Download Mixed infection with multiple strains of murine cytomegalovirus

Journal of General Virology (2006), 87, 1123–1132
DOI 10.1099/vir.0.81583-0
Mixed infection with multiple strains of murine
cytomegalovirus occurs following simultaneous or
sequential infection of immunocompetent mice
Shelley Gorman,13 Nicole L. Harvey,1 Dorian Moro,24 Megan L. Lloyd,1
Valentina Voigt,1,3 Lee M. Smith,1 Malcolm A. Lawson1
and Geoffrey R. Shellam1
Correspondence
Shelley Gorman
[email protected]
1
Discipline of Microbiology, School of Biomedical and Chemical Sciences, M502, University of
Western Australia, 35 Stirling Highway, Crawley, WA 6009, Australia
2
School of Natural Sciences, Edith Cowan University, Joondalup, WA 6027, Australia
3
Centre for Experimental Immunology, Lions Eye Institute, 2 Verdun Street, Nedlands, WA
6009, Australia
Received 4 October 2005
Accepted 3 January 2006
As with human cytomegalovirus (HCMV) infection of humans, murine CMV (MCMV) infection is
widespread in its natural host, the house mouse Mus domesticus, and may consist of mixed
infection with different CMV isolates. The incidence and mechanisms by which mixed infection
occurs in free-living mice are unknown. This study used two approaches to determine whether
mixed infection with MCMV could be established in laboratory mice. The first utilized two naturally
occurring MCMV strains, N1 and G4, into which the lacZ gene was inserted by homologous
recombination. The lacZ gene was used to track recombinant and parental viruses in simultaneously
coinfected mice. In the second approach, a real-time quantitative PCR (qPCR) assay was used
to detect viral immediate-early 1 (ie1) gene sequences in mice successively coinfected with G4 and
then with the K181 MCMV strain. In both systems, mixed infection was detected in the salivary
glands and lungs of experimentally infected mice. MCMV-specific antibody in sera and G4
IE1-specific cytotoxic lymphocyte responses in the spleens of twice-infected mice did not prevent
reinfection. Finally, the prevalence of mixed infection in free-living mice trapped in four Australian
locations was investigated using real-time qPCR to detect ie1 DNA sequences of N1, G4 and
K181. Mixed infection with MCMVs containing the G4 and K181 ie1 sequences was detected
in the salivary glands of 34?2 % of trapped mice. The observations that mixed infections are common
in free-living M. domesticus and are acquired by immunocompetent mice through simultaneous
or successive infections are important for vaccine development.
INTRODUCTION
The prevalence of human cytomegalovirus (HCMV) is
widespread in many human populations (Britt & Alford,
1996) where primary infection is asymptomatic for most
individuals (Sissons & Carmichael, 2002). In principle,
new viral genotypes may appear in the infected host either
through mutation or reinfection with a different viral strain.
Infection of individuals with more than one HCMV genotype was first thought to occur only in those with altered
immunity such as AIDS patients (Drew et al., 1984; Gerna
3Present address: Telethon Institute for Child Health Research, Centre
for Child Health Research, The University of Western Australia, PO Box
855 West Perth, WA 6872, Australia.
4Present address: NERC Centre for Ecology and Hydrology and the
School of Agricultural and Forest Sciences, University of Wales, Bangor,
Gwynedd LL57 2UP, UK.
0008-1583 G 2006 SGM
et al., 1992; Spector et al., 1984), transplant recipients (Chou,
1986) and pregnant women (Arav-Boger et al., 2002; Huang
et al., 1980; Shen et al., 1993). However, mixed infection of
healthy individuals may frequently occur. Multiple genotypes of the glycoprotein B (gB) gene were detected in organ
and blood samples collected from 25 people at necropsy
(Meyer-König et al., 1998), and also in women who regularly
attended clinics for sexually transmitted disease (Chandler et
al., 1987). The mechanism by which mixed CMV infection
occurs in healthy individuals is unknown. The presence of
multiple strains of a virus in the infected host has significant
implications for the design of vaccines where numerous
immunologically distinct viral strains may confound vaccination attempts.
To understand further the phenomenon of mixed infection
with multiple CMV variants, we have utilized murine CMV
(MCMV) infection of inbred laboratory and free-living mice
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
Printed in Great Britain
1123
S. Gorman and others
as a model for human infection with HCMV. HCMV and
MCMV are members of the subfamily Betaherpesvirinae
of the family Herpesviridae (van Regenmortel et al., 2000).
Infection of laboratory mice with MCMV is used in many
experimental systems investigating CMV pathogenesis and
disease, as CMV infections are species-specific (Kim & Carp,
1971; Osborn, 1981). Similar to most HCMV infections,
MCMV infection is asymptomatic in healthy mice when
acquired via natural routes of transmission (Farroway et al.,
2002). MCMV is ubiquitous in free-living mice (Mus
domesticus) trapped in rural areas in Australia (Booth et al.,
1993; Moro et al., 1999; Singleton et al., 1993; Smith et al.,
1993) and other countries (Gardner et al., 1974; Mannini &
Medearis, 1961; Plummer, 1973). Furthermore, mixed
infections with multiple, genetically variable MCMV strains
have been detected in free-living mice by using restriction
fragment length polymorphism (RFLP) analysis (Booth
et al., 1993).
We were interested in determining whether mixed infection
with MCMV could be established experimentally in BALB/c
mice through either simultaneous or asynchronous inoculation with two different viral strains, in the context of
vaccine development. Mice were initially inoculated simultaneously with a wild-type strain and an alternate recombinant strain expressing the b-galactosidase protein. In a
second system, real-time quantitative PCR (qPCR) was used
to specifically detect differing immediate-early 1 (ie1) gene
sequences after mice were serially inoculated with two viral
strains. Finally, in order to investigate the extent of mixed
infection with MCMV in free-living mouse populations, we
used real-time qPCR to detect a number of MCMV ie1
genotypes in mice that were trapped at four Australian
locations. Results indicated that mixed infections can be
established in laboratory mice either through simultaneous
or asynchronous inoculation in the face of both antibody
and cytotoxic lymphocyte (CTL) responses, and that many
free-living mice may be infected with more than one MCMV
genotype.
production of tissue culture virus (TCV) stocks was as described
previously (Lutarewych et al., 1997). Confluent cells in tissue culture
flasks were infected with 16105 p.f.u. MCMV in RPMI 1640
medium with 2 % fetal calf serum (FCS), 20 mM L-glutamine and
40 mg gentamicin ml21 under conditions of centrifugal enhancement
(Hudson, 1988) at 800 g for 30 min at 37 uC. Flasks were incubated
at 37 uC with 5 % CO2 until 100 % cytopathic effect was evident.
Infected cells were scraped into the supernatant and samples were
centrifuged at 11 000 g for 30 min at 4 uC. The pellet was resuspended in 5 ml RPMI with 2 % FCS, frozen to 280 uC and thawed
to release virus from cells. Cellular debris was removed by centrifugation at 300 g for 5 min at 4 uC and supernatant was then collected
and stored at 280 uC.
Recombinant virus. The N1lacZ and G4lacZ recombinant viruses
were produced using homologous recombination techniques, which
required the co-transfection of viral DNA of the N1 and G4 strains
with linearized pON427+ plasmid. Professor E. Morcarski (Stanford
University, California, USA) provided pON427+, which contains a
lacZ gene cassette inserted between two HpaI sites in the ie2 gene on
the HindIII L fragment of K181. Insertion of this gene cassette
resulted in the deletion of a 79 bp fragment of ie2 as described
previously (Manning et al., 1992). The ie2 gene is non-essential
for virus replication both in vitro and in vivo (Cardin et al., 1995;
Manning & Mocarski, 1988; Manning et al., 1992). A purified clonal
population was acquired using three rounds of plaque purification in conjunction with X-Gal (5-bromo-4-chloro-3-indolyl b-Dgalactopyranoside) to identify cells infected with a recombinant
MCMV expressing b-galactosidase. RFLP analysis of recombinant
and parental viral DNA with the HindIII restriction enzyme
(Promega) followed by Southern blot analysis confirmed that the
lacZ gene was located on the same HindIII fragment as the ie1 and
ie2 genes (data not shown). RT-PCR confirmed that transcripts of
the ie1 and m131/129 open reading frames of the recombinant
viruses were identical to their parental strains, indicating that the
expression of genes surrounding the site of insertion was not disrupted (data not shown).
Plaque assays. Organs were homogenized to form 10 % extracts
METHODS
by using sterilized pestles (Kontes) in 1 ml RPMI with 2 % FCS.
Samples were clarified by centrifugation at 800 g for 20 min at 4 uC
and supernatants were stored at 280 uC. The plaque assay was used
to quantify infectious virus present in organ extracts in duplicate as
described previously (Allan & Shellam, 1984), except that M210B4
cells were used to detect infectious MCMV. Viral titres are expressed
in p.f.u. salivary gland g21 (limit of detection ¡500 p.f.u. g21),
where negative samples were given values of 500 p.f.u. g21 (the limit
of detection) in order to calculate geometric means.
Mice. Highly inbred BALB/c (H2d) adult (8 week old) female mice
Detection of b-galactosidase expression. Infected cell samples
were purchased as specific-pathogen-free from the Animal Resources
Centre (Murdoch, Western Australia) and maintained under minimal disease conditions. Sentinel mice were free of a set of murine
pathogens including MCMV following routine testing. All experiments were performed according to the ethical guidelines of the
National Health and Medical Research Council of Australia.
or salivary gland extracts were serially diluted in RPMI with 2 %
FCS and 200 ml was used to infect confluent monolayers of M210B4
cells for 1 h at 37 uC with 5 % CO2. The inoculum was aspirated and
1 ml RPMI with 0?7 % carboxymethyl-cellulose and 2 % FCS was
added to each well. When plaques became visible, cell monolayers
were fixed with gluteraldehyde (0?5 % in PBS), and b-galactosidase
expression was detected after incubation with PBS supplemented
with 0?5 mg X-Gal ml21 for 2 h at 37 uC.
Virus. Dr A. Scalzo (University of Western Australia, Australia)
provided the N1 and G4 isolates of MCMV, which were originally
obtained from the salivary glands of free-living mice (M. domesticus)
trapped at Nannup (N1) or Geraldton (G4) in Western Australia
(Booth et al., 1993). Dr D. Lang (Duke University, NC, USA) originally provided K181 (Chalmer et al., 1977), a laboratory strain of
MCMV considered to be a virulent variant of the Smith strain
(Misra & Hudson, 1980).
Cells and virus stock production. The M210B4 cell line was
obtained from the ATCC. Generation of M210B4 cells for the
1124
In vivo cytotoxic T-cell assay. Splenocytes from naive mice were
used as target cells, after the lysis of erythrocytes with 0?15 M
NH4Cl. Target cells were pulsed with the G4 IE1 (YPMFNPPSL) or
K181 IE1 (YPHFMPTNL) peptides by incubating 105 cells with 1 ng
peptide for 90 min at 37 uC and then labelled with 0?025 mM 5,6carboxyfluorescein diacetate succinimidyl ester (CFSE, Molecular
Probes). A second population of splenocytes was labelled with
0?25 mM CFSE. Target cells (CFSElo) and control cells (CFSEhi)
were then mixed at a ratio of 1 : 1, and 56107 cells were adoptively
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
Journal of General Virology 87
Mixed infection of immunocompetent mice with MCMV
transferred into infected mice. Splenocