Download Ghrelin regulates mitochondrial-lipid metabolism gene

Am J Physiol Endocrinol Metab 288: E228 –E235, 2005.
First published August 24, 2004; doi:10.1152/ajpendo.00115.2004.
Ghrelin regulates mitochondrial-lipid metabolism gene expression
and tissue fat distribution in liver and skeletal muscle
Rocco Barazzoni,1 Alessandra Bosutti,1 Marco Stebel,2 Maria Rosa Cattin,1 Elena Roder,1
Luca Visintin,1 Luigi Cattin,1 Gianni Biolo,1 Michela Zanetti,1 and Gianfranco Guarnieri1
1
Dipartimento di Scienze Cliniche, Clinica Medica, Morfologiche e Tecnologiche and
Centro Servizi Polivalenti di Ateneo Animal Facility, University of Trieste, Trieste, Italy
2
Submitted 9 March 2004; accepted in final form 12 August 2004
GHRELIN IS A GASTRIC HORMONE reported to increase body weight
and body fat (24, 26, 34, 57), also independently of changes in
food intake (50). Ghrelin favors adipogenesis in vivo (49) and
impairs adipocyte lipolysis in vitro (12), whereas sustained
peripheral and central ghrelin administration increase respiratory quotient directly, indicating reduced whole body lipid
oxidative utilization (50). Fat accumulation in obese individuals is associated with fat deposition in nonadipose tissues,
including liver and skeletal muscle (3, 19, 20, 25), and these
changes can contribute to the onset of insulin resistance (45).
Excess fat in the obese general population is, however, char-
acterized by hypoghrelinemia (51), whereas circulating ghrelin
is increased after caloric restriction and weight loss (8, 13),
which can in turn be associated with tissue-specific liver fat
deposition (3).
In vitro studies have indicated that ghrelin can exert direct
metabolic effects in lean tissues, since ghrelin was shown to
activate the insulin-signaling cascade and to independently
stimulate expression of glucogenic genes in cultured hepatocytes (32). Known mediators of central ghrelin effects
include neuropeptide Y (24), which was reported to regulate
lean tissue lipid metabolism, favoring lipogenesis in liver
but not skeletal muscle (53, 59). Taken together, the above
observations suggest a role of ghrelin in changes of lean
tissue lipid metabolism and distribution after changes in
nutrient availability, but these potential effects have not
been investigated. To elucidate the role of ghrelin in the
regulation of lipid metabolism and distribution in metabolically relevant lean tissues and its potential molecular mediators, we determined the in vivo effects of peripheral
ghrelin administration at a dose not affecting food intake on
liver and skeletal muscle triglyceride content and mitochondrial-lipid metabolism gene expression in a rodent model in
vivo. Both mixed type I-type II gastrocnemius and type I
soleus muscles were studied to assess effects of different
muscle fiber composition and oxidative capacities. Expression levels of genes involved in the regulation of lipogenesis
[acetyl-CoA carboxylase (ACC) and fatty acid synthase
(FAS)] and lipid oxidation [carnitine palmitoyltransferase
(CPT) I and mitochondrial uncoupling proteins (UCPs)
(10)] were investigated. Peroxisome proliferator-activated
receptor (PPAR)␥ and -␣ transcript levels were also measured, since PPARs are important regulators of tissue fat
metabolism and content (38), and ghrelin was reported to
enhance adipocyte PPAR␥ expression (12). Mitochondria
are the site of tissue fat oxidative disposal, and activities of
cytochrome c oxidase (COX) and citrate synthase (CS) were
measured as representative mitochondrial enzymes because
of their flux-generating role in the respiratory chain and
tricarboxylic acid cycle, respectively (15). Potential involvement
of AMP-activated protein kinase (AMPK) in ghrelin effects was
finally studied, since AMPK is a major regulator of tissue lipid
and glucose metabolism, the activating phosphorylation of which
favors tissue fatty acid oxidation (56) and downregulates hepatic
glucogenetic molecules (58) in direct contrast with reported ghrelin effects (32, 50).
Address for reprint requests and other correspondence: R Barazzoni, Clinica
Medica Generale, Univ. of Trieste, Ospedale Cattinara, Strada di Fiume 443,
34100 Trieste, Italy (E-mail: [email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
triglyceride; mitochondria
E228
0193-1849/05 $8.00 Copyright © 2005 the American Physiological Society
http://www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on October 25, 2016
Barazzoni, Rocco, Alessandra Bosutti, Marco Stebel, Maria
Rosa Cattin, Elena Roder, Luca Visintin, Luigi Cattin, Gianni
Biolo, Michela Zanetti, and Gianfranco Guarnieri. Ghrelin regulates mitochondrial-lipid metabolism gene expression and tissue fat
distribution in liver and skeletal muscle. Am J Physiol Endocrinol
Metab 288: E228 –E235, 2005. First published August 24, 2004;
doi:10.1152/ajpendo.00115.2004.—Ghrelin is a gastric hormone increased during caloric restriction and fat depletion. A role of ghrelin
in the regulation of lipid and energy metabolism is suggested by fat
gain independent of changes in food intake during exogenous ghrelin
administration in rodents. We investigated the potential effects of
peripheral ghrelin administration (two times daily 200-ng sc injection
for 4 days) on triglyceride content and mitochondrial and lipid
metabolism gene expression in rat liver and muscles. Compared with
vehicle, ghrelin increased body weight but not food intake and
circulating insulin. In liver, ghrelin induced a lipogenic and glucogenic pattern of gene expression and increased triglyceride content
while reducing activated (phosphorylated) stimulator of fatty acid
oxidation, AMP-activated protein kinase (AMPK, all P ⬍ 0.05), with
unchanged mitochondrial oxidative enzyme activities. In contrast,
triglyceride content was reduced (P ⬍ 0.05) after ghrelin administration in mixed (gastrocnemius) and unchanged in oxidative (soleus)
muscle. In mixed muscle, ghrelin increased (P ⬍ 0.05) mitochondrial
oxidative enzyme activities independent of changes in expression of
fat metabolism genes and phosphorylated AMPK. Expression of
peroxisome proliferator-activated receptor-␥, the activation of which
reduces muscle fat content, was selectively increased in mixed muscle
where it paralleled changes in oxidative capacities (P ⬍ 0.05). Thus
ghrelin induces tissue-specific changes in mitochondrial and lipid
metabolism gene expression and favors triglyceride deposition in liver
over skeletal muscle. These novel effects of ghrelin in the regulation
of lean tissue fat distribution and metabolism could contribute to
metabolic adaptation to caloric restriction and loss of body fat.
