites is often
associated with cell differentiation and development
(Calvo et al., 2002; Umeyama et al., 2002). Previously,
veA, a gene which regulates sexual and asexual development in A. nidulans in response to light, was also reported
to control secondary metabolism. This global regulator is
essential for expression of aflR, which activates the
expression of the sterigmatocystin gene cluster, as well
as for transcription of acvA, the key gene in the first step
of penicillin biosynthesis. Moreover, veA regulates the
transcription of brlA by modulating the a/b transcript ratio
that controls conidiation (Kato et al., 2003). In Fusarium,
a genetic connection between fungal development and
mycotoxin production was recently reported. FCC1, a Ctype cyclin, which is essential for activating subunits of
cyclin-dependent kinases (CDKs), is involved in signal
transduction regulating fumonisin B1 biosynthesis and
conidiation in Fusarium verticillioides, thus supporting that
morphogenesis and secondary metabolism are controlled
via a common signal transduction pathway (Shim and
Woloshuk, 2001; Calvo et al., 2002).
In this study, we have demonstrated that overexpression
of the cpcR1 gene in the DAcfkh1 background has no
effect on the formation of arthrospores in A. chrysogenum.
Additionally, overexpression of Acfkh1 in recipient A3/2 but
not in the DcpcR1 strain leads to a slightly accelerated
arthrospore formation. This suggests that an increased
amount of the AcFKH1 protein could lead to a more efficient interaction with CPCR1, and therefore cause the
slightly accelerated fragmentation of hyphae. Thus, the
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
CPCR1 controls morphological differentiation in A. chrysogenum
interaction of CPCR1 with AcFKH1 seems to be necessary
for the functionality of CPCR1 in the morphogenesis of A.
chrysogenum. Further, our data provide the first indication
that AcFKH1 seems to be involved in cell separation.
Fungal cells lacking AcFKH1 were swollen and highly
septated, but remained attached to each other in the first
144 h of batch cultivation. In human and yeast, members
of the forkhead transcription factor family are involved in
different processes like cell cycle regulation, death control,
pre-mRNA processing and morphogenesis (Burgering
and Kops, 2002; Carlsson and Mahlapuu, 2002; Morillon
et al., 2003). The forkhead protein CaFKH2 from Candida
albicans is required for the morphogenesis of true hyphal
as well as yeast cells regulating expression of several
hyphae- and yeast-specific genes. C. albicans cells lacking
CaFKH2 formed constitutive pseudohyphae that appear
to have intact septa, but remain attached by cell wall
material (Bensen et al., 2002). This situation is reminiscent
of Dfkh1Dfkh2 mutants from Saccharomyces cerevisiae
which display a pseudohyphal morphology; thus, indicating that both proteins control the switch between pseudohyphal and yeast-like growth (Zhu et al., 2000).
As mentioned above, the forkhead transcription factor
AcFKH1 contains an N-terminal FHA domain which mediates the phospho-dependent assembly of protein complexes (Li et al., 2000; Durocher and Jackson, 2002). In
A. chrysogenum, the CPCR1 protein does not interact with
the FHA domain of AcFKH1 (Schmitt et al., 2004b). This
suggests the possibility of additional interaction partners.
Thus, the FHA site of AcFKH1 could be the molecular link
to signal transduction pathways, which are involved in
controlling morphogenesis and secondary metabolism in
filamentous fungi. In mammals, the activation of the FoxO
forkhead proteins was recently established to be regulated
by the phosphatidylinositol-3-kinase-protein kinase B
pathway. Only the dephosphorylated transcription factors
are localized in the nuclei and activate the cyclin G2
expression which is essential for cell cycle entry
(Martínez-Gac et al., 2004). Thus, it seems feasible that
the post-translational activation of AcFKH1, and subsequently, the functional complex formation with CPCR1 in
the nuclei of A. chrysogenum occur in response to external signals, such as the availability of nutrients, via a signal
cascade and reversible phosphorylation.
The mechanism by which the CPCR1 protein acts to
activate the arthrospore formation and/or repress the filamentation awaits the isolation of potential downstream
genes from A. chrysogenum. CPCR1 might control target
genes related to hyphal fragmentation such as genes
encoding chitinolytic or proteolytic enzymes. Cell wall chitinases are thought to be involved in sporulation in filamentous fungi, as the specific chitinase inhibitor allosamidin
retarded the fragmentation of hyphae into arthrospores in
A. chrysogenum and autolysis in Penicillium chrysogenum
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
1229
(Sándor et al., 1998; Pócsi et al., 2003). Chitinases contribute to breakage and reforming of bonds within and
between chitin polymers. This leads to re-modelling of the
cell wall during growth and morphogenesis (Adams, 2004).
