Download NO APICAL MERISTEM (MtNAM) regulates

Research
NO APICAL MERISTEM (MtNAM) regulates floral organ identity
and lateral organ separation in Medicago truncatula
Xiaofei Cheng, Jianling Peng, Junying Ma, Yuhong Tang, Rujin Chen, Kirankumar S. Mysore and Jiangqi Wen
Plant Biology Division, Samuel Roberts Noble Foundation, 2510 Sam Noble Parkway, Ardmore, OK 73401, USA
Summary
Author for correspondence:
Jiangqi Wen
Tel: +1 580 224 6680
Email: [email protected]
Received: 27 January 2012
Accepted: 11 March 2012
New Phytologist (2012) 195: 71–84
doi: 10.1111/j.1469-8137.2012.04147.x
Key words: boundary, floral organ identity,
lateral organ separation, Medicago
truncatula, Medicago truncatula NO APICAL
MERISTEM (MtNAM).
• The CUP-SHAPED COTYLEDON (CUC) ⁄ NO APICAL MERISTEM (NAM) family of genes
control boundary formation and lateral organ separation, which is critical for proper leaf and
flower patterning. However, most downstream targets of CUC ⁄ NAM genes remain unclear.
• In a forward screen of the tobacco retrotransposon1 (Tnt1) insertion population in
Medicago truncatula, we isolated a weak allele of the no-apical-meristem mutant mtnam-2.
Meanwhile, we regenerated a mature plant from the null allele mtnam-1. These materials
allowed us to extensively characterize the function of MtNAM and its downstream genes.
• MtNAM is highly expressed in vegetative shoot buds and inflorescence apices, specifically
at boundaries between the shoot apical meristem and leaf ⁄ flower primordia. Mature plants of
the regenerated null allele and the weak allele display remarkable floral phenotypes: floral
whorls and organ numbers are reduced and the floral organ identity is compromised. Microarray and quantitative RT-PCR analyses revealed that all classes of floral homeotic genes are
down-regulated in mtnam mutants. Mutations in MtNAM also lead to fused cotyledons and
leaflets of the compound leaf as well as a defective shoot apical meristem.
• Our results revealed that MtNAM shares the role of CUC ⁄ NAM family genes in lateral
organ separation and compound leaf development, and is also required for floral organ
identity and development.
Introduction
Boundaries are composed of distinctive sets of cells that are
formed between the shoot apical meristem (SAM) and lateral
organs or between lateral organs during embryogenesis and
post-embryonic development. Boundaries separate lateral organ
primordia from the SAM and adjacent organ primordia, and
promote SAM and organ primordium formation (Aida &
Tasaka, 2006a,b; Rast & Simon, 2008). Boundary cells have
specific morphological and cytological characteristics. Cells at the
meristem and organ boundaries display a saddle-shaped surface
and are elongated along the boundaries (Kwiatkowska, 2004,
2006; Reddy et al., 2004). Cell proliferation analysis reveals that
boundaries between inflorescence and floral meristems, and
between floral organs, consist of nondividing cells.
CUP-SHAPED
COTYLEDON
(CUC) ⁄ NO
APICAL
MERISTEM (NAM), a small group of plant-specific NAC transcription factors, plays important roles in the regulation of
boundary development (Aida & Tasaka, 2006a; Rast & Simon,
2008). The CUC ⁄ NAM gene family includes CUP-SHAPED
COTYLEDON1, 2 and 3 (CUC1, 2 and 3) in Arabidopsis
thaliana, NO APICAL MERISTEM (NAM) in Petunia,
GOBLET (GOB) in tomato (Solanum lycopersicum) and
CUPULIFORMIS (CUP) in Antirrhinum majus (Souer et al.,
1996; Aida et al., 1997; Takada et al., 2001; Vroemen et al.,
2012 The Authors
New Phytologist 2012 New Phytologist Trust
2003; Weir et al., 2004; Berger et al., 2009). CUC ⁄ NAM genes
are expressed in all boundaries between organ primordia and
meristems from early embryogenesis to floral developmental
stages. Mutations in CUC1 ⁄ CUC2 of A. thaliana and in NAM of
Petunia lead to fusion of cotyledons and some floral organs, as
well as severe defects of the primary apical meristem (Souer et al.,
1996; Aida et al., 1997; Takada et al., 2001). Double mutants
cuc3 ⁄ cuc2 or cuc3 ⁄ cuc1 in A. thaliana and the co-suppression
plants of NAM and its homolog genes NAM HOMOLOG-1
(NH-1) and NAM HOMOLOG-3 (NH-3) in Petunia exhibit
lateral organ fusion during vegetative development (Souer et al.,
1998; Hibara et al., 2006). Mutations in the CUP gene in snapdragon (Antirrhinum majus), however, strongly affect all lateral
organ boundaries during embryonic, vegetative and reproductive
development (Weir et al., 2004). These studies not only demonstrate that CUC ⁄ NAM genes play a pivotal role in organ
separation and primary apical meristem formation but also show
that different degrees of functional redundancy exist amongst the
CUC ⁄ NAM family members.
Plant leaf primordia initiate from the flanks of the SAM and go
through primary and secondary morphogenesis to form various
leaf patterns, such as simple or compound leaves. Of particular
importance for leaf patterning is the region at the leaf margins, the
marginal blastozone or leaf marginal meristems, which maintains
a morphogenetic activity and is responsible for the initiation of
New Phytologist (2012) 195: 71–84 71
www.newphytologist.com
New
Phytologist
72 Research
secondary structures, such as leaflets (Blein et al., 2010; Efroni
et al., 2010). In compound-leafed species, both class I homeodomain KNOTTED1-like genes (KNOXI), which were initially
identified for their roles in the maintenance of shoot meristem
identity (Long & Barton, 1998), and the floral meristem identity
gene LEAFY (LFY ) and its orthologs, UNIFOLIATA (UNI ) in
pea (Pisum sativum) and SINGLE LEAFLET1 (SGL1) in
Medicago truncatula, are species-specific positive regulators in
compound leaf development (Hofer et al., 1997; Champagne
et al., 2007; Wang et al., 2008; Blein et al., 2010). Recent studies
revealed that CUC ⁄ NAM genes also share a conserved function in
compound leaf development and leaf margin formation (Nikovics
et al., 2006; Blein et al., 2008, 2010; Bilsborough et al., 2011;
Hasson et al., 2011). Reduced expression of NAM ⁄ CUC leads to
the suppression of marginal outgrowth and thus formation of
reduced and ⁄ or fused leaflets during compound leaf development
in a diverse compound-leafed species (Blein et al., 2008). GOB, a
NAM ortholog in tomato, is essential for proper specification of
lateral organ boundaries at the apical meristem and proper specification of leaflet boundaries in developing compound leaves
(Berger et al., 2009). Furthermore, it has been reported that the
ectopic expression of CUC1 in the margins of developing leaves is
sufficient to change their architecture from simple to compound
in A. thaliana (Hasson et al., 2011). It is thus proposed that
NAM ⁄ CUC genes have a common role in promoting leaflet
formation and separation.
Previous studies suggest that CUC ⁄ NAM genes prevent organ
fusion through repression of boundary cell growth and that the
possible cytological function of these genes is to regulate cell
division or orientation as well as cell expansion (Aida & Tasaka,
2006a,b; Rast & Simon, 2008). CUP in snapdragon directly interacts with a TCP-domain transcription factor, which has previously been shown to regulate organ outgrowth (Weir et al., 2004).
Over the last decade, several regulators of CUC genes have been
identified in A. thaliana, including SHOOTMERISTEMLESS
(STM), PINFORMED1 (PIN1), MONOPTEROS (MP), and
microRNA164 (Aida et al., 1999, 2002; Mallory et al., 2004; Aida
& Tasaka, 2006a; Larue et al., 2009). STM plays a major role in
SAM initiation and is also implicated in cotyledon separation.
Activation of STM expression in the embryo apical end requires
CUC1 and CUC2, whereas at later stages of A. thaliana embryogenesis STM is required for proper expression patterns of CUC1
and CUC2 (Aida et al., 1999; Hibara et al., 2003). Further studies
showed that STM directly binds to the promoter of CUC1 and
thus up-regulates CUC1 expression (Spinelli et al., 2011). PIN1
and MP repress CUC1 expression in cotyledons and promote
CUC2 expression in cotyledon boundaries (Aida et al., 2002;
Furutani et al., 2004). During leaf margin development, CUC2
promotes the generation of PIN1-dependent auxin accumulation
while auxin represses CUC2 expression. This feedback loop
regulates the activity of the conserved auxin efflux module in leaf
margins to form stable serration patterns (Bilsborough et al.,
2011). Both CUC1 ⁄ 2 and GOB are post-transcriptionally
regulated by microRNA164 for fine-tuning of organ boundaries
both temporally and spatially, especially in leaf margin development (Laufs et al., 2004; Mallory et al., 2004; Nikovics et al.,
New Phytologist (2012) 195: 71–84
www.newphytologist.com
2006; Larue et al., 2009). These genes are negative or reciprocal
regulators of CUC ⁄ NAM. More recently, it was reported that
CUC1 directly activates the expression of LIGHT-DEPENDENT
SHORT HYPOCOTYLS (LSH) (LSH3 and LSH4) in shoot organ
boundaries (Takeda et al., 2011). Despite these observations, how
CUC ⁄ NAM regulates downstream gene(s) to affect lateral organ
development remains elusive.
In this study, two insertion mutant alleles of MtNAM, one null
allele with a retrotransposon Tnt1 insertion, and one weak allele
with a native Medicago Endogenous Retrotansposon 1 (MERE1)
insertion, were characterized in detail in M. truncatula. The
mtnam mutants display unique simplified floral organ phenotypes in addition to the common fused-cotyledon and leaflet
phenotypes shared with other cuc ⁄ nam mutants. Microarray and
real-time quantitative PCR analyses revealed that mutations in
MtNAM down-regulate the expression of floral homeotic genes.
MtNAM is expressed at boundaries between lateral organs ⁄ organ
primordia and meristems. These results indicate that MtNAM
plays an essential role in controlling floral organ formation and
lateral organ separation in M. truncatula.
Materials and Methods
Seed treatment and plant growth
Seeds of wild-type Medicago truncatula Gaertn. R108 and mutant
lines were scarified with concentrated sulfuric acid for 8 min and
thoroughly rinsed with water, which was followed by sterilization
in 30% bleach for 10 min, extensive rinsing with ddH2O, cold
treatment at 4C for 7 d on MS medium, and germination in a
growth chamber with a regime of a 18 h light (25C) : 6 h dark
(22C) photoperiod. After 2 wk, seedlings were transferred into
Metro-Mix 350 (Scotts, Marysville, OH, USA) composite soil
and grown in a glasshouse until maturation.
Tnt1 insertion mutant screening and molecular
confirmation
The M. truncatula Tnt1 insertional mutant population was
generated as described previously (Tadege et al., 2008). In a forward
genetic screen for mutants with fused cotyledons or fused leaflets,
we identified mutant lines NF1937 (mtnam-1) and NF1757
(mtnam-2). Recovery of flanking sequence tags (FSTs) in the
Tnt1 insertion line NF1937 was carried out by thermal asymmetric interlaced (TAIL)-PCR as described previously (Cheng et al.,
2011). Each individual FST was analyzed by tBLASTx against
the M. truncatula genome sequence at the National Center for
Biotechnology Information (http://blast.ncbi.nlm.nih.gov/).
Candidate FSTs were selected for co-segregation analysis.
Segregated R1 seeds from NF1937 were treated and grown as
described in the previous section. Homozygous plants were identified by their fused cotyledons, and heterozygous plants were
identified by examining dissected maturing pods, which in
heterozygous plants produced seeds with both fused cotyledons
and normal cotyledons. Genomic DNA from both homozygous
and heterozygous plants was extracted. Forward primer Tnt1-F
2012 The Authors
New Phytologist 2012 New Phytologist Trust
New
Phytologist
Research 73
and reverse primers from selected candidate FSTs were used for
genotyping the NF1937 progenies.
In situ hybridization
PCR-based reverse screening for MtNAM mutant lines and
molecular cloning of MtNAM
Young seeds and shoot apices, at both vegetative and reproductive stages, were fixed and in situ hybridization was performed as
described by Zhou et al. (2010). A 638-bp cDNA fragment from
the nonconserved region of MtNAM was used as the probe for
hybridization.
One c. 500-bp FST was found co-segregating with the fused cotyledon phenotype in NF1937 progenies. Part of this FST hits
NAM ⁄ CUC family genes in Petunia hybrid and Arabidopsis
thaliana but no M. truncatula genomic sequence matched this
FST. To recover the full genomic sequence of the gene, two sets of
primers, MtNAM-F, MtNAM-F1, MtNAM-R and MtNAM-R1
(sequences are listed in Table 1), were designed on both ends of
the FST sequence. TAIL-PCR was carried out using wild-type
R108 DNA as the template (Liu et al., 1995). After two rounds of
PCR amplification, the full-length genomic DNA sequence of
MtNAM was obtained. To obtain more mutant alleles of mtnam,
PCR-based reverse genetic screening was performed as described
previously using the pooled DNA from the Tnt1 mutant
population (Tadege et al., 2008; Cheng et al., 2011).
Regeneration of mtnam-1 plants
Immature seeds with fused cotyledons at the late cotyledon stage
were collected from MtNAM ⁄ mtnam-1 heterozygous plants, sterilized for 15 min with 30% bleach + 0.01% Tween-20, and
rinsed three times with autoclaved ddH2O. Immature embryos
with fused cotyledons (homozygous mtnam-1) were cut into two
halves and placed on the callus-induction medium. Callus
subculture, somatic embryogenesis and plantlet regeneration were
carried out following previous protocols (Trinh et al., 1998).
Regenerated plants were transferred into soil and grown to
maturation in the glasshouse.
Tissue clearing
Flowers and seeds dissected from young pods 1–2 d after pollination were cleared in Hoyer’s solution (7.5 g of gum arabic, 100 g
of chloral hydrate, 5 ml of glycerol and 60 ml of ddH2O).
Ovules and embryos were further dissected and observed under a
dissecting microscope.
Scanning electron microscopy
Inflorescence shoot apices were dissected and fixed in 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS; pH 7.2) for
12 h at 4C. After rinsing with PBS for 3 h, samples were dehydrated in an ethanol series and critical-point dried. The samples
were then mounted on metal stubs, sputter-coated with gold and
observed under a Zeiss DSM-960A SEM (Carl Zeiss Inc.) at an
accelerating voltage of 5 kV.
RNA extraction, RT-PCR and qRT-PCR
Roots, stems, leaves, vegetative shoots, inflorescence shoots,
flower buds, young pods and young seeds were collected from
wild-type R108 plants. Vegetative shoots and inflorescence
shoots were also collected from both heterozygous and homozygous plants of mtnam-1 and mtnam-2. Total RNA was extracted
Table 1 Primer sequences of genes used in the experiments
Gene
Forward primer
Reverse primer
MtNAM
RtF- ATGAACAACAACAGTAATAACAACAG
F- ACTCATGTATTCACAAAAGTGTGA
F1- ACTCTTACATGCACCATAGGGT
F- ACAGTGCTACCTCCTCTGGATG
F1- CCTTGTTGGATTGGTAGCCAACTTTGTTG
RtR- TTAATAGTTCCACATGCAATCAAGCT
R- TGAACTTATGAAGGATGAATGGGT
R1- AAGGATGAATGGGTCATTTCA
R- CAGTGAACGAGCAGAACCTGTG
R1-TGTAGCACCGAGATACGGTAATTAACAAGA
R-GTCAAACATGTATTACTGCCATGTG
R- TCTCAGCATGACAAAGCTGACGAAGTTTT
AGGGCCATCAGCTCTTTGTA
GAATGGTGCTGACAGAATGC
TGGTAACCATCCTCCCATGT
CGTCCACGGCTAGAGAAGAC
TGATCTTGCCTGGCATACTG
TGAATCAAGTTGGCGTTCAA
GTCCATGGGATTGGTTTCAG
CACGTGGCGGTTATTTGTAG
CTTGGTTTCTGCGTGTACGA
AGCACCTCTGGCTGACAAAT
CCATCATTTCAAAACGTGGA
RtR-ACTCACACCGTCACCAGAATCC
CAATTTCTCGCTCTGCTGAGGTGG
Tnt1
MERE1
SGL
PISTILLATA ⁄ MtPI
APETALA3-like 2
SEPALLATA3-like
AGAMOUS-like1
AGAMOUS-like 2
SEPALLATA1-like
SEPALLATA 3-like
AP2-L
APETALA1 ⁄ MtPIM
APETALA1 ⁄ FUL-like
APETALA3-like 2
MtActin2
MtActin2
F- AGTTTCATTGCTTACCATGGATCCCGAC
GGAAAACCCTATGGGATGCT
AGCTTGGAGCAGATGAATGG
GTCGGCATCCAAGTCAAACT
TGGAAGGGGAAAGATTGAGA
AAGTGAGCAGAGGAGCAACC
ACCTGCCAAAGAGCTTGAGA
GCAGGAAGCTAGGCAGAGAA
GCATGTGCCTATGACTGTGC
TATACGCGACTGAAGGCAAA
GACATTGCAGGAGCAAAACA
GGCTATTCGTGAGCGTAAGG
RtF-TCAATGTGCCTGCCATGTATGT
GGCTGGATTTGCTGGAGATGATGC
MtNAM, Medicago truncatula NO APICAL MERISTEM; SGL, SINGLE LEAFLET.
2012 The Authors
New Phytologist 2012 New Phytologist Trust
New Phytologist (2012) 195: 71–84
www.newphytologist.com
New
Phytologist
74 Research
using Tri-Reagent (Gibco-BRL Life Technologies, Grand Island,
NY, USA) and treated with Turbo DNase I (Ambion). For
RT-PCR and qRT-PCR, 3 lg of total RNA was used for reverse
transcription using SuperScript III Reverse Transcriptase (Invitrogen) with the oligo (dT)20 primer. Two microliters of 1 : 20
diluted cDNA was used as the template. Gene-specific primers
for RT-PCR and qRT-PCR are listed in Table 1. All qRT-PCR
reactions were carried out using a 7900HT Fast Real-Time PCR
System (Applied Biosystems), and the data were analyzed using
SDS 2.2.1 software (Applied Biosystems, Life Technologies,
Grand Island, NY, USA). PCR efficiency (E) was estimated using
the LINREGPCR program (Ramakers et al., 2003) and the transcript levels were determined by relative quantification using the
M. truncatula actin gene (tentative consensus no. 107326) as the
reference (Benedito et al., 2008).
Turbo DNase I (Ambion). 10 lg of total RNA from each sample
was used for probe labeling. Hybridization against Affymetrix
Medicago Genechip and scanning for microarray analysis were
conducted according to the manufacturer’s instructions (Affymetrix,
Santa Clara, CA, USA). Differentially expressed genes between
wild-type-looking plants and homozygous mtnam-1 were selected
using associative analysis as described previously (Benedito et al.,
2008). Raw data from the experiment were deposited in the
ArrayExpress database under the ArrayExpress accession number
E-MEXP-3480.
Microarray analysis
Results
For microarray analysis, total RNA was extracted from three biological replicates of the inflorescence shoots from both
wild-type-looking plants (including wild-type and heterozygous
plants from the same NF1937 segregating progeny) and regenerated homozygous mtnam-1 plants using the RNeasy Plant Mini
Kit (Qiagen, Valencia, CA). Purified RNA was treated with
(a)
1
2
3
Sequence data
The MtNAM gene sequence was deposited in GenBank under
the accession number JF929904.
The fused cotyledon phenotype is caused by mutation of
MtNAM in Medicago truncatula
Medicago truncatula mutant line NF1937 with fused cotyledons
(Fig. 1a.2) was identified from a forward screen of the Tnt1
insertion population generated at the Samuel Roberts Noble
(b)
(c)
(d)
Fig. 1 Characterization and cloning of Medicago truncatula no apical meristem (mtnam) mutants. (a) Phenotypes of mtnam mutants. 1, a wild-type R108
seedling with a single juvenile leaf (JLe) and a three-leaflet compound leaf; 2, NF1937 (mtnam-1) with fused cotyledons; 3, an NF1757 (mtnam-2) seedling
with a shield-shaped juvenile leaf (JLe) and a fused compound leaf (arrow). Bars, 1 cm. (b) Phylogenetic tree of MtNAM and its orthologs in the
NAM ⁄ CUP-SHAPED COTYLEDON (CUC) gene family. The phylogenetic tree was constructed using the neighbor-joining, maximum parsimony and
Unweighted Pair Group Method with Arithmetic Mean (UPGMA) algorithms implemented in MEGA software suite 4 (http://www.megasoftware.net/) with
1000 bootstrap replicates. Ps, Pisum sativum; Ac, Aquilegia coerulea; St, Solanum tuberosum; Sl, Solanum lycopersicum; At, Arabidopsis thaliana; Ch,
Cardamine hirsute; Gm, Glycine max. (c) Schematic diagram of MtNAM gene structure and the insertion locations of Tnt1 (NF1937, NF2689 and NF4725)
and MERE1 (NF1757) alleles. The orientation and location of primers NAMRtF and NAMRtR are indicated. (d) RT-PCR analysis of MtNAM expression in
R108 and mtnam mutants. Lanes 1–6, the primer pair of MtNAM-RtF and MtNAM-RtR was used for two R108, two mtnam-1 and two mtnam-2 samples;
lanes 7, 8, primers MtNAM-RtF and MERE1-R were used for two mtnam-2 samples.
New Phytologist (2012) 195: 71–84
www.newphytologist.com
2012 The Authors
New Phytologist 2012 New Phytologist Trust
New
Phytologist
Foundation (Tadege et al., 2008). Using the TAIL-PCR
approach (Liu et al., 1995), 15 FSTs of Tnt1 insertions were
recovered from this mutant. After BLAST searches against the
NCBI GenBank, five candidate FSTs were chosen for genotyping
the segregating F2 population from the self-pollinated heterozygous plants. One FST, which had no significant hits in the
M. truncatula genome sequences in GenBank, was found cosegregating with the fused cotyledon phenotype. Using two sets
of primers at the 3¢ and 5¢ ends of this FST sequence, a
full-length genomic sequence was recovered by TAIL-PCR. The
same two sets of primers were also used in combination with
Tnt1-specific primers to screen the pooled DNA samples of the
Tnt1 insertion population (Cheng et al., 2011) and two additional insertion alleles were identified. The two alleles, NF2689
and NF4725, exhibit similar fused cotyledon phenotypes as
observed in NF1937. Sequence analysis revealed that the causative gene for the fused cotyledon phenotype in NF1937, NF2689
and NF4725 encodes an NAC-domain transcription factor, designated as MtNAM. MtNAM shares > 75% identity in amino
acid sequences with other NAM ⁄ CUC family members. Phylogenetic analysis indicated that MtNAM belongs to the NAM
clade and is closest to PsNAM1 and PsNAM2 in pea (Fig. 1b).
NF1937, which was designated as mtnam-1, harbors a Tnt1
insertion at 1325 bp from ATG. NF4725, named mtnam-3, has
a Tnt1 insertion at 363 bp, and NF2689, named mtnam-4, has a
Tnt1 insertion at 1295 bp from ATG (Fig. 1c).
In addition, another mutant line, NF1757, with partially fused
cotyledons and fused leaflets, was obtained from a forward screen
of the Tnt1 insertion population. We failed to recover any causative Tnt1 insertions in NF1757 by TAIL-PCR using Tnt1specific primers. Direct PCR using MtNAM-specific primers
revealed an insertion of MERE1, a native retrotransponson of
M. truncatula (Rakocevic et al., 2009), at 1811 bp from ATG of
MtNAM, 67 bp upstream of the stop codon TAA (Fig. 1c).
Although the full-length transcript of MtNAM was not amplified
using MtNAM-specific forward and reverse primers (Fig. 1d;
lanes 5 and 6), a transcript that is slightly bigger in size was
amplified using the MtNAM forward primer and the MERE1
reverse primer in the mutant NF1757 (Fig. 1d; lanes 7 and 8).
Sequence analysis of this RT-PCR product suggested that the
deduced chimera protein has 375 amino acids, of which 362 aa
are from MtNAM and 13 aa from MERE1 (Supporting Information Notes S1). Therefore, the mutant NF1757, designated as
mtnam-2, is a weak allele of MtNAM.
MtNAM is required for cotyledon and leaflet separation
and primary apical meristem formation
Mutant mtnam-1 seedlings display fused cotyledons and aborted
primary apical meristem (Fig. 1a.2), while mtnam-2 seedlings
exhibit a fused leaflet phenotype (Fig. 1a.3). We examined the
development of these mutants from early embryogenesis to
seedling stages in comparison with wild-type plants. Differences
in the embryo morphology between mtnam-1 and wild type
become apparent at the early heart stage. Unlike the heart-shaped
embryos in wild type (Fig. 2a), embryos of mtnam-1 appear
2012 The Authors
New Phytologist 2012 New Phytologist Trust
Research 75
cylindrical (Fig. 2b). However, no significant differences were
observed at this stage between mtnam-2 and wild-type embryos
(data not shown).
At the cotyledon stage, the two cotyledons are separated and the
apical meristem between the two cotyledons is visible in the wild
type (Fig. 2c,f). In the weak allele mtnam-2, the two cotyledons
are partially fused at the basal region and the embryonic meristem
appears to develop normally (Fig. 2d,g). The juvenile leaf, which
is typically elliptical in wild-type plants, is clearly deformed to be
shield-shaped in the mtnam-2 plant (Fig. 1a.3). In contrast to
wild-type and mtnam-2 plants, the two cotyledons in mtnam-1 are
fused along the edges and no apical meristem was observed
(Fig. 2e,h). After germination, wild-type seeds develop into young
seedlings with a single juvenile leaf and three-leaflet compound
leaves (Fig. 2i,k,n). Because in mtnam-2 the lower parts of the two
cotyledons are fused, the mtnam-2 mutant grows into a seedling
by breaking the side of the partially fused cotyledons with the
developing SAM (Fig. 2i; arrow indicates the breaking point).
The juvenile leaf in mtnam-2 is shield-shaped (Fig. 1a) and the
three leaflets of compound leaves are fused into a simple leaf
(Fig. 2n). Development of the mtnam-1 mutant arrests at the
fused cotyledon stage. No primary apical meristem is developed
(Fig. 2j,l). Furthermore, no escaped shoot meristem was observed
with or without decapitating the hypocotyls (data not shown).
We were interested in understanding how loss-of-function of
MtNAM affects development in mature plants. Using fused cotyledons of mtnam-1 as explants, mature mtnam-1 plants were
regenerated through tissue culture. The regenerated mtnam-1
plants show nearly normal vegetative growth and no apparent
defects in the SAM (Fig. 2n) even though no MtNAM expression
was detectable (Fig. 1d). Like plants carrying the weak allele
mtnam-2, the regenerated mtnam-1 null mutant also develops
compound leaves with fused leaflets, and the fusion of leaflets is
more severe than that in mtnam-2. The three major veins in the
fused leaflets are distinctive, indicating the fused leaves are developed from three leaflets (Fig. 2n).
Mutation of MtNAM results in a reduced number of floral
whorls and floral organs
Both weak allele mtnam-2 plants and regenerated null allele
mtnam-1 plants develop into maturation with flowers but no seed
pods. In order to uncover the phenotypes in flowers, we compared the flower morphology among mtnam-1, mtnam-2 and
wild-type plants. Each flower in the wild type is organized in four
whorls: sepals, petals, stamens and the carpel. The five sepals in
the first whorl are fused at the base. The second whorl consists of
one standard petal, two lateral petals or wings, and two fused
short petals. The third whorl contains nine fused filaments and
one free-standing filament. The innermost whorl is the centered
carpel consisting of stigmas, style and ovary covered with glandular trichomes (Fig. 3a,b). In plants carrying the weak allele
mtnam-2, flowers are similar in appearance to the wild-type flowers.
Dissection of the mtnam-2 flowers revealed that the flower is also
arranged in four whorls; the first and second whorls of sepals and
petals are similar to those of the wild type in terms of organ
New Phytologist (2012) 195: 71–84
www.newphytologist.com
New
Phytologist
76 Research
(a)
(f)
(k)
(b)
(g)
(c)
(h)
(l)
(d)
(i)
(m)
(e)
(j)
(n)
Fig. 2 Phenotypes of wild-type Medicago truncatula R108 and no apical meristem (mtnam) mutants at the vegetative stage. (a, b) Heart stage embryos.
(a) Heart-shaped embryo in R108; (b) cylinder-like embryo in mtnam-1. (c–h) Cotyledon stage embryos. (c) Separated cotyledons (arrow) in R108;
(d) partial fusion at the base of cotyledons (arrow) in mtnam-2; (e) fused cotyledons (arrow) in mtnam-1; (f) embryonic meristem (arrow) and the juvenile
leaf (JLe) in R108; (g) embryonic meristem (arrow) and the shield-shaped juvenile leaf (JLe) in mtnam-2; (h) embryonic meristem and the juvenile leaf are
absent (arrow) between the manually separated cotyledons of mtnam-1. (i–l) Young seedlings. (i) Young seedlings of R108 and mtnam-2; in mtnam-2, the
shoot apex breaks out from the fused cotyledon region (arrow); (j) an mtnam-1 seedling with fused cotyledons; (k) longitudinal sectioning of shoot apex in
R108; (l) longitudinal sectioning of fused cotyledons in mtnam-1 showing no shoot apical meristem is developed. (m) A regenerated mtnam-1 plant with
fused leaflets. (n) Left, compound leaf with fused leaflets in mtnam-1; middle, compound leaf with partially fused leaflets in mtnam-2; right, compound leaf
with three separated leaflets in R108. Bars: (a, b, k–l) 50 lm; (f, g) 0.5 mm; (c–e) 1 mm; (i, j, m, n) 0.5 cm.
numbers and shapes (Fig. 3c). The stamens in the third whorl
and the carpel at the center show some differences from those of
wild-type flowers. Some stamens are similar to those of the wild
type, with nine fused filaments and one separated filament
(Fig. 3c). Some stamens, however, have a reduced number of
filaments (usually reduced to five to seven); and the free-standing
filament is fused with the petals or carpel (Fig. 3d). Most anthers
of mtnam-2 do not release pollen, although a few pollen grains
are occasionally released to the outside of the anthers. The
released pollen grains are able to germinate in vitro (data not
shown). Unlike wild-type carpels which are covered only by glandular trichomes (Fig. 3l), the carpel in mtnam-2 is covered with
long hairy trichomes (Fig. 3d,e,m), although glandular trichomes
are still visible (Fig. 3e). Along the margin, carpel edges are not
fully fused in the upper part of the ovary and some ovules are
exposed (Fig. 3e). Occasionally germinating pollen grains are
observed on stigmas (Fig. 3p). However, seeds are never developed
in mtnam-2 plants. In the regenerated mtnam-1 plants, the flower
size is reduced. Dissection of flowers revealed severe defects in
New Phytologist (2012) 195: 71–84
www.newphytologist.com
whorl number, organ number and organ appearance compared
with mtnam-2 and wild-type flowers (Fig. 3f–j). In mtnam-1
flowers, the first whorl (sepals) shows normal development,
although sometimes the number of sepals is reduced to three to
four (Fig. 3g). The second whorl (petals) and the third whorl (stamens) are usually simplified into one whorl, forming either
sepal-like or petal-like structures, and the organ number is greatly
reduced to one or two (Fig. 3g–j). Sometimes, anther-like tissues
are formed on a petal-like structure, but no pollen is observed
(Fig. 3o). At the center of the flower, the carpel is always observed.
However, the carpel is small and its edges are not fused, resulting
in exposed ovules (Fig. 3k). Some carpels have more severe defects,
with no style and stigmas developed (Fig. 3g). Similar to mtnam-2,
the carpel of mtnam-1 is also covered with dense long trichomes on
the surface (Fig. 3h–j,n).
Inside the wild-type carpel, eight to ten ovules are arranged
along the fused margin, and each mature ovule consists of funiculus, chalaza and nucellus containing a large embryo sac (Fig. 3q).
In mtnam-2, eight to 10 ovules are also developed along the
2012 The Authors
New Phytologist 2012 New Phytologist Trust
New
Phytologist
Research 77
(a)
(f)
(b)
(c)
(g)
(d)
(h)
(l)
(m)
(q)
(r)
(e)
(i)
(n)
(j)
(o)
(s)
(k)
(p)
(t)
(u)
Fig. 3 Phenotypes of Medicago truncatula R108 and no apical meristem (mtnam) mutants at the reproductive stage. (a, b) R108 flowers. (a) Mature
flower; (b) dissected flower showing five base-fused sepals (sp), five yellow petals, nine fused filaments and one carpel (cp). (c–e) Dissected flowers of the
mtnam-2 mutant. (c) A wild-type-like flower with the carpel covered by hairy trichomes. (d) Five fused filaments and one filament (fm) fused with the
carpel, which is covered with hairy trichomes. (e) scanning electron microscopy (SEM) images showing the partially closed carpel with exposed ovules in
the mtnam-2 mutant (arrow) (left) in comparison with the fully closed wild-type carpel (right). (f–k) mtnam-1 flowers with reduced organ whorls and organ
numbers. (f, g) A defective flower with four sepals, petal and stamen whorls simplified to one sepal-like (spl) structure, and a carpel covered with hairy
trichomes. (h) A flower with one petal-like (ptl) structure fused with antheroids and a carpel with hairy trichomes. (i–k) A flower with two small tube-like
petals (ptl), and one small filament-like (fl) fused with a hairy carpel (j); and the magnified side view of the carpel showing the unclosed carpel with ovules
(ov) exposed (k). (l–p) Trichomes on the carpel surface. (l) Glandular trichomes in R108; (m, n) long nonglandular trichomes in mtnam-2 and mtnam-1; (o)
the fused petal-like structure with an anther (an) in mtnam-1 flowers; (p) germinated pollens on stigmas of mtnam-2 flowers. (q–u) Cleared ovules. (q) A
mature ovule with developed embryo sac (es) in the nucellus (nu) in R108; (r) a normal ovule with developed embryo sac in mtnam-2; (s) an ovule without
a developed embryo sac in mtnam-2; (t) two retarded ovules without an embryo sac in mtnam-1; (u) a carpel-like structure (cpl) instead of an ovule in
mtnam-1. fl, funiculus; cl, chalaza. Bars: (a–d, f–j) 1 mm; (k) 0.5 mm; (e, l, m) 100 lm; (n–u) 50 lm.
incompletely fused carpel margin. Both normal ovules with an
embryo sac and abnormal ovules without an embryo sac are
observed in the same ovary (Fig. 3r,s). Inside the carpel of
mtnam-1, only three to six small ovules are observed along the
unclosed carpel margin. The development of ovules is severely
defective and no embryo sac is observed in the nucellus (Fig. 3t).
In extreme cases, some ovules develop into carpel-like structures
(Fig. 3u). Both male and female organs are sterile in mtnam-1
flowers.
We further examined the early development of floral organs in
mtnam mutants and the wild type by scanning electron microscopy (SEM). Compared with the common radial arrangement of
sepals, petals, stamens, and carpels in most angiosperm plant
2012 The Authors
New Phytologist 2012 New Phytologist Trust
species, the initiation of floral organs in all whorls is unidirectional from the abaxial to the adaxial position in some legume
species, including M. truncatula and pea. The most unique
feature of flower development in these legume species is the formation of four common primordia, which are further differentiated into petals and stamens (Tucker, 1989, 2003; Ferrandiz
et al., 1999; Benloch et al., 2003). Fig. 4 (a–c,f) shows the developmental stages of floral organs in wild-type flowers. Three
distinctive whorls of floral organ primordia are initiated, including
the sepal primordia in the outer whorl, common primordia in
the middle whorl and the carpel primordium in the inner whorl
(Fig. 4b). Later, petal and stamen primordia are differentiated
from the common primordia in the middle whorl (Fig. 4c), and
New Phytologist (2012) 195: 71–84
www.newphytologist.com
New
Phytologist
78 Research
(a)
(b)
(c)
(d)
(e)
(f)
(g)
(h)
(i)
Fig. 4 Scanning electron microscopy (SEM) analysis of floral organ primordium development in Medicago truncatula. (a–c, f) Wild-type R108.
(a) Overview of a shoot apex at the reproductive stage; (b) a floral structure at the early stage with sepal primordia, common primordia and carpel primordium
whorls; (c) a floral structure with all organ primordia initiated; (f) a floral structure with differentiating organs. (d, e) no apical meristem2 (mtnam-2).
(d) Overview of a shoot apex at the reproductive stage; (e) a floral structure with disorganized organ primordia. (g–i) mtnam-1. (g) Three abnormal florets
at different development stages; (h) a floret with normal-looking developing sepal and carpel primordia, and one common primordium; (i) a floret with a
differentiating sepal whorl and carpel, and one small common primordium between the two whorls. sp, sepal primordium; cmp, common primordium; stp,
stamen primordium; pp, petal primordium; cp, carpel primordium.
then individual floral organs are clearly differentiated (Fig. 4f).
In mtnam-2, the sepal primordia are normally developed in the
first whorl; common primordia and the carpel primordium are
observed inside the first whorl. However, the arrangement of
common primordia and the carpel primordium is disorganized
(Fig. 4d,e). In mtnam-1, three whorls of organ primordia are initiated and separated (Fig. 4g–i). Although the sepal primordia
appear normal, only one common primordium develops and no
clear petal and stamen primordia are observed at later stages
(Fig. 4h). At the center, the carpel primordium is differentiated
(Fig. 4g–i). These observations indicate that the defects of
mtnam flowers occur at both floral organ primordium initiation
and later development stages.
All classes of floral homeotic genes are down-regulated in
mtnam mutants
To gain insights into potential genes downstream of NAM ⁄ CUC,
we compared the gene expression profiles in shoot apices at the
reproductive stage between the regenerated mtnam-1 mutant
plants and bulked wild-type-like plants (including heterozygous
mtnam-1 and wild-type plants) by Affymetrix microarray. Of the
300 down-regulated genes (Table S1), nine MADS-box family
genes and one APETALA2 (AP2)-like gene were identified, which
represent homeotic genes related to floral organ development.
Sequence analysis indicated that the 10 down-regulated floral
New Phytologist (2012) 195: 71–84
www.newphytologist.com
homeotic genes in mtnam-1 fall into the A, B, C and E classes,
including two genes in the A class, three in the B class, two in the
C class and three in the E class (Table 2). The transcript levels of
two B class genes, PI and AP3-like, are reduced > 20-fold. We
further validated the microarray results for the 10 homeotic genes
in individual mtnam-1 and mtnam-2 plants by real-time quantitative PCR. Results revealed that all 10 genes in the knockout
mutant mtnam-1 and seven genes in the weak allele mutant
mtnam-2 are down-regulated (Fig. 5). The down-regulation of
the floral homeotic genes is in agreement with the severe flower
organ defects observed in mtnam mutants.
MtNAM is expressed at boundaries between organs ⁄ organ
primordia and meristem
To understand the function of MtNAM, we carried out
tissue-specific expression analysis. Semi-quantitative PCR and
real-time quantitative PCR analyses showed that MtNAM is
highly expressed in shoot apices at both vegetative and reproductive stages; a low expression level was detected in mature flowers
and young pods, whereas no expression was detected in roots,
stems and mature leaves (Fig. 6a).
The elaborate expression pattern of MtNAM was further
explored at various developmental stages by RNA in situ hybridization using the nonconserved region of MtNAM as the probe.
During embryogenesis, MtNAM is detectable at the early
2012 The Authors
New Phytologist 2012 New Phytologist Trust
New
Phytologist
Research 79
Table 2 Down-regulation of Medicago truncatula floral homeotic genes
in microarray analysis
Probe set
Annotation
Mtr.45079.1.S1_at
Mtr.11698.1.S1_at
Mtr.18866.1.S1_at
Mtr.35242.1.S1_at
Mtr.46049.1.S1_at
Mtr.9824.1.S1_at
Mtr.23758.1.S1_at
Mtr.21819.1.S1_at
PISTILLATA (MtPI), B-class
APETALA3-like 2, B-class
SEPALLATA3-like protein, E-class
AGAMOUS-like protein 1, C-class
AGAMOUS-like protein 2, C-class
SEPALLATA1-like protein, E-class
SEPALLATA 3-like protein, E-class
AP2-L, AP2 domain transcription,
B-class
APETALA1 ⁄ MtPIM, A-class
APETALA1 ⁄ FUL-like protein, A-class
APETALA3-like 2, B-class
Mtr.19024.1.S1_at
Mtr.4872.1.S1_s_at
Mtr.24436.1.S1_at
Relative
transcript
level
0.017
0.05
0.074
0.087
0.135
0.188
0.264
0.303
0.333
0.391
0.474
Ten homeotic floral identity genes, which belong to classes A, B, C and E,
are significantly down-regulated in the mtnam-1 mutant. The relative
transcript level was compared with that of the control (wild-type-looking
plants).
Fig. 5 Real-time quantitative PCR analysis to show the relative expression
levels of 10 floral homeotic genes in no apical meristem1 (mtnam-1)
(black bars) and mtnam-2 (gray bars) mutants relative to the expression of
the same genes in respective heterozygous Medicago truncatula plants.
Shown are nine MADS-box genes: PISTILLATA (PI), APETALA3-1 (AP3-1),
SEPALLATA3-1 (SEP3-1), AGAMOUS-1 (AGA-1), AGAMOUS-2 (AGA-2),
SEPALLATA1-1 (SEP1-1), SEPALLATA3-2 (SEP3-2), PROLIFERATING
INFLORESCENCE MERISTEM (PIM) and APETALA1 (AP1), and one
APETALA-2 (AP-2) gene. MtACTIN2 (ACT) was used as the reference
gene. Error bars represent SD.
globular embryo stage and the signal is detected at sites of the
cotyledon primordial initiation (Fig. 6b.1). At the heart stage,
MtNAM expression is detected between the embryonic meristem
and the cotyledon primordia (Fig. 6b.2). The MtNAM signal is
maintained at boundaries of cotyledons and the primary meristem at the cotyledon stage (Fig. 6b.3). During the vegetative
developmental stage, MtNAM expression is found at boundaries
between lateral organ primordia and the shoot apical meristem
(Fig. 6b.4). The signal is also detectable at sites where leaflet primordia arise and at boundaries between leaflets (Fig. 6b.5, b.6).
2012 The Authors
New Phytologist 2012 New Phytologist Trust
At the floral developmental stage, MtNAM is first detected in the
floral meristem before floral organ primordia arise. Later, the signal is detected at boundaries between floral organ primordia
(Fig. 6b.7, b.8). At the gynoecium stage, the MtNAM signal is
detected at the margin of the carpel, where the ovule primordia
are initiated. At later stages, signals are detected at boundaries
between ovules and the placenta (Fig. 6b.9, b.10). Weak signals
are also detectable between integuments in ovules (data not
shown). Overall, MtNAM expression was observed at all boundaries, including those between organs of the same type, between
different floral organ whorls and between developing organs and
adjacent meristems. In addition, the MtNAM signal was detectable before the initiation of primordia.
MtNAM modulates compound leaf development
As described in the previous section, MtNAM is expressed at
boundaries between leaflets, and mutations in MtNAM lead to the
fusion of three leaflets, indicating that MtNAM is required for
leaflet separation. It has been reported that SINGLE LEAFLET1
(SGL1), the FLOCAULA ⁄ LEAFY ortholog in M. truncatula, plays
a key role in the initiation of leaflet primordia during compound
leaf development; the loss-of-function sgl1 mutant exhibits a complete conversion of compound leaves into simple leaves (Wang
et al., 2008). The difference between the simple leaves of sgl1 and
the fused leaves of mtnam is that the three major veins from the
three leaflets are distinguishable in the fused leaves of mtnam
(Fig. 2n). To better understand compound leaf development,
cross-pollination between sgl1 and mtnam-2 mutants was carried
out. As both sgl1 and mtnam mutants are sterile, heterozygous sgl1
and mtnam-2 plants were used for cross-pollination. The resultant
sgl1/mtnam-2 double mutant was confirmed by PCR-based genotyping and gene expression analysis (Fig. 7a,b). The double
mutant contains a Tnt1 insertion in SGL1 and an MERE1 insertion in MtNAM (Fig. 7a), and has no detectable expression of
SGL1 and MtNAM (Fig. 7b). Compared with the phenotype of
the single leaves in sgl1 (Fig. 7c.2) and the phenotypes of the
partially fused cotyledons and fused compound leaves in mtnam-2
(Fig. 7c.3), the sgl1 ⁄ mtnam-2 double mutant shows additive
phenotypes: partially fused cotyledons at the embryonic stage and
shoot growing through the fused cotyledons during seed germination, and single leaves at the post-embryonic stage (Fig. 7c.4).
Furthermore, the regulation of MtNAM and SGL1 expression was
analyzed in mtnam and sgl1 mutants by real-time quantitative
PCR. Results revealed that the expression of MtNAM is reduced in
the sgl1 mutant, whereas the expression of SGL1 in both mtnam-1
and mtnam-2 mutants is similar to that of the wild type (Fig. 7d).
Discussion
MtNAM plays a key role in separating adjacent lateral
organs and in the establishment of the primary shoot
meristem
In this paper, we report a detailed characterization of
M. truncatula mutants, mtnam-1 and mtnam-2, which exhibit
New Phytologist (2012) 195: 71–84
www.newphytologist.com
New
Phytologist
80 Research
(a)
(b)
1
5
8
2
3
6
4
7
9
10
Fig. 6 Expression patterns of Medicago truncatula NO APICAL MERISTEM (MtNAM). (a) MtNAM expression in different tissues of Medicago truncatula
by semi-quantitative PCR analysis (top panel). A real-time quantitative PCR analysis of MtNAM expression in corresponding tissues is shown in the bottom
panel. Rt, root; Le, leaves; St, stem; Fl, flower; Vsh, vegetative shoots; Rsh, reproductive shoots; Pod, young pods; Se, young seeds. Error bars represent
SD. (b) MtNAM expression at different developmental stages by RNA in situ hybridization. 1, globular embryo stage. MtNAM expression was detected at
the sites where cotyledon primordia arise (arrow). 2, early heart stage. MtNAM expression (arrow) was detected between the cotyledon primordium and
the embryonic meristem. 3, cotyledon stage. MtNAM expression (arrow) was detected at the boundary between cotyledons (co) and the primary meristem
(pm). 4, shoot apex. MtNAM expression (arrows) was detected between the apical meristem (am) and lateral organ primordia (lp) and between lateral
organ primordia and the floral meristem (fm). The MtNAM expression preceded the floral meristem outgrowth. 5–6, developing compound leaves (cl).
MtNAM was detected at the boundaries of leaflets (arrows). 7–8, developing flowers. MtNAM was detected between floral organ primordia. cp, carpel
primordium; cmp, common primordium; fm, floral meristem. 9–10, developing ovaries. The expression of MtNAM (arrow) was detected at the edges of
carpels (cp) before ovule primordia arose (9), or between ovules (ov) and placenta (pl) (10). Bars, 50 lm.
defects in leaf and flower development. At vegetative stages,
mtnam mutants display fused cotyledons, a defective primary apical meristem, and fused leaflets of compound leaves. The first
two phenotypes are shared among all known cuc ⁄ nam mutants in
other plant species, including cuc1 ⁄ cuc2, cuc1 ⁄ cuc3, cup and nam
(Souer et al., 1996; Aida et al., 1997; Takada et al., 2001;
Vroemen et al., 2003; Weir et al., 2004), whereas the fused
leaflet phenotype is only observed in nam ⁄ cuc mutants or
NAM ⁄ CUC down-regulated plants of compound-leafed species
(Blein et al., 2008; Berger et al., 2009), indicating that
CUC ⁄ NAM genes have conserved functions in cotyledon separation, primary apical meristem establishment, and compound leaf
development. Although the expression of MtNAM is detected in
all lateral organ boundaries at post-embryonic stages, except for
the fusion of leaflets in compound leaves, mtnam mutants do not
exhibit other lateral organ fusion. This suggests that one or more
other NAC-domain genes may have a redundant function in
lateral organ separation, although no other NAM-like gene, except
for MtNAM, has been identified in the M. truncatula genome.
Unlike cup, nam and gob mutants, in which escaped shoot
meristems occasionally form and develop into mature plants, no
escaped meristems were observed in the null mutant mtnam-1.
Mature plants of mtnam-1 could only be obtained by tissue
culture and subsequent plant regeneration, indicating that
New Phytologist (2012) 195: 71–84
www.newphytologist.com
MtNAM is essential for the embryonic induction of the primary
apical meristem, but is not necessary for the post-embryonic
development of the apical meristem. Members of the
NAM ⁄ CUC subfamily contain a conserved NAC domain at the
N-terminus and three conserved motifs, V, L and W, in
the C-terminal region. The NAC domain of CUC1 and CUC2
in A. thaliana is capable of binding to DNA and is important for
promoting adventitious shoot formation, whereas the W motif
plays an important role in transactivation (Taoka et al., 2004).
The MERE1 insertion in mtnam-2 results in a chimeric transcript. The deduced protein from the chimeric transcript contains
the NAC domain, the V and L motifs, and the
miRNA164-binding site of MtNAM, but loses the conserved W
motif at the C-terminus. The mutant plant shows no apparent
defects in SAM development, indicating that the function of the
deduced protein is sufficient for the induction of the primary
meristem. The result is in agreement with the previous report
that the specificity of CUC1 in promoting the formation of
adventitious shoots resides in the conserved NAC domain (Taoka
et al., 2004). However, the NAC domain alone is not sufficient
for SAM development, for a transcript is also detected in the null
mtnam-1 mutant, which encodes a deduced 198 amino acid truncated protein with an NAC domain (Notes S1). The partially
fused cotyledons and fully fused leaflets in mtnam-2 further
2012 The Authors
New Phytologist 2012 New Phytologist Trust
New
Phytologist
Research 81
(a)
(c)
1
2
3
4
(d)
(b)
Fig. 7 Characterization of the Medicago truncatula single leaflet1 (sgl1) ⁄ no apical meristem2 (mtnam-2) double mutant. (a) Genotyping single or double
mutants of mtnam-2 and sgl1 by PCR with primer pairs of MtNAM-F + MtNAM-R (lanes 1, 5, 6 and 7) or SGL-F + SGL-R (lanes 2, 3, 4 and 8). The PCR
product size of MtNAM-F + MtNAM-R is c. 7.5 kb, containing a 5.3-kb MERE1 insertion in mtnam-2 and sgl1 ⁄ mtnam-2; the PCR product of
SGL-F + SGL-R is c. 7.2 kb, containing a 5.3-kb Tnt1 insertion in sgl1 and sgl1 ⁄ mtnam-2. (b) RT-PCR analysis of mutants. The expression of MtNAM was
not detected in mtnam-2 and mtnam-2 ⁄ sgl1 double mutants, and SGL1 was not detected in sgl1 and mtnam-2 ⁄ sgl1 double mutants. (c) Phenotype. 1, an
R108 plant showing compound leaves with three leaflets; 2, an sgl1 single mutant showing simple leaves; 3, an mtnam-2 single mutant showing fused compound leaves and the shoot growing through the partially fused cotyledons (arrow); 4, a sgl1 ⁄ mtnam-2 double mutant showing simple leaves and the shoot
growing through the partially fused cotyledons (arrow). Bars, 1 cm. (d) Real-time quantitative PCR analysis to show the relative expression of MtNAM
(gray) and SGL1 (black) in R108, mtnam-1, mtnam-2 and sgl1 mutants. MtACTIN2 (ACT) was used as the reference gene. Error bars represent SD.
suggest that a fully functional MtNAM is required to repress cell
proliferation locally in boundaries to separate lateral organs, and
the W motif is crucial for the full function of MtNAM.
MtNAM is required for both floral organ separation and
primordium development
During flower development, the fusion of sepals, petals or
stamens and the occurrence of extra petals or petal whorls are
commonly reported in cuc ⁄ nam mutants and in mutants with
defective expression of CUC1 or miRNA164 (Souer et al., 1996;
Ishida et al., 2000; Mallory et al., 2004; Weir et al., 2004; Baker
et al., 2005), while a reduced petal number has been reported in
A. thaliana plants overexpressing miRNA164 (Laufs et al., 2004).
Similarly, fusion of the filaments with petals or carpels and a
reduced filament number are observed in the weak allele mutant
mtnam-2, indicating the conserved function of MtNAM for adjacent floral organ separation. However, unlike the formation of an
extra petal whorl in cuc ⁄ nam mutants, the null mutant mtnam-1
displays a reduction of floral organs: one simple chimera whorl
with greatly reduced organ numbers at the sites of petal and
stamen whorls. This phenomenon implies a special floral organ
development process in M. truncatula. In contrast to the centripetal and sequential flower ontogeny in other model species
(Bossinger & Smyth, 1996), the floral organ primordia in
2012 The Authors
New Phytologist 2012 New Phytologist Trust
M. truncatula initiate in the abaxial to adaxial unidirection
without synchronization of organs in each whorl. Four common
primordia occur sequentially in the second whorl and later differentiate into petals and stamens in the second and third whorls,
while the carpel primordium is initiated early at the center
(Benloch et al., 2003). The phenotypes of reduced common primordium and floral organ numbers indicate that the mutation of
MtNAM represses outgrowth from common primordia. Taken
together with the MtNAM expression pattern in floral organ
primordia, our results suggest that MtNAM is required to
promote the initiation and further development of the secondary
primordia.
Plant aerial organs such as cotyledons, leaves, and floral organs
have long been regarded as homologous structures (Esau, 1977;
Pelaz et al., 2001). The difference between leaves and floral organs
could be attributed to the differential expression of floral homeotic
genes in flowers but not in leaves (Honma & Goto, 2001). Given
the concept that a floral organ is a modified leaf, the unique
developmental processes from common primordia to petals and
stamens resemble those from the leaf marginal blastozone to
secondary leaflet formation during compound leaf development.
Down-regulation or mutation of CUC ⁄ NAM leads to the suppression of marginal outgrowth and fewer or fused leaflets in diverse
compound-leafed species (Blein et al., 2008; Berger et al., 2009).
The simplification of floral organ whorls and numbers in
New Phytologist (2012) 195: 71–84
www.newphytologist.com
New
Phytologist
82 Research
mtnam-1 is similar to the reduction of compound leaf complexity
in gob mutants in tomato and the CUC ⁄ NAM down-regulated
plants in other species (Blein et al., 2008; Berger et al., 2009). It is
suggested that MtNAM shares an essential role in promoting secondary outgrowth with other CUC ⁄ NAM members.
MtNAM promotes meristem and primordium identity
Lateral organ primordia are initiated at the periphery of the apical meristem and are defined at early developmental stages. Each
primordium acquires an identity by expressing an organ identity
gene(s), which enables it to develop into the appropriate type of
lateral organs. Members of the MADS-box gene family are the
primary determinants of floral organ identity. The ABC model
of floral organ determination has been proposed to explain how
the unique combination of ABC types of genes determines the
floral organ identity in each whorl of floral organs (Coen &
Meyerowitz, 1991). An expanded ABC model suggests that class
E activity is also required for the specification of each organ
type (Gutierrez-Cortines & Davies, 2000). In mtnam mutants,
the development of the second whorl is indeterminate and a
chimera of petals and stamens or a sepal-like structure is
observed, indicating the indeterminacy of floral organs in the
whorl. In the center of the flower, the carpel is covered by long
dense trichomes, which is a character of the sepal surface, and
ovules inside the carpel are severely retarded or transformed into
sepal-like structures in extreme cases. These observations indicate that floral organ identity in the inner whorls, except for the
first sepal whorl, is impaired in mtnam mutants. The downregulation of A, B, C and E classes of floral organ identity genes
in the mtnam mutants is consistent with the displayed floral
organ phenotypes, suggesting that MtNAM is not only required
for organ separation, but is also necessary for the expression of
organ identity genes to promote the development of floral organ
primordia.
In A. thaliana, CUC2 ⁄ CUC1 is expressed in the early globular
embryos and activates the expression of the meristem identity
gene STM in the meristem. Mutations in CUC1 ⁄ 2 result in abolished expression of STM and thus abortion of the primary apical
meristem. Mis-expression of CUC1 leads to the ectopic formation of adventitious buds and to a change of leaf architecture
from simple to compound and induces the expression of
SAM-related and compound leaf genes (Aida et al., 1999; Hibara
et al., 2003; Hasson et al., 2011). These studies suggest that
CUC1 ⁄ 2 activates the expression of SAM identity and compound
leaf determination genes and promotes shoot meristem formation. Similarly, MtNAM is also expressed in the early globular
embryo in M. truncatula. The defect in the primary apical meristem in the mtnam-1 mutant is probably caused by the impaired
expression of a shoot meristem identity gene(s).
Different roles of MtNAM and SGL1 in compound leaf
development in M. truncatula
SGL1 plays a key role in compound leaf development. The
loss-of-function mutant sgl1 exhibits complete conversion of
New Phytologist (2012) 195: 71–84
www.newphytologist.com
compound leaves into simple leaves by repressing the initiation
of leaflet primordia (Wang et al., 2008). MtNAM functions in
separating initiated leaflets to form the compound leaf, and the
loss of function leads to fused leaflets. The double mutant of
SGL1 and MtNAM-2 shows single leaves resembling the sgl1
single mutant, indicating that the function of SGL1 in leaflet primordium initiation is epistatic to MtNAM on leaflet separation
during compound leaf development, although the expression of
SGL1 is reduced in mtnam mutants.
In addition to the common role in leaflet separation,
NAM ⁄ CUC is also required for leaf margin outgrowth in leaf
development, which is demonstrated in NAM ⁄ CUC-silenced or
mutated plants with a greatly reduced number of secondary leaflets and a smooth leaf margin (Blein et al., 2008; Bilsborough
et al., 2011). Mutants of MtNAM, however, show three fused
leaflets and a wild-type-like serrated leaf margin, indicating that
MtNAM does not play a prominent role in leaf margin development, or an unidentified MtNAM-like gene has the redundant
function in leaf development in M. truncatula.
Acknowledgements
This work is supported by the National Science Foundation
(NSF-0703285) and the Samuel Roberts Noble Foundation.
The authors would like to thank Drs Elison Blancaflor and Ping
Xu at the Noble Foundation for their critical reading of the
manuscript. We also thank Kuihua Zhang for plant care and seed
curation, Shulan Zhang for assistance with flanking sequence
recovery, and Hee-Kyung Lee and Janie Gallaway for generating
the Tnt1 lines and organizing forward screening.
References
Aida M, Ishida T, Tasaka M. 1999. Shoot apical meristem and cotyledon
formation during Arabidopsis embryogenesis: interaction among the
CUP-SHAPED COTYLEDON and SHOOT MERISTEMLESS genes.
Development 126: 1563–1570.
Aida M, Tasaka M. 2006a. Genetic control of shoot organ boundaries. Current
Opinion in Plant Biology 9: 72–77.
Aida M, Tasaka M. 2006b. Morphogenesis and patterning at the organ
boundaries in the higher plant shoot apex. Plant Molecular Biology 60:
915–928.
Aida M, Tetsuya I, Fukaki H, Fujisawa H, Tasaka M. 1997. Genes involved in
organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant.
Plant Cell 9: 841–857.
Aida M, Vernoux T, Furutani M, Traas J, Tasaka M. 2002. Roles of
PIN-FORMED1 and MONOPTEROS in pattern formation of the apical
region of the Arabidopsis embryo. Development 129: 3965–3974.
Baker CC, Sieber P, Wellmer F, Meyerowitz EM. 2005. The early extra petals1
mutant uncovers a role for MicroRNA miR164c in regulating petal number in
Arabidopsis. Current Biology 15: 303–315.
Benedito VA, Torres-Jerez I, Murray JD, Andriankaja A, Allen AS, Kakar K,
Wandrey M, Verdier J, Zuber H, Ott T et al. 2008. A gene expression atlas of
the model legume Medicago truncatula. Plant Journal 55: 504–513.
Benloch R, Navarro C, Beltran JP, Canas LA. 2003. Floral development of
the model legume Medicago truncatula: ontogeny studies as a tool to
better characterize homeotic mutations. Sexual Plant Reproduction 15:
231–241.
Berger Y, Harpaz-Saad S, Brand A, Melnik H, Sirding N, Alvarez JP, Zinder M,
Samach A, Eshed Y, Ori N. 2009. The NAC-domain transcription factor
2012 The Authors
New Phytologist 2012 New Phytologist Trust
New
Phytologist
GOBLET specifies leaflet boundaries in compound tomato leaves. Development
136: 823–832.
Bilsborough GD, Runions A, Barkoulas M, Jenkins HW, Hasson A, Galinha C,
Laufs P, Hay A, Prusinkiewicz P, Tsiantis M. 2011. Model for the regulation
of Arabidopsis thaliana leaf margin development. Proceedings of the National
Academy of Sciences, USA 108: 3424–3429.
Blein T, Hasson A, Laufs P. 2010. Leaf development: what it needs to be
complex. Current Opinion in Plant Biology 13: 75–82.
Blein T, Pulido A, Vialette-Guiraud A, Nikovics K, Morin H, Hay A, Johansen
IE, Tsiantis M, Laufs P. 2008. A conserved molecular framework for
compound leaf development. Science 322: 1835–1839.
Bossinger G, Smyth DR. 1996. Initiation patterns of flower and floral organ
development in Arabidopsis thaliana. Development 122: 1093–1102.
Champagne CEM, Goliber TE, Wojciechowski MF, Mei RW, Townsley BT,
Wang K, Paz MM, Geeta R, Sinha NR. 2007. Compound leaf development
and evolution in the legumes. Plant Cell 19: 3369–3378.
Cheng X, Wen J, Tadege M, Ratet P, Mysore KS. 2011. Reverse genetics in
Medicago truncatula using Tnt1 insertion mutants. Methods in Molecular
Biology 678: 179–190.
Coen ES, Meyerowitz EM. 1991. The war of the whorls: genetic interactions
controlling flower development. Nature 353: 31–37.
Efroni I, Eshed Y, Lifschitz E. 2010. Morphogenesis of simple and compound
leaves: a critical review. Plant Cell 22: 1019–1032.
Esau K. 1977. The flower: structure and development. Anatomy of Seed Plant 20:
375–401.
Ferrandiz C, Navarro C, Gomez MD, Canas LA, Beltran JP. 1999. Flower
development in Pisum sativum: from the war of the whorls to the battle of the
common primordia. Developmental Genetics 25: 280–290.
Furutani M, Vernoux T, Traas J, Kato T, Tasaka M, Aida M. 2004.
PIN-FORMED1 and PINOID regulate boundary formation and cotyledon
development in Arabidopsis embryogenesis. Development 131: 5021–5030.
Gutierrez-Cortines ME, Davies B. 2000. Beyond the ABCs: ternary complex
formation in the control of floral organ identity. Trends in Plant Science 5:
471–476.
Hasson A, Plessis A, Blein T, Adroher B, Grigg S, Tsiantis M, Boudaoud A,
Damerval C, Laufs P. 2011. Evolution and diverse roles of the
CUP-SHAPED COTYLEDON genes in Arabidopsis leaf development. Plant
Cell 23: 54–68.
Hibara K, Karim MR, Takada S, Taoka KI, Furutani M, Aida M, Tasaka M.
2006. Arabidopsis CUP-SHAPED COTYLEDON3 regulates postembryonic
shoot meristem and organ boundary formation. Plant Cell 18: 2946–2957.
Hibara K, Takada S, Tasaka M. 2003. CUC1 gene activates the expression of
SAM-related genes to induce adventitious shoot formation. Plant Journal 36:
687–696.
Hofer J, Turner L, Hellens R, Ambrose M, Matthews P, Michael A, Ellis N.
1997. UNIFOLIATA regulates leaf and flower morphogenesis in pea. Current
Biology 7: 581–587.
Honma T, Goto K. 2001. Complexes of MADS-box proteins are suficient to
convert leaves into floral organs. Nature 409: 525–529.
Ishida T, Aida M, Takada S, Tasaka M. 2000. Involvement of CUP-SHAPED
COTYLEDON genes in gynoecium and ovule development in Arabidopsis
thaliana. Plant and Cell Physiology 41: 60–67.
Kwiatkowska D. 2004. Surface growth at the reproductive shoot apex of
Arabidopsis thaliana pin-formed 1 and wild type. Journal of Experimental
Botany 5: 1021–1032.
Kwiatkowska D. 2006. Flower primordium formation at the Arabidopsis shoot
apex: quantitative analysis of surface geometry and growth. Journal of
Experimental Botany 57: 571–580.
Larue CT, Wen J, Walker JC. 2009. A microRNA–transcription factor module
regulates lateral organ size and patterning in Arabidopsis. Plant Journal 58:
450–463.
Laufs P, Peaucelle A, Morin H, Traas J. 2004. MicroRNA regulation of the
CUC genes is required for boundary size control in Arabidopsis meristems.
Development 131: 4311–4322.
Liu YG, Mitsukawa N, Oosumi T, Whittier RF. 1995. Efficient isolation and
mapping of Arabidopsis thaliana T-DNA insert junctions by thermal
asymmetric interlaced PCR. Plant Journal 8: 457–463.
2012 The Authors
New Phytologist 2012 New Phytologist Trust
Research 83
Long JA, Barton MK. 1998. The development of apical embryonic pattern in
Arabidopsis. Development 125: 3027–3035.
Mallory AC, Dugas DV, Bartel DP, Bartel B. 2004. MicroRNA regulation of
NAC-domain targets is required for proper formation and separation of
adjacent embryonic, vegetative, and floral organs. Current Biology 14:
1035–1046.
Nikovics K, Blein T, Peaucelle A, Ishida T, Morin H, Aida M, Laufs P. 2006.
The balance between the MIR164A and CUC2 genes controls leaf margin
serration in Arabidopsis. Plant Cell 18: 2929–2945.
Pelaz S, Tapia-López R, Alvarez-Buylla ER, Yanofsky MF. 2001. Conversion of
leaves into petals in Arabidopsis. Current Biology 11: 182–184.
Rakocevic A, Mondy S, Tirichine L, Cosson V, Brocard L, Iantcheva A, Cayrel
A, Devier B, El-Heba GAA, Ratet P. 2009. MERE1, a low-copy-number
copia-type retroelement in Medicago truncatula active during tissue culture.
Plant Physiology 151: 1250–1263.
Ramakers C, Ruijter JM, Deprez RH, Moorman AF. 2003. Assumption-free
analysis of quantitative real-time polymerase chain reaction (PCR) data.
Neuroscience Letters 339: 62–66.
Rast MI, Simon R. 2008. The meristem-to-organ boundary: more than an
extremity of anything. Current Opinion in Genetics & Development 18:
287–294.
Reddy GV, Heisler MG, Ehrhardt DW, Meyerowitz EM. 2004. Real-time
lineage analysis reveals oriented cell divisions associated with
morphogenesis at the shoot apex of Arabidopsis thaliana. Development 131:
4225–4237.
Souer E, van Houwelingen A, Bliek M, Kloos D, Mol J, Koes R. 1998.
Co-suppression of nam and homologous genes leads to a reduction axillary
meristem formation and increased leaf and stem size in Petunia: a possible
role for NAC domain genes in plant development. Flowering Newsletter 26:
36–46.
Souer E, van Houwelingen A, Kloos D, Mol J, Koes R. 1996. The no apical
meristem gene of Petunia is required for pattern formation in embryos and
flowers and is expressed at meristem and primordia boundaries. Cell 85:
159–170.
Spinelli SV, Paula Martin A, Viola IL, Gonzalez DH, Palatnik JF. 2011. A
mechanistic link between STM and CUC1 during Arabidopsis development.
Plant Physiology 156: 1894–1904.
Tadege M, Wen JQ, He J, Tu H, Kwak Y, Eschstruth A, Cayrel A, Endre G,
Zhao PX, Chabaud M et al. 2008. Large-scale insertional mutagenesis using
the Tnt1 retrotransposon in the model legume Medicago truncatula. Plant
Journal 54: 335–347.
Takada S, Hibara K, Ishida T, Tasaka M. 2001. The CUP-SHAPED
COTYLEDON1 gene of Arabidopsis regulates shoot apical meristem formation.
Development 128: 1127–1135.
Takeda S, Hanano K, Kariya A, Shimizu S, Zhao L, Matsui M, Tasaka M, Aida
M. 2011. CUP-SHAPED COTYLEDON1 transcription factor activates the
expression of LSH4 and LSH3, two members of the ALOG gene family, in
shoot organ boundary cells. Plant Journal 66: 1066–1077.
Taoka K, Yanagimoto Y, Daimon Y, Hibara K, Aida M, Tasaka M. 2004. The
NAC domain mediates functional specificity of CUP-SHAPED
COTYLEDON proteins. Plant Journal 40: 462–473.
Trinh TH, Ratet P, Kondorosi E, Durand P, Kamaté K, Bauer P, Kondorosi A.
1998. Rapid and efficient transformation of diploid Medicago truncatula and
Medicago sativa ssp. falcata lines improved in somatic embryogenesis. Plant Cell
Reports 17: 345–355.
Tucker SC. 1989. Overlapping organ initation and common primordia in flowers
of Pisum sativum (Legumnosae, Papilionoideae). American Journal of Botany
76: 714–729.
Tucker SC. 2003. Floral development in legumes. Plant Physiology 131:
911–926.
Vroemen CW, Mordhorst AP, Albrecht C, Kwaaitaal MACJ, de Vries SC.
2003. The CUP-SHAPED COTYLEDON3 gene is required for boundary and
shoot meristem formation in Arabidopsis. Plant Cell 15: 1563–1577.
Wang H, Chen J, Wen J, Tadege M, Li G, Liu Y, Mysore KS, Ratet P, Chen R.
2008. Control of compound leaf development by FLORICAULA ⁄ LEAFY
ortholog SINGLE LEAFLET1 in Medicago truncatula. Plant Physiology 146:
1759–1772.
New Phytologist (2012) 195: 71–84
www.newphytologist.com
New
Phytologist
84 Research
Weir I, Lu JP, Cook H, Causier B, Schwarz-Sommer Z, Davies B. 2004.
CUPULIFORMIS establishes lateral organ boundaries in Antirrhinum.
Development 131: 915–922.
Zhou R, Jacksona L, Shadle G, Nakashimaa J, Templeb S, Chen F, Dixon RA.
2010. Distinct cinnamoyl CoA reductases involved in parallel routes to lignin
in Medicago truncatula. Proceedings of the National Academy of Sciences, USA
107: 17803–17808.
Table S1 List of down- and up-regulated genes ⁄ probe sets in the
Medicago truncatula no apical meristem (mtnam) mutant
Supporting Information
Please note: Wiley-Blackwell are not responsible for the content
or functionality of any supporting information supplied by the
authors. Any queries (other than missing material) should be
directed to the New Phytologist Central Office.
Additional supporting information may be found in the online
version of this article.
Notes S1 cDNA sequences of NF1757 (Medicago truncatula no
apical meristem2 (mtnam-2)) and deduced protein sequences of
NF1757 (mtnam-2) and NF1937 (mtnam-1).
New Phytologist is an electronic (online-only) journal owned by the New Phytologist Trust, a not-for-profit organization dedicated
to the promotion of plant science, facilitating projects from symposia to free access for our Tansley reviews.
Regular papers, Letters, Research reviews, Rapid reports and both Modelling/Theory and Methods papers are encouraged.
We are committed to rapid processing, from online submission through to publication ‘as ready’ via Early View – our average time
to decision is <25 days. There are no page or colour charges and a PDF version will be provided for each article.
The journal is available online at Wiley Online Library. Visit www.newphytologist.com to search the articles and register for table
of contents email alerts.
If you have any questions, do get in touch with Central Office ([email protected]) or, if it is more convenient,
our USA Office ([email protected])
For submission instructions, subscription and all the latest information visit www.newphytologist.com
New Phytologist (2012) 195: 71–84
www.newphytologist.com
2012 The Authors
New Phytologist 2012 New Phytologist Trust