GHRELIN REGULATES LIPID METABOLISM IN LEAN TISSUES IN VIVO
MATERIALS AND METHODS
with a quencher dye TAMRA (6⬘-carboxytetramethylrhodamine). The
reporter and quencher dyes are in close proximity on the probe,
resulting in suppression of reporter fluorescence. The probe is designed to hybridize to a specific sequence within the PCR product.
The 5⬘- to 3⬘-exonuclease activity of the Taq DNA polymerase allows
for separation of the reporter from the close proximity of the quencher
dye, resulting in fluorescence of the reporter dye. The resulting signal
is measured at each amplification cycle on the ABI Sequence Detection System (Applied Biosystems), thus allowing the measurement of
sample abundance in the linear phase of amplification. Target genes
were amplified using aliquots of the same cDNA sample, and final
quantitation of each sample was achieved by a coamplified relative
standard curve. Abundance of 28S rRNA was measured separately in
the same fashion and used to normalize against potential differences
in RNA isolation, RNA degradation, and efficiency of reverse transcription reactions. All values (arbitrary units) were finally divided by
the average of the control group and multiplied by 100 to express
them as percent of the control group. Mitochondrial UCP2 and -3
mRNA was measured by Northern blot, as previously described, and
also expressed as a percentage of control (6, 7).
Western blot. For measurement of activated (phosphorylated)
AMPK and inactivated (phosphorylated) and total ACC, total tissue
proteins were extracted from liver and muscles and quantitated as
described (6). Total protein (40 ␮g) was separated on 12% (phosphorylated AMPK) or 4 –12% (ACC) gradient acrylamide gels and transferred to PVDF membranes (Bio-Rad Laboratories, Hercules, CA)
that were blocked overnight and subsequently hybridized overnight at
4°C to rabbit antibodies for Thr172 phosphorylated AMPK, phosphorylated ACC, or total ACC (Upstate Biotechnology, Lake Placid, NY).
The secondary antibody was peroxidase-conjugated goat anti-rabbit
IgG (Jackson ImmunoResearch, West Grove, PA) used at a 1:20,000
dilution for 1 h at room temperature. Membranes were then exposed
to films for 4 – 8 min (Kodak Biomax MR; Kodak, Rochester, NY),
and resulting images were quantified by densitometry. Similar to
mRNA measurements, each value (arbitrary units) was divided by the
average of the control group and multiplied by 100 to express data as
a percentage of the control vehicle-treated group.
Table 1. Forward and reverse primer and probe sequences
ACC (GenBank J03808):
FAS (GenBank X62889):
CPT I L (GenBank NM031559):
CPT I M (GenBank AF029875):
PPAR␥ (GenBank NM 03124):
PPAR␣ (GenBank NM 031347):
G-6-Pase (GenBank L37333):
28S rRNA (GenBank V01270):
FP: CAGCTCAGCAAAACCACCAA
RP: ATGGCAAATGGGAGGCAATA
Probe: CAAAGTGGCACTGCGGGCTCG
FP: GTTTCCAGTGGGTGGACTCTCT
RP: TTCATGGCTGTTAGCCACACA
Probe: AGAGCATTCTGGCCACATCCTCCTCC
FP: GTAAGGCCACTGATGAAGGAAGA
RP: ATTTGGGTCCGAGGTTGACA
Probe: CATGACAGCACTGGCCCAGGATTTTG
FP: ATGCCTCCCGACAAGGTATG
RP: CCGGTGGAGAAGATGACCAT
Probe: CTCCTACGGGACCCCACAGAC
FP: ACCAGGGAGTTCCTCAAAAGC
RP: GCAAACTCAAACTTAGGCTCCATAA
Probe: TGCGGAAGCCCTTTGGTGA
FP: TGGAGTCCACGCATGTGAAG
RP: CGCCAGCTTTAGCCGAATAG
Probe: TGCAAGGGCTTCTTTCGGC
FP: TCTACCTTGCGGCTCACTTTC
RP: GAAAGTTTCAGCCACAGCAATG
Probe: CCATCAGGTGGTGGCTGGAGTCTTG
FP: TGGGAATGCAGCCCAAAG
RP: CCTTACGGTACTTGTTGGCTATCG
Probe: TGGTAAACTCCATCTAAGGCTAAATACCGGC
Forward (FP) and reverse (RP) primer and probe sequences for real-time PCR gene quantitation for acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS),
carnitine palmitoyltransferase (CPT) I liver (L) and muscle (M) isoforms, peroxisome proliferator-activated receptor (PPAR)␥ and -␣, glucose-6-phosphatase
(G-6-Pase), and 28S rRNA.
AJP-Endocrinol Metab • VOL
288 • JANUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on October 25, 2016
Experimental protocol. Male Wistar rats (10 wk old) were purchased from Harlan Italy (San Pietro al Natisone), kept in individual
cages in the Animal Facility of the University of Trieste in a controlled environment (22°C, 12:12-h light-dark cycle), and fed a
standard commercial chow diet (3.4 kcal/g Harlan 2018; Harlan).
Experimental procedures were approved by the Institutional Review
Committee for animal studies. After arrival (2 wk), rats were randomly assigned to undergo twice daily (8:00 PM and 8:00 AM)
subcutaneous injections of rat ghrelin (n ⫽ 8, 200 ng/injection;
AnaSpec, San Jose, CA) or vehicle (water, n ⫽ 8). The ghrelin dose
was chosen to be lower but in the same order of magnitude of the one
previously reported to markedly increase body weight without affecting food intake in mice (50), and lack of food intake effects were
verified in preliminary short-term experiments. Injections were started
in the evening (day 1), with the last injection in the morning (day 4).
Animals were killed 3.5 h after the last ghrelin injection, with food
withdrawal 2 h before death. Food intake and body weights were
measured before injections and before death. Food intake between the
last injection and food withdrawal was comparable in the two study
groups (0.81 vs. 0.89 g/h, control vs. ghrelin, P ⫽ 0.4). Animals were
not killed under prolonged fasting conditions to avoid potential
confounding effects of fasting-related hyperghrelinemia in the control
group. After intraperitoneal pentobarbital overdose, gastrocnemius
and soleus muscles, liver, and abdominal epididymal white adipose
tissue were collected, frozen in liquid nitrogen, and stored at ⫺80°C.
Blood was collected through cardiac puncture.
RNA analyses (real-time PCR and Northern blot). Total RNA was
isolated from 40- to 60-mg tissues by the guanidinium method (Tri
Reagent; MRC, Cincinnati, OH). Transcript levels of pivotal regulators of lipid metabolism were measured by real-time PCR (7900
Sequence Detection System; Applied Biosystems). Total RNA (1 ␮g)
was reversed transcribed (RNA Reverse Transcription KIT; Applied
Biosystems) to cDNA. Primers and probes for real-time PCR amplification were selected using Primer Express Software (Applied Biosystems; Table 1). The probe for target genes was labeled at the 5⬘ end
with a reporter dye FAM (6⬘-carboxyfluorescein) and at the 3⬘ end
E229
E230
GHRELIN REGULATES LIPID METABOLISM IN LEAN TISSUES IN VIVO
RESULTS
Food intake, body weight, and plasma metabolic profile.
Ghrelin resulted in a moderate increment of body weight gain
(control: 14 ⫾ 2 g, ghrelin: 19 ⫾ 1 g, P ⫽ 0.04) over the 4-day
study period, whereas overall food intake was comparable in
the two groups (control: 79 ⫾ 2 g, ghrelin: 82 ⫾ 3 g, P ⫽
0.39). Plasma insulin, growth hormone, and free fatty acid
concentrations were comparable in ghrelin- and vehicle-treated
rats, whereas blood glucose was increased (P ⬍ 0.01) in the
ghrelin-treated group (Table 2).
Ghrelin modifies lipid metabolism gene expression and increases triglyceride content in rat liver. Ghrelin administration markedly increased liver triglyceride content (control:
0.0073 ⫾ 0.001, ghrelin: 0.0125 ⫾ 0.017 mg/g dry wt; Fig. 1).
Transcript levels of lipogenic enzymes ACC (⫹37%) and FAS
(⫹42%) were increased, whereas those of the rate-limiting
enzyme of lipid oxidation, CPT I, were reduced (⫺30%) after
ghrelin compared with vehicle injections. In addition, ghrelin
treatment upregulated glucose-6-phosphatase expression
(⫹46%; all P ⬍ 0.05 vs. control; Fig. 2A). These changes were
associated with reduced tissue-phosphorylated AMPK (⫺42%)
and increased total (⫹77%) but not phosphorylated ACC
protein levels, indicating a relative reduction of phosphorylated
inactive ACC form (Fig. 2B). Tissue COX and CS activities
(Fig. 2C) were unchanged, whereas UCP2 expression was
increased (⫹268%, Fig. 2D) after ghrelin treatment. Transcript
levels of hepatic PPAR␥ (control: 100 ⫾ 23 and ghrelin: 123 ⫾
20%) were comparable in the two experimental groups.
Table 2. Initial body weight and body weight changes, food
intake, plasma insulin, growth hormone, and free fatty acid
and blood glucose concentrations in the two experimental
groups
Initial body weight, g
Body weight change, g
Total food intake, g
Insulin, ng/ml
Growth hormone, ng/ml
Free fatty acids, meq/l
Glucose, mg/dl
Control
Ghrelin
341⫾4
14⫾2
79⫾2
7.8⫾1.3
14.3⫾3.9
0.47⫾0.09
109⫾2
331⫾6
19⫾1*
82⫾3
9⫾1.2
15.9⫾3.8
0.35⫾0.07
144⫾5*
Values are means ⫾ SE. *P ⬍ 0.05 vs. control.
AJP-Endocrinol Metab • VOL
Fig. 1. Ghrelin effects on tissue triglyceride content in liver, gastrocnemius,
and soleus muscles. Data are means ⫾ SE from 8 animals/group. *P ⬍ 0.05,
ghrelin vs. control by Student’s t-test for unpaired data.
Ghrelin reduces triglyceride content and increases mitochondrial oxidative capacity in rat mixed skeletal muscle. In
mixed gastrocnemius muscle, no changes were observed in
transcript levels of ACC and CPT I (Fig. 3A), in phosphorylated AMPK, or phosphorylated or total ACC protein (Fig. 3B).
Activities of both COX (control: 125 ⫾ 9; ghrelin: 192 ⫾ 16
␮mol䡠min⫺1 䡠g protein⫺1) and CS (control: 118 ⫾ 11; ghrelin:
173 ⫾ 21 ␮mol䡠min⫺1 䡠g protein⫺1) were increased after
ghrelin treatment in mixed gastrocnemius muscle (P ⬍ 0.05 vs.
control; Fig. 3C), and a positive correlation was observed
between the two (r ⫽ 0.86, P ⬍ 0.001, data not shown).
Ghrelin treatment also increased UCP2 (⫹86%) but not UCP3
transcript levels (Fig. 3D). Transcript levels of PPAR␥ (control: 100 ⫾ 24, ghrelin: 188 ⫾ 18%, P ⬍ 0.05) were also
higher after ghrelin administration in gastrocnemius muscle
and were positively related to mitochondrial COX activities in
all animals (r ⫽ 0.75, P ⬍ 0.001, data not shown) as well as
in each group considered separately (control: r ⫽ 0.70, P ⫽
0.07; ghrelin: r ⫽ 0.71, P ⫽ 0.07). These changes were
associated with marked reduction of tissue triglyceride content
in ghrelin- compared with vehicle-treated rats (control:
0.0072 ⫾ 0.0012, ghrelin: 0.00423 ⫾ 0.0005 mg/g dry wt; Fig.
1). In contrast to gastrocnemius, mitochondrial oxidative enzyme activities, transcript levels of ACC, CPT I, UCPs, and
PPAR␥, as well as tissue triglyceride content were comparable
in highly oxidative soleus muscle from ghrelin-treated and
control rats (Fig. 1 and Table 3).
Ghrelin favors expression of lipogenetic genes in white
adipose tissue. To further test the hypothesis that ghrelin would
favor a lipogenic pattern of gene expression in white adipose
tissue, transcript levels of ACC, FAS, CPT I, and PPARs were
also determined in this tissue. Ghrelin resulted in increased
transcript levels of both ACC (⫹84%) and FAS (⫹109%) in
abdominal white adipose tissue (Fig. 4, P ⬍ 0.05), whereas
PPAR␥ expression was increased to a nonsignificant extent
(control: 100 ⫾ 33; ghrelin: 163 ⫾ 51%). Ghrelin did not
change white adipose tissue expression of CPT I (Fig. 4).
PPAR␣ expression was not modified by ghrelin treatment in
any tissue (data not shown).
DISCUSSION
The current data demonstrate a role of ghrelin in the in vivo
regulation of fat distribution and metabolism in nonadipose
tissues. Ghrelin administration was reported to increase adipo-
288 • JANUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on October 25, 2016
Mitochondrial enzyme activities. Activities of mitochondrial COX
and CS were measured spectrophotometrically from whole tissue
homogenates, as previously reported (44).
Tissue triglycerides and plasma biochemical profile. Triglyceride
content was measured from 35 to 40 mg liver and each muscle after
lyophilization. Dry samples were homogenized in 2:1 chloroformmethanol solution in a 20:1 volume-to-weight ratio and kept at 4°C
overnight with gentle shaking. Phase separation was performed using
H2SO4 (1 mmol/l), lipid phase was dried under nitrogen and dissolved
in 100 ␮l ethanol, and triglyceride content was measured using a
commercially available kit (TG; Roche Diagnostics, Indianapolis, IN).
Plasma insulin and growth hormone concentrations were measured by
RIA (Linco, St. Louis, MO; see Ref. 8). Blood glucose concentration
was measured by reflectometer (Roche Diagnostics).
Statistical analysis. Student’s t-test for unpaired data was used to
compare variables in the two groups. Linear regression analysis was
used to study the relationships between variables. P values ⬍0.05
were considered statistically significant.
GHRELIN REGULATES LIPID METABOLISM IN LEAN TISSUES IN VIVO
E231
genesis and adiposity (12, 49, 50), consistent with the current
findings of enhanced adipose tissue lipogenic gene expression.
It is shown here that weight gain caused by sustained ghrelin
administration is further associated with altered lean tissue fat
distribution with triglyceride deposition favored in liver over
skeletal muscles. Circulating ghrelin is inversely related to
body weight and fat mass in pathophysiological conditions,
including obesity and anorexia (35, 51), suggesting that ghrelin
is involved in adaptation to altered body fat content. Tissuespecific liver fat deposition occurs during sustained or marked
caloric restriction and weight loss (3) that can also be associated with reduction of skeletal muscle fat (20). The current
observations therefore suggest a potential contribution of ghrelin to the regulation of tissue fat distribution during reduced
nutrient availability and loss of body weight and body fat.
AJP-Endocrinol Metab • VOL
Ghrelin treatment altered hepatic transcriptional and posttranscriptional expression of major regulators of lipid metabolism favoring lipogenesis over lipid oxidation. In addition,
ghrelin enhanced mitochondrial UCP2 transcript levels, in
agreement with UCP2 upregulation reported in experimental
fatty liver (11). Caution should be used in interpreting changes
in transcript levels with respect to their potential impact on
correspondent enzyme activities and functions. The coordinated pattern of changes in transcript and protein levels and
concomitant marked increase in triglyceride content, however,
suggest that changes in fatty acid metabolism were involved in
liver triglyceride accumulation. Sustained ghrelin treatment
was also associated with hyperglycemia and increased transcript levels of the key enzyme of the gluconeogenic pathway,
glucose-6-phosphatase, in keeping with in vitro findings (32).
288 • JANUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on October 25, 2016
Fig. 2. Ghrelin effects on liver mitochondrial-lipid
metabolism gene expression. A: transcript levels
(real-time PCR) of carnitine palmitoyltransferase I
(CPT I), acetyl-CoA carboxylase (ACC), fatty acid
synthase (FAS), and glucose-6-phosphatase (G-6Pase). B: protein levels of phosphorylated (p)
AMP-activated protein kinase (AMPK) and total (t)
and phosphorylated ACC. C: enzyme activities of
cytochrome c oxidase (COX) and citrate synthase
(CS). D: transcript levels of uncoupling protein 2
(UCP2) measured by Northern blot. B and D: bands
under each bar are representative samples from
each experimental group. Data are means ⫾ SE
from 8 animals/group. *P ⬍ 0.05, ghrelin vs. control by Student’s t-test for unpaired data.
E232
GHRELIN REGULATES LIPID METABOLISM IN LEAN TISSUES IN VIVO
These combined observations suggest that enhanced hepatic
production contributed to increase circulating glucose.
Changes in phosphorylated AMPK and total and phosphorylated ACC (56) further support the involvement of altered
AMPK signaling in hepatic effects of ghrelin treatment and
indicate a link between ghrelin and AMPK in vivo. A major
role of PPAR␥ and mitochondrial changes in ghrelin-induced
triglyceride deposition are in turn not supported by the current
data. Mitochondrial abnormalities reported in fatty liver in the
general population are indeed proposed to result from chronic
fat-related oxidative damage (4), in keeping with lack of
changes in the current short-term model.
Table 3. Transcript levels of ACC, CPT I, UCP2 and -3,
PPAR␥ (arbitrary units, %average control value), COX and
CS enzyme activities in soleus muscle in the two
experimental groups
ACC
CPT I
UCP2
UCP3
PPAR␥
COX activity
CS activity
Control
Ghrelin
100⫾16
100⫾6
100⫾19
100⫾21
100⫾13
226⫾11
282⫾17
98⫾11
90⫾8
82⫾16
80⫾17
92⫾28
236⫾31
298⫾16
Values are means ⫾ SE. COX, cytochrome c oxidase; CS, citrate synthase.
Units are ␮mol䡠min⫺1䡠 g protein⫺1.
AJP-Endocrinol Metab • VOL
Fig. 4. Abdominal white adipose tissue transcript levels of CPT I, ACC, and
FAS. Data are means ⫾ SE from 8 animals/group. Values were expressed as
%average value in the control group. *P ⬍ 0.05, ghrelin vs. control by
Student’s t-test for unpaired data.
288 • JANUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on October 25, 2016
Fig. 3. Ghrelin effects on gastrocnemius muscle mitochondrial-lipid metabolism gene expression. A: transcript levels (real-time PCR) of CPT I and ACC. B: protein
levels of phosphorylated AMPK and total and phosphorylated ACC. C: enzyme activities of COX and CS. D: UCP2 and -3 transcript levels measured by Northern Blot.
B and D: bands under each bar are representative samples from each experimental group. Data are means ⫾ SE from 8 animals/group. *P ⬍ 0.05, ghrelin vs. control
by Student’s t-test for unpaired data.
GHRELIN REGULATES LIPID METABOLISM IN LEAN TISSUES IN VIVO
AJP-Endocrinol Metab • VOL
mius muscle, since reduced mitochondrial enzyme activities
are related to impaired substrate utilization and muscle triglyceride accumulation in obese, type 2 diabetic, and aging individuals (21, 25, 39). Notably increased muscle fat oxidative
gene expression during acute nutrient deprivation is more
pronounced in moderately than in highly oxidative muscle
(42), consistent with the current muscle-specific ghrelin effects
that could be the result of higher basal oxidative reserve and
capacity for fat utilization in type I fibers (33). A direct link
between increased PPAR␥ expression or activation by thiazolidinediones and increased expression of skeletal muscle mitochondrial oxidative genes are indicated by several studies
(23, 27, 31). Knockout mouse models showing muscle insulin
resistance and tendency to accumulate muscle fat (22, 36)
highlighted the metabolic relevance of muscle PPAR␥. Although changes in transcript levels do not imply corresponding
effects on protein levels and activity, upregulation of PPAR␥
transcriptional expression parallel to oxidative enzyme activities suggests involvement of PPAR␥ in ghrelin-induced muscle
mitochondrial effects.
Intravenous bolus ghrelin administration can acutely increase growth hormone and, to a lesser extent, cortisol and
prolactin plasma concentrations (48). However, sustained stimulation of growth hormone secretagogue receptor (46) and
sustained repeated ghrelin administration in rodents (24, 57)
did not result in increased circulating growth hormone. These
findings are in excellent agreement with the current results in
supporting the concept that repeated administration blunts or
abolishes the growth hormone-secreting effects of ghrelin.
Because acute ghrelin-induced increments of cortisol and prolactin plasma concentration are markedly less pronounced than
that of growth hormone (48), comparable circulating growth
hormone levels indirectly suggest that no major changes in
cortisol and prolactin occurred after ghrelin treatment. In
addition, available data do not indicate that cortisol and prolactin effects would account for the pattern of changes in tissue
mitochondrial-oxidative metabolism gene expression and lipid
distribution. In particular, reported prolactin effects on liver
and white adipose tissue lipogenic gene expression and function are opposite to those observed after ghrelin treatment in
the current study (1). In addition, excess glucocorticoids are
not reported to exert independent effects on hepatic lipogenesis
and lipid deposition (14, 29, 54), whereas most (16, 18, 30),
although not all (55), reports agree on their suppressive or null
effect on skeletal muscle mitochondrial function. Thus, taken
together, the above observations do not support a major role of
additional hypophyseal hormonal changes in observed metabolic effects.
In conclusion, ghrelin induces tissue-specific changes in
mitochondrial and lipid metabolism gene expression favoring
triglyceride deposition in liver over skeletal muscle. These
results suggest that ghrelin could be involved in adaptive
changes of lipid distribution and metabolism in the presence of
caloric restriction and loss of body fat.
ACKNOWLEDGMENTS
We thank M. Sturma, A. de Santis, and A. Semolic for skillful technical
assistance.
288 • JANUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on October 25, 2016
Central ghrelin mediators include hypothalamic neuropeptide Y (24), the overexpression of which was reported to favor
hepatic ACC activity, lipogenesis, and glucose production
independent of its orexigenic effects (59). Importantly, neuropeptide Y also enhanced adipose tissue lipogenesis but not
muscle triglyceride deposition (53, 59), in strong indirect
agreement with tissue-specific changes in the current study.
The association between liver fat deposition and sustained
reduction of nutrient availability has been established (3), and
hepatic lipogenesis was reported to be enhanced during malnutrition and weight loss, presumably associated with hyperghrelinemia and hypoinsulinemia (28). Thus enhanced liver
lipid deposition induced by ghrelin could contribute to fatty
liver associated with marked or sustained reduction of nutrient
intake. Because circulating insulin is commonly reduced in
calorie-restricted states and high insulin can favor hepatic
lipogenesis (3), it is possible that maintenance of basal plasma
insulin concentrations played a permissive role in the rapid
onset of ghrelin-induced changes in liver triglyceride content in
the current experimental setting. Ghrelin-induced lipogenic
patterns of gene expression in liver and adipose tissue are
further consistent with and could mediate excess fat gain
during refeeding in different clinical models of undernutrition
(17, 41).
Preferential fat deposition in liver and adipose tissue (12, 49)
could have also contributed to prevent muscle triglyceride
deposition in the current model by preventing increments of
circulating free fatty acids and muscle free fatty acid supply
that commonly occur in ghrelin-independent weight gain (9).
Unchanged plasma free fatty acids could have also prevented
major changes in muscle CPT I transcriptional expression,
since fatty acid availability is an independent activator of
muscle fat oxidative disposal (40). Ghrelin-induced weight
gain was conversely not associated with downregulation of
transcriptional and posttranscriptional expression of measured
mitochondrial-lipid metabolism genes, at variance with observations in short-term diet-induced weight gain and human
models of ghrelin-independent obesity (25, 37). In particular,
the increase of representative mitochondrial enzyme activities
and UCP2 transcript levels in mixed muscle [representing a
majority of muscle tissue in rodents and humans (5)] suggests
a role of ghrelin in the regulation of muscle mitochondrial
oxidative capacity. Enhanced gastrocnemius muscle mitochondrial gene expression is reported during chronic caloric restriction (47). Early increments of the ability for muscle substrate
oxidative disposal also occur in the presence of acute or
short-term reduction of nutrient intake (42, 52). Expression of
mitochondrial genes is in turn rapidly reduced in rodent muscle
after 3 days of overfeeding and weight gain possibly associated
with ghrelin suppression (37). The above observations suggest
that early changes of muscle mitochondrial oxidative capacity
contribute to adaptive changes in substrate disposal after modifications of nutrient intake. This hypothesis is also consistent
with rapid changes in muscle lipid deposition after treatment
with nutrient-sensing hormones insulin (2) and leptin (43) for
3–7 days in human and rodent models. It is therefore possible
to hypothesize that early ghrelin increments (8, 13) contribute
to muscle metabolic adaptive changes in calorie-restricted
states (47, 52). Enhanced mitochondrial oxidative capacity
could also have independently contributed to initiate or maintain ghrelin-induced triglyceride depletion in mixed gastrocne-
E233
E234
GHRELIN REGULATES LIPID METABOLISM IN LEAN TISSUES IN VIVO
REFERENCES
AJP-Endocrinol Metab • VOL
288 • JANUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on October 25, 2016
1. Agius L, Robinson AM, Girard JR, and Williamson DH. Alterations in
the rate of lipogenesis in vivo in maternal liver and adipose tissue on
premature weaning of lactating rats: a possible regulatory role of prolactin.
Biochem J 180: 689 – 692, 1979.
2. Anderwald C, Bernroider E, Krssak M, Stingl H, Brehm A, Bischof
MG, Nowotny P, Roden M, and Waldhausl W. Effects of insulin
treatment in type 2 diabetic patients on intracellular lipid content in liver
and skeletal muscle. Diabetes 51: 3025–3032, 2002.
3. Angulo P. Nonalcoholic fatty liver disease. N Engl J Med 346: 1221–
1231, 2002.
4. Angulo P and Lindor KD. Insulin resistance and mitochondrial abnormalities in NASH: a cool look into a burning issue. Gastroenterology 120:
1281–1285, 2001.
5. Armstrong RB and Phelps RO. Muscle fiber type composition of the rat
hindlimb. Am J Anat 171: 259 –272, 1984.
6. Barazzoni R and Nair KS. Changes in uncoupling protein-2 and -3
expression in aging rat skeletal muscle, liver and heart. Am J Physiol
Endocrinol Metab 280: E413–E419, 2001.
7. Barazzoni R, Short KR, and Nair KS. Effects of aging on mitochondrial
DNA copy number and cytochrome c oxidase gene expression in rat
skeletal muscle, liver and heart. J Biol Chem 275: 3343–3347, 2000.
8. Barazzoni R, Zanetti M, Stebel M, Biolo G, Cattin L, and Guarnieri
G. Hyperleptinemia prevents increased plasma ghrelin concentration during short-term moderate caloric restriction in rats. Gastroenterology 124:
1188 –1192, 2003.
9. Boden G. Role of fatty acids in the pathogenesis of insulin resistance and
NIDDM. Diabetes 46: 3–10, 1997.
10. Boss O, Hagen T, and Lowell BB. Uncoupling proteins 2 and 3: potential
regulators of mitochondrial energy metabolism. Diabetes 49: 143–156,
2000.
11. Chavin KD, Yang S, Lin HZ, Chatham J, Chacko VP, Hoek JB,
Walajtys-Rode E, Rashid A, Chen CH, Huang CC, Wu TC, Lane MD,
and Diehl AM. Obesity induces expression of uncoupling protein-2 in
hepatocytes and promotes liver ATP depletion. J Biol Chem 274: 5692–
5700, 1999.
12. Choi K, Roh SG, Hong YH, Shrestha YB, Hishikawa D, Chen C,
Kojima M, Kangawa K, and Sasaki S. The role of ghrelin and growth
hormone secretagogues receptor on rat adipogenesis. Endocrinology 144:
754 –759, 2003.
13. Cummings DE, Weigle DS, Frayo RS, Breen P, Ma MK, Dellinger EP,
and Purnell JQ. Plasma ghrelin levels after diet-induced weight loss or
gastric by-pass surgery. N Engl J Med 346: 1623–1630, 2002.
14. Dahm CH Jr, Jellinek M, Mueller EJ, Rickey C, and Hertelendy F.
Some effects of medroxyprogesterone acetate on intermediary metabolism
in rat liver. Life Sci 22: 165–169, 1978.
15. Darley-Usmar V, Ragan I, Smith P, and Wilson M. The proteins of the
mitochondrial inner membrane and their role in oxidative phosphorylation.
In: Mitochondria: DNA, Proteins and Disease, edited by Darley-Usmar V
and Shapira AHV. London: Portland, 1994.
16. Duclos M, Gouarne C, Martin C, Rocher C, Mormede P, and Letellier
T. Effects of corticosterone on muscle mitochondria identifying different
sensitivity to glucocorticoids in Lewis and Fischer rats. Am J Physiol
Endocrinol Metab 286: E159 –E167, 2004.
17. Dulloo AG, Jacquet J, and Girardier L. Poststarvation hyperphagia and
body fat overshooting in humans: a role for feedback signals from lean and
fat tissues. Am J Clin Nutr 65: 717–723, 1997.
18. Dumas JF, Simard G, Roussel D, Douay O, Foussard F, Malthiery Y,
and Ritz P. Mitochondrial energy metabolism in a model of undernutrition induced by dexamethasone. Br J Nutr 90: 969 –977, 2003.
19. Forouhi NG, Jenkinson G, Thomas EL, Mullick S, Mierisova S,
Bhonsle U, McKeigue PM, and Bell JD. Relation of triglyceride stores
in skeletal muscle cells to central obesity and insulin sensitivity in
European and South Asian men. Diabetologia 42: 932–935, 1999.
20. Goodpaster BH, Theriault R, Watkins SC, and Kelley DE. Intramuscular lipid content is increased in obesity and decreased by weight loss.
Metabolism 49: 467– 472, 2000.
21. He J, Watkins S, and Kelley DE. Skeletal muscle lipid content and
oxidative enzyme activity in relation to muscle fiber type in type 2 diabetes
and obesity. Diabetes 50: 817– 823, 2001.
22. Hevener AL, He W, Barak Y, Le J, Bandyopadhyay G, Olson P,
Wilkes J, Evans RM, and Olefsky J. Muscle-specific Pparg deletion
causes insulin resistance. Nat Med 9: 1491–1497, 2003.
23. Jove M, Salla J, Planavila A, Cabrero A, Michalik L, Wahli W,
Laguna JC, and Vazquez Carrera M. Impaired expression of the
mitochondrial DNA-encoded gene NADH dehydrogenase subunit 1 and
PPARgamma coactivator-1 in skeletal muscle of ZDF rats: restoration by
troglitazone treatment. J Lipid Res 45: 113–123, 2004.
24. Kamegai J, Tamura H, Shimizu T, Ishii S, Sugihara H, and Wakabayashi I. Chronic central infusion of ghrelin increases hypothalamic neuropeptide Y and Agouti-related protein mRNA levels and body weight in
rats. Diabetes 50: 2438 –2443, 2001.
25. Kelley DE, Goodpaster B, Wing RR, and Simoneau JA. Skeletal
muscle fatty acid metabolism in association with insulin resistance, obesity, and weight loss. Am J Physiol Endocrinol Metab 277: E1130 –E1141,
1999.
26. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, and Kangaw
K. Ghrelin is a ghrowth-hormone releasing acylated peptide from stomach. Nature 402: 656 – 660, 1999.
27. Lapsys NM, Kriketos AD, Lim-Fraser M, Poynten AM, Lowy A,
Furler SM, Chisholm DJ, and Cooney GJ. Expression of genes involved
in lipid metabolism correlate with peroxisome proliferator-activated receptor gamma expression in human skeletal muscle. J Clin Endocrinol
Metab 85: 4293– 4297, 2000.
28. Lieber CS, Spritz N, and DeCarli LM. Fatty liver produced by dietary
deficiencies: its pathogenesis and potentiation by ethanol. J Lipid Res 10:
283–287, 1969.
29. Mantha L and Deshaies Y. Energy intake-independent modulation of
triglyceride metabolism by glucocorticoids in the rat. Am J Physiol Regul
Integr Comp Physiol 278: R1424 –R1432, 2000.
30. Martens ME, Peterson PL, and Lee CP. In vitro effects of glucocorticoid on mitochondrial energy metabolism. Biochim Biophys Acta 1058:
152–160, 1991.
31. Medvedev AV, Snedden SK, Raimbault S, Ricquier D, and Collins S.
Transcriptional regulation of the mouse uncoupling protein-2 gene. Double E-box motif is required for peroxisome proliferator-activated receptorgamma-dependent activation. J Biol Chem 276: 10817–10823, 2001.
32. Murata M, Okimura Y, Iida K, Matsumoto M, Sowa H, Kaji H,
Kojima M, Kangawa K, and Chihara K. Ghrelin modulates the downstream molecules of insulin signaling in hepatoma cells. J Biol Chem 277:
5667–5674, 2002.
33. Nagaraj RY, Nosek CM, Brotto MA, Nishi M, Takeshima H, Nosek
TM, and Ma J. Increased susceptibility to fatigue of slow- and fast-twitch
muscles from mice lacking the MG29 gene. Physiol Genomics 4: 43– 49,
2000.
34. Nakazato M, Murakami N, Date Y, Kojima N, Matsuo H, Kangawa K,
and Matsukura S. A role of ghrelin in the central regulation of feeding.
Nature 409: 194 –198, 2001.
35. Nedvidkova J, Krykorkova I, Bartak V, Papezova H, Gold PW, Alesci
S, and Pacak K. Loss of meal-induced decrease in plasma ghrelin levels
in patients with anorexia nervosa. J Clin Endocrinol Metab 88: 1678 –
1682, 2003.
36. Norris AW, Chen L, Fisher SJ, Szanto I, Ristow M, Jozsi AC,
Hirshman MF, Rosen ED, Goodyear LJ, Gonzalez FJ, Spiegelman
BM, and Kahn CR. Muscle-specific PPARgamma-deficient mice develop increased adiposity and insulin resistance but respond to thiazolidinediones. J Clin Invest 112: 608 – 618, 2003.
37. Obici S, Wang J, Chowdury R, Feng Z, Siddhanta U, Morgan K, and
Rossetti L. Identification of a biochemical link between energy intake and
energy expenditure. J Clin Invest 109: 1599 –1605, 2002.
38. Olefsky JM. Treatment of insulin resistance with peroxisome proliferatoractivated receptor gamma agonists. J Clin Invest 106: 467– 472, 2000.
39. Petersen KF, Befroy D, Dufour S, Dziura J, Ariyan C, Rothman DL,
DiPietro L, Cline GW, and Shulman GI. Mitochondrial dysfunction in
the elderly: possible role in insulin resistance. Science 300: 1140 –1142,
2003.
40. Rasmussen BB and Wolfe RR. Regulation of fatty acid oxidation in
skeletal muscle. Annu Rev Nutr 19: 463– 484, 1999.
41. Salisbury JJ, Levine AS, Crow SJ, and Mitchell JE. Refeeding, metabolic rate, and weight gain in anorexia nervosa: a review. Int J Eat Disord
17: 337–345, 1995.
42. Samec S, Seydoux J, Russell AP, Montani JP, and Dulloo AG. Skeletal
muscle heterogeneity in fasting-induced upregulation of genes encoding
UCP2, UCP3, PPARgamma and key enzymes of lipid oxidation. Pflügers
Arch 445: 80 – 86, 2002.
43. Shimabukuro M, Koyama K, Chen G, Wang M-Y, Trieu F, Lee Y,
Newgard CB, and Unger RH. Direct antidiabetic effect of leptin through
GHRELIN REGULATES LIPID METABOLISM IN LEAN TISSUES IN VIVO
44.
45.
46.
47.
49.
50.
51.
AJP-Endocrinol Metab • VOL
52. Tucker MZ and Turcotte LP. Brief food restriction increases FA
oxidation and glycogen synthesis under insulin-stimulated conditions.
Am J Physiol Regul Integr Comp Physiol 282: R1210 –R1218, 2002.
53. Vettor R, Zarjevski N, Cusin I, Rohner-Jeanrenaud F, and
Jeanrenaud B. Induction and reversibility of an obesity syndrome by
intracerebroventricular neuropeptide Y administration to normal rats.
Diabetologia 37: 1202–1208, 1994.
54. Volpe JJ and Marasa JC. Hormonal regulation of fatty acid synthetase,
acetyl-CoA carboxylase and fatty acid synthesis in mammalian adipose
tissue and liver. Biochim Biophys Acta 380: 454 – 472, 1975.
55. Weber K, Bruck P, Mikes Z, Kupper JH, Klingenspor M, and
Wiesner RJ. Glucocorticoid hormone stimulates mitochondrial biogenesis specifically in skeletal muscle. Endocrinology 143: 177–184, 2002.
56. Winder WW and Hardie DG. AMP-activated protein kinase, a metabolic
master switch: possible roles in type 2 diabetes. Am J Physiol Endocrinol
Metab 277: E1–E10, 1999.
57. Wren AM, Small CJ, Abbott CR, Dhillo WS, Seal LJ, Cohen MA,
Batterham RL, Taheri S, Stanley SA, Ghatei MA, and Bloom SR.
Ghrelin causes hyperphagia and obesity in rats. Diabetes 50: 2540 –2547,
2001.
58. Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S,
Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P,
Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB, and
Kadowaki T. Adiponectin stimulates glucose utilization and fatty-acid
oxidation by activating AMP-activated protein kinase. Nat Med 8: 1288 –
1295, 2002.
59. Zarjevski N, Cusin I, Vettor R, Rohner-Jeanrenaud F, and
Jeanrenaud B. Chronic intracerebroventricular neuropeptide-Y administration to normal rats mimics hormonal and metabolic changes of obesity.
Endocrinology 133: 1753–1758, 1993.
288 • JANUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on October 25, 2016
48.
triglyceride depletion of tissues. Proc Natl Acad Sci USA 94: 4637– 4641,
1997.
Short KR, Nygren J, Barazzoni R, Levine J, and Nair KS. T3 increases
mitochondrial ATP production in oxidative but not glycolytic muscle
despite increased expression of UCP-2 and -3. Am J Physiol Endocrinol
Metab 280: E761–E766, 2001.
Shulman GI. Cellular mechanisms of insulin resistance. J Clin Invest 106:
171–176, 2000.
Smith RG, Pong SS, Hickey G, Jacks T, Cheng K, Leonard R, Cohen
CJ, Arena JP, Chang CH, Drisko J, Wyvratt M, Fisher M, Nargund
R, and Patchett A. Modulation of pulsatile GH release through a novel
receptor in hypothalamus and pituitary gland. Recent Prog Horm Res 51:
261–285, 1996.
Sreekumar R, Unnikrishnan J, Fu A, Nygren J, Short KR, Schimke J,
Barazzoni R, and Nair KS. Effects of caloric restriction on mitochondrial
function and gene transcripts in rat muscle. Am J Physiol Endocrinol
Metab 283: E38 –E43, 2002.
Takaya K, Ariyasu H, Kanamoto N, Iwakura H, Yoshimoto A,
Harada M, Mori K, Komatsu Y, Usui T, Shimatsu A, Ogawa Y,
Hosoda K, Akamizu T, Kojima M, Kangawa K, and Nakao K. Ghrelin
strongly stimulates growth hormone release in humans. J Clin Endocrinol
Metab 85: 4908 – 4911, 2000.
Thompson NM, Gill DA, Davies R, Loveridge N, Houston PA, Robinson IC, and Wells T. Ghrelin and des-octanoyl ghrelin promote adipogenesis directly in vivo by a mechanism independent of the type 1a growth
hormone secretagogue receptor. Endocrinology 145: 234 –242, 2004.
Tschop M, Smiley DL, and Heiman ML. Ghrelin induces adiposity in
rodents. Nature 407: 908 –913, 2000.
Tschop M, Weyer C, Tataranni PA, Devanarayan V, Ravussin E, and
Heiman ML. Circulating ghrelin levels are decreased in human obesity.
Diabetes 50: 707–709, 2001.
E235