Recently, in S. cerevisiae, efficient cell separation was
reported to be dependent on the expression of a chitinase
encoded by the CTS1 gene. Expression of this gene is
greatly reduced in DCBK1 cells, lacking a putative serine/
threonine protein kinase (Bidlingmaier et al., 2001). However, no molecular link has been established, as yet,
between regulatory kinases or phosphatases and the
expression of lytic enzymes with roles during growth and
morphogenesis in filamentous fungi (Adams, 2004).
In conclusion, the RFX transcription factor CPCR1 is
the first candidate for regulating morphogenesis in A.
chrysogenum, probably via interaction with the forkhead
protein AcFKH1. Further understanding of the underlying
molecular mechanisms will offer applications to control
fungal growth during biotechnical processes, requiring
defined morphological stages for optimal production yields.
Experimental procedures
Cloning and plasmid constructions
Escherichia coli strain XL1-blue served as host for general
plasmid construction and maintenance (Bullock et al., 1987).
The sequences of all oligonucleotides are provided in
Table 2. For disruption of the Acfkh1 gene in A. chrysogenum, a knockout plasmid pKOFKH1 was constructed. Plasmid pKSFKH1, carrying a 3.6 kb EcoRI fragment of genomic
DNA containing the entire Acfkh1 gene, was hydrolysed with
SexAI and NdeI to remove a DNA fragment of about 1 kb.
The hph cassette from plasmid pZHK2 (Kück and Pöggeler,
2004) was amplified by PCR using primers hphs and hpha to
introduce the corresponding SexAI and NdeI recognition
sites, and then ligated into plasmid pKSFKH1 hydrolysed with
SexAI and NdeI. This process resulted in the knockout plasmid pKOFKH1, which contains a disrupted Acfkh1 gene with
about 1.3 kb of flanking DNA on both sides of the hph
cassette.
Plasmids pGCPCR1, pYFKH1 and pGCPCR1DBD containing the chimeric cpcR1–egfp, Acfkh1–eyfp and
cpcR1DBD–egfp fusions under control of the A. nidulans gpd
promoter and trpC terminator have been described previously (Hoff and Kück, 2005) The pcbC gene, encoding
isopenicillin N synthase, was PCR amplified using primers
pcbCs and pcbCa, which are extended by a NcoI recognition
site, and subcloned in vector pDrive. The NcoI fragment was
ligated into the NcoI-hydrolysed plasmid p82.9 to generate
pGPCBC. This plasmid carries the chimeric pcbC–egfp
fusion under the control of the A. nidulans gpd promoter and
trpC terminator. All constructs used in this investigation were
verified by DNA sequencing.
Fungal strains and culture conditions
Transformation
experiments
were
performed
with
A.
1230 B. Hoff, E. K. Schmitt and U. Kück
Table 2. Oligonucleotides used in this work to generate PCR amplicons.
Oligonucleotide
Sequence (5¢-3¢)
Specificity
hphs
hpha
pcbCs
pcbCa
cpcR1D1s
cpcR1D1a
Primer 1
Primer 2
Primer 3
Primer 4
Primer 5
CACAACCAGGTAATTCGTCGACGTTAACTGGTTCC
TGTGCATATGGCGTCGACGTTAACTGATATTGAAGG
CACACCATGGGTTCCGTTCCAGTTCC
CACACCATGGCGGTCTGACCATTCTTGTTG
CACGCATGCCGGTCACCGTTTGCCGTCAAC
GTGAAGCTTTCATGCAGGAGCCGCCCATTC
CCCTGACGTCCACAAAATCCCCTG
CGATGAATCTCCAGAAAGGAGCCG
CACGGATCCGCTGCAAGAGGATCTCGTCG
GTGGAATTCTCAAAAGGTATCTCCAACACT
CATGCCGCCCACGTCGAAGCG
hph from pZHK2a + SexAI
trpC(p) from pZHK2a + NdeI
pcbC (pos. 1–20)a,b + NcoI
pcbC (pos. 1014–996)a,b + NcoI
cpcR1 (pos. 2541–2562)c
cpcR1 (pos. 3132–3112)c
Acfkh1 (pos. 1507–1529)d
Acfkh1 (pos. 2409–2386)d
Acfkh1 (pos. 2028–45)d
Acfkh1 (pos. 2768–2748)d
Acfkh1 (pos. 560–580)d
a.
b.
c.
d.
5¢, these primers contain four unspecific nucleotides, which are not part of the specific sequence.
Nucleotide positions are from Accession No. M33522. The s and a primer encode amino acids 1–6 and 333–338 respectively.
Nucleotide positions are from Accession No. AJ132014. The s and a primer encode amino acids 635–641 and 825–830 respectively.
Nucleotide positions are from Accession No. AY196786 and primer positions are shown in Fig. 1A.
chrysogenum strains using standard transformation procedures (Walz and Kück, 1993). All strains used in this study
are listed in Table 3, and their genotypes were confirmed by
Southern analyses using gene-specific probes for hybridization of genomic DNA. Generation of strains DcpcR1,
DcpcR1:cpcR1 and A3/2:cpcR1 were previously described
(Schmitt et al., 2004c).
To generate disruption strain DAcfkh1, plasmid pKOFKH1
was hydrolysed with EcoRI and transformed into A.
chrysogenum strain A3/2 (Radzio and Kück, 1997). Resulting
transformants were selected for hygromycin B resistance and
124 transgenic strains were analysed for disruption of the
Acfkh1 gene by a PCR-based approach. For reintegration of
the Acfkh1 and the chimeric cpcR1–egfp gene into the
DAcfkh1 disruption strain, co-transformation experiments
were performed using plasmid pUT737 (Jain et al., 1992)
together with pKSFKH1 and pGCPCR1 respectively. Transformed protoplasts were selected on CCM medium supplemented with 10 mg ml-1 phleomycin and 10 U ml-1
hygromycin B. Transformants were isolated after 21–28 days
of incubation at 27∞C. Strains A3/2:egfp, A3/2:cpcR1–egfp
and A3/2:Acfkh1 were obtained by transformation of recipient
A3/2 with plasmids pSM1 (Pöggeler et al., 2003), pGCPCR1
and pKSFKH1 respectively; thus, allowing selection on
hygromycin B containing media. The retransformants
DcpcR1:cpcR1–egfp and DcpcR1:cpcR1DBD–egfp were
generated by co-transformation of recipient strain DcpcR1
with plasmids pGCPCR1 or pGCPCR1DBD and vector
pUT737 mediating phleomycin resistance. The two strains
DcpcR1:Acfkh1–eyfp and DcpcR1:pcbC–egfp were obtained,
when DcpcR1 was co-transformed with vector pUT737 and
plasmids pYFKH1 and pGPCBC respectively.
All A. chrysogenum strains were cultivated in liquid CCM
medium at 27∞C and 180 r.p.m. as described by Minuth et al.
(1982). Cultivations for time-courses and microscopic studies
were started with a 5% inoculum from a 2.5-day-old preculture. Cultivation time points given in Results indicate the
times following the inoculation of the main culture.
DNA extraction and Southern blotting
Fungal genomic DNA was isolated as previously described
(Schmitt et al., 2004c). DNA was isolated from vegetative
hyphal cells grown at 27∞C and 180 r.p.m. for 3 days in liquid
CCM medium. Southern blotting was performed with GeneScreen hybridization transfer membrane according to the
manufacturer’s instructions (PerkimElmer, Boston, USA). Fil-
Table 3. Strains used in this study.
Strain
Characteristics
Reference
ATCC 14553
A3/2
A3/2:cpcR1
A3/2:cpcR1–egfp
A3/2:Acfkh1
A3/2:egfp
DcpcR1
DcpcR1:cpcR1
DcpcR1:cpcR1–egfp
DcpcR1:cpcR1DBD–egfp
DcpcR1:Acfkh1–eyfp
DcpcR1:pcbC–egfp
DAcfkh1
DAcfkh1:Acfkh1
DAcfkh1:cpcR1–egfp
Wild-type strain
Recipient (semi-producer strain)
cpcR1(p)::cpcR; trpC(p)::hph
gpd(p)::cpcR1::egfp::trpC(t); trpC(p)::hph
Acfkh1(p)::Acfkh1
gpd(p)::egfp::trpC(t); trpC(p)::hph
DcpcR1::hygB
DcpcR1::hygB; cpcR1(p)::cpcR1
DcpcR1::hygB; gpd(p)::cpcR1::egfp::trpC(t)
DcpcR1::hygB; gpd(p)::cpcR1Daa218-309::egfp::trpC(t)
DcpcR1::hygB; gpd(p)::Acfkh1::eyfp::trpC(t)
DcpcR1::hygB; gpd(p)::pcbC::egfp::trpC(t)
DAcfkh1::hygB
DAcfkh1::hygB; Acfkh1(p)::Acfkh1
DAcfkh1::hygB; gpd(p)::cpcR1::egfp::trpC(t)
–
Radzio and Kück (1997)
Schmitt et al. (2004c)
This work
This work
This work
Schmitt et al. (2004c)
Schmitt et al. (2004c)
This work
This work
This work
This work
This work
This work
This work
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
CPCR1 controls morphological differentiation in A. chrysogenum
ters were hybridized with [a-32P]-dCTP-labelled probes using
standard methods (Sambrook and Russell, 2001). For PCR
analyses, genomic DNA of fungal transformants was isolated
by grinding approximately 2–3 cm2 of mycelia in 400 ml of
extraction buffer using glass beads, followed by the addition
of 200 ml of 3 M sodium acetate (pH 5.2), and freezing at
-20∞C. After centrifugation, DNA contained in the supernatant was precipitated by the addition of isopropanol and incubation at -20∞C. The pellets were washed with 70% ethanol,
dried, and resuspended in 70 ml of water.
1231
Fig. S2. Arthrospore formation in the A. chrysogenum wildtype strain ATCC 14553.
Fig. S3. Arthrospore formation accelerates severely in transformants carrying extra copies of the cpcR1 gene.
Fig. S4. Arthrospore formation accelerates severely in A3/2
recipient strains carrying multiple copies of the cpcR1 gene.
Fig. S5. Retransformation of the cpcR1 gene restores wildtype cellular morphology to the DcpcR1 strain, part I.
Fig. S6. Retransformation of the cpcR1 gene restores wildtype cellular morphology to the DcpcR1 strain, part II.
Fig. S7. AcFKH1 is involved in arthrospore formation of A.
chrysogenum.
Microscopy and image analysis
Hyphal morphology at different cultivation times (24–168 h)
was analysed by using ¥40 objective lenses and DIC optics
on a Zeiss Axiophot microscope (Carl Zeiss, Jena, Germany). Images were captured with a Axiovision digital imaging system and processed with Adobe Photoshop TM 6.0
software. The fluorescence emissions of hyphae and
arthrospores were analysed by confocal laser scanning
microscopy (CLSM) using a Zeiss LSM 510 META microscopy system (Carl Zeiss, Jena, Germany) based on an Axiovert inverted microscope. EGFP and EYFP were excited with
the 488 nm and 514 nm line of an argon-ion laser respectively. The fluorescence emission was selected by bandpass
filters BP505-550 for EGFP and BP530-600 for EYFP. Transmission images were recorded using DIC optics and the
merged images were analysed with Zeiss LSM510 software.
Physiological tests
Growth of mycelia was monitored as dry cell weight. At the
assigned cultivation times (24–168 h), the dry weight of each
sample was estimated by vacuum filtration of a 100 ml liquid
culture. The remained cell material was dried at 60∞C for 24 h
and weighed. The final pH value of the culture media was
measured after 24–168 h of cultivation. In terms of reproducibility, all experiments are mean values of three or four independent measurements.
Acknowledgements
We thank Ms Kerstin Kalkreuter and Ingeborg Godehardt for
their excellent technical assistance, E. Szczypka for the artwork, D. Janus for her gift of unpublished transformants, Drs
C. Theiß and H.-G. Mannherz (Ruhr-University, Medical Faculty) for their support with confocal laser microscopy, and Drs
H. Kürnsteiner and E. Friedlin (Kundl, Austria) for their interest and support. This work was funded by Sandoz GmbH
(Kundl, Austria).
Supplementary material
The following material is available from
http://www.blackwellpublishing.com/products/journals/
suppmat/mmi/mmi4626/mmi4626sm.htm
Fig. S1. Deletion of the A. chrysogenum cpcR1 gene prevents arthrospore formation.
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
References
Adams, D.J. (2004) Fungal cell wall chitinases and glucanases. Microbiology 150: 2029–2035.
Adams, T.H., Boylan, M.T., and Timberlake, W.E. (1988) brlA
is necessary and sufficient to direct conidiophore development in Aspergillus nidulans. Cell 54: 353–362.
Bartoshevich, Y.E., Zaslavskaya, P.L., Novak, M.J., and
Yudina, O.D. (1990) Acremonium chrysogenum differentiation and biosynthesis of cephalosporin. J Basic Microbiol
30: 313–320.
Bensen, E.S., Filler, S.G., and Berman, J. (2002) A forkhead
transcription factor is important for true hyphal as well as
yeast morphogenesis in Candida albicans. Eukaryot Cell
1: 787–798.
Bidlingmaier, S., Weiss, E.L., Seidel, C., Drubin, D.G., and
Snyder, M. (2001) The Cbk1p pathway is important for
polarized cell growth and cell separation in Saccharomyces cerevisiae. Mol Cell Biol 21: 2449–2462.
Borneman, A.R., Hynes, M.J., and Andrianopoulos, A. (2001)
An STE12 homolog from the asexual, dimorphic fungus
Penicillium marneffei complements the defect in sexual
development of an Aspergillus nidulans steA mutant.
Genetics 157: 1003–1014.
Bullock, W.O., Fernandez, J.M., and Short, J.M. (1987) XL1Blue: a high efficiency plasmid transforming recA Escherichia coli strain with beta-galactosidase selection. Biotechniques 5: 376–378.
Burgering, B.M., and Kops, G.J. (2002) Cell cycle and death
control: long live forkheads. Trends Biochem Sci 27: 352–
360.
Caltrider, N.P., and Niss, H.F. (1966) Role of methionine in
cephalosporin synthesis. Appl Microbiol 14: 746–753.
Calvo, A.M., Wilson, R.A., Bok, J.W., and Keller, N.P. (2002)
Relationship between secondary metabolism and fungal
development. Microbiol Mol Biol Rev 66: 447–459.
Carlsson, P., and Mahlapuu, M. (2002) Forkhead transcription factors: key players in development and metabolism.
Dev Biol 250: 1–23.
Crabbe, M.J. (1988) The effect of thiols and the Ca2+ ionophore A23817 on growth and antibiotic production in
Cephalosporium acremonium. FEMS Microbiol Lett 56:
71–78.
Drew, S.W., Winstanley, D.J., and Demain, A.L. (1976) Effect
of norleucine on mycelial fragmentation in Cephalosporium
acremonium. Appl Environ Microbiol 31: 143–145.
Durocher, D., and Jackson, S.P. (2002) The FHA domain.
FEBS Lett 513: 58–66.
1232 B. Hoff, E. K. Schmitt and U. Kück
Emery, P., Durand, B., Mach, B., and Reith, W. (1996) RFX
proteins, a novel family of DNA binding proteins conserved
in the eukaryotic kingdom. Nucleic Acids Res 24: 803–807.
Gajiwala, K.S., and Burley, S.K. (2000) Winged helix proteins. Curr Opin Struc Biol 10: 110–116.
Gams, W. (1971) Cephalosporium-artige Schimmelpilze
(Hyphomycetes). Stuttgart: Gustav Fischer Verlag.
Harris, S.D., and Momany, M. (2004) Polarity in filamentous
fungi: moving beyond the yeast paradigm. Fungal Genet
Biol 41: 391–400.
Hicks, J.K., Yu, J.H., Keller, N.P., and Adams, T.H. (1997)
Aspergillus sporulation and mycotoxin production both
require inactivation of the FadA G alpha protein-dependent
signaling pathway. EMBO J 16: 4916–4923.
Hoff, B., and Kück, U. (2005) Use of bimolecular fluorescence
complementation to demonstrate transcription factor interaction in nuclei of living cells from the filamentous fungus
Acremonium chrysogenum. Curr Genet 47: 132–138.
Jain, S., Durand, H., and Tiraby, G. (1992) Development of
a transformation system for the thermophilic fungus Talaromyces sp. CL240 based on the use of phleomycin resistance as a dominant selectable marker. Mol Gen Genet
234: 489–493.
Jekosch, K., and Kück, U. (2000) Loss of glucose repression
in an Acremonium chrysogenum b-lactam producer strain
and its restoration by multiple copies of the cre1 gene. Appl
Microbiol Biotechnol 54: 556–563.
Karaffa, L., Sándor, E., Kozma, J., and Szentirmai, A. (1997)
Methionine enhances sugar consumption, fragmentation,
vacuolation and cephalosporin-C production in Acremonium chrysogenum. Process Biochem 32: 495–499.
Kato, N., Brooks, W., and Calvo, A.M. (2003) The expression
of sterigmatocystin and penicillin genes in Aspergillus nidulans is controlled by veA, a gene required for sexual
development. Eukaryot Cell 2: 1178–1186.
Kück, U., and Pöggeler, S. (2004) pZHK2, a bifunctional
transformation vector, suitable for two step gene targeting.
Fungal Genetics Newslett 51: 4–6.
Li, J., Lee, G., Van Doren, S.R., and Walker, J.C. (2000) The
FHA domain mediates phosphoprotein interactions. J Cell
Sci 113: 4143–4149.
Litzka, O., Then Bergh, K., Van den Brulle, J., Steidl, S., and
Brakhage, A.A. (1999) Transcriptional control of expression
of fungal b-lactam biosynthesis genes. Antonie Van Leeuwenhoek 75: 95–105.
Martínez-Gac, L., Marqués, M., García, Z., Campanero,
M.R., and Carrera, A.C. (2004) Control of cyclin G2 mRNA
expression by forkhead transcription factors: novel mechanism for cell cycle control by phosphoinositide 3-kinase
and forkhead. Mol Cell Biol 24: 2181–2189.
Menne, S., Walz, M., and Kück, U. (1994) Expression studies
with the bidirectional pcbAB-pcbC promoter region from
Acremonium chrysogenum using reporter gene fusions.
Appl Microbiol Biotechnol 42: 57–66.
Minuth, W., Tudzynski, P., and Esser, K. (1982) Extrachromosomal genetics of Cephalosporium acremonium. Curr
Genet 25: 34–40.
Morillon, A., O’Sullivan, J., Azad, A., Proudfoot, N., and Mellor, J. (2003) Regulation of elongation RNA polymerase II
by forkhead transcription factors in yeast. Science 300:
492–495.
Nash, C.H., and Huber, F.M. (1971) Antibiotic synthesis and
morphological differentiation of Cephalosporium acremonium. Appl Microbiol 22: 6–10.
Onions, A.H.S., and Brady, B.L. (1987) Taxonomy of Penicillium and Acremonium. In Penicillium and Acremonium,
Vol. 1. Perbedy, J.F. (ed.). New York: Plenum Press,
pp. 1–36.
Pócsi, I., Pusztahelyi, T., Sámi, L., and Emri, T. (2003) Autolysis of Penicillium chrysogenum – a holistic approach. Ind
J Biotechnol 2: 293–301.
Pöggeler, S., Masloff, S., Hoff, B., Mayrhofer, S., and Kück,
U. (2003) Versatile EGFP reporter plasmids for cellular
localization of recombinant gene products in filamentous
fungi. Curr Genet 43: 54–61.
Queener, S.W., and Ellis, L.F. (1975) Differentiation of
mutants of Cephalosporium acremonium in complex
medium: the formation of unicellular arthrospores and their
germination. Can J Microbiol 21: 1981–1996.
Radzio, R., and Kück, U. (1997) Efficient synthesis of the
blood-coagulation inhibitor hirudin in the filamentous fungus Acremonium chrysogenum. Appl Microbiol Biotechnol
48: 58–65.
Sambrook, J., and Russell, D.W. (2001) Molecular Cloning.
A Laboratory Manual. Cold Spring Habor, NY: Cold Spring
Harbor Laboratory Press.
Sándor, E., Pusztahelyi, T., Karaffa, L., Karanyi, Z., Pócsi, I.,
Biro, S., et al. (1998) Allosamidin inhibits the fragmentation
of Acremonium chrysogenum but does not influence the
cephalosporin-C production of the fungus. FEMS Microbiol
Lett 164: 231–236.
Sándor, E., Szentirmai, A., Paul, G.C., Colin, R.T., Pócsi, I.,
and Karaffa, L. (2001) Analysis of the relationship between
growth, cephalosporin C production, and fragmentation in
Acremonium chrysogenum. Can J Microbiol 47: 801–806.
Schmitt, E.K., and Kück, U. (2000) The fungal CPCR1 protein, which binds specifically to b-lactam biosynthesis
genes, is related to human regulatory factor X transcription
factors. J Biol Chem 275: 9348–9357.
Schmitt, E.K., Kempken, R., and Kück, U. (2001) Functional
analysis of promoter sequences of cephalosporin C biosynthesis genes from Acremonium chrysogenum: specific
DNA–protein interactions and characterization of the transcription factor PACC. Mol Genet Genomics 265: 508–518.
Schmitt, E.K., Hoff, B., and Kück, U. (2004a) Regulation of
cephalosporin biosynthesis. In Molecular Biotechnology of
Fungal b-Lactam Antibiotics and Related Peptide Synthetases, Vol. 88. Brakhage, A.A. (ed.). Berlin: Springer
Verlag, pp. 1–43.
Schmitt, E.K., Hoff, B., and Kück, U. (2004b) AcFKH1,
a novel member of the forkhead family, associates with
RFX transcription factor CPCR1 in the cephalosporin Cproducing fungus Acremonium chrysogenum. Gene 342:
269–281.
Schmitt, E.K., Bunse, A., Janus, D., Hoff, B., Friedlin, E.,
Kürnsteiner, H., and Kück, U. (2004c) Winged helix transcription factor CPCR1 is involved in regulation of b-lactam
biosynthesis in the fungus Acremonium chrysogenum.
Eukaryot Cell 3: 121–134.
Sekiguchi, J., and Gaucher, G.M. (1977) Conidiogenesis and
secondary metabolism in Penicillium urticae. Appl Environ
Microbiol 33: 147–158.
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
CPCR1 controls morphological differentiation in A. chrysogenum
Shim, W.B., and Woloshuk, C.P. (2001) Regulation of fumonisin B1 biosynthesis and conidiation in Fusarium verticillioides by a cyclin-like (C-type) gene, FCC1. Appl Environ
Microbiol 67: 1607–1612.
Shimizu, K., and Keller, N.P. (2001) Genetic involvement
of a cAMP-dependent protein kinase in a G protein signaling pathway regulating morphological and chemical
transitions in Aspergillus nidulans. Genetics 157: 591–
600.
Tag, A., Hicks, J., Garifullina, G., Ake, C., Phillips, T.D.,
Beremand, M., and Keller, N. (2000) G-protein signalling
mediates differential production of toxic secondary metabolites. Mol Microbiol 38: 658–665.
Tollnick, C., Seidel, G., Beyer, M., and Schügerl, K. (2004)
Investigations of the production of cephalosporin C by
Acremonium chrysogenum. Adv Biochem Engin/Biotechnol 86: 1–45.
Ullán, R.V., Casqueiro, J., Bañuelos, O., Fernández, F.J.,
Gutiérrez, S., and Martín, J.F. (2002) A novel epimerization system in fungal secondary metabolism involved in
the conversion of isopenicillin N into penicillin N in
© 2005 Blackwell Publishing Ltd, Molecular Microbiology, 56, 1220–1233
1233
Acremonium chrysogenum. J Biol Chem 277: 46216–
46225.
Umeyama, T., Lee, P.C., and Horinouchi, S. (2002) Protein
serine/threonine kinases in signal transduction for secondary metabolism and morphogenesis in Streptomyces. Appl
Microbiol Biotechnol 59: 419–425.
Walz, M., and Kück, U. (1993) Targeted integration into the
Acremonium chrysogenum genome: disruption of the pcbC
gene. Curr Genet 24: 421–427.
Yu, J.H., Butchko, R.A., Fernandes, M., Keller, N.P., Leonard,
T.J., and Adams, T.H. (1996) Conservation of structure and
function of the aflatoxin regulatory gene aflR from Aspergillus nidulans and A. flavus. Curr Genet 29: 549–555.
Zhu, G., Spellmann, P.T., Volpe, T., Brown, P.O., Botstein,
D., Davis, T.N., and Futcher, B. (2000) Two yeast forkhead
genes regulate the cell cycle and pseudohyphal growth.
Nature 406: 90–94.
Zuber, S., Hynes, M.J., and Andrianopoulos, A. (2003) The
G-protein alpha-subunit GasC plays a major role in germination in the dimorphic fungus Penicillium marneffei.
Genetics 164: 487–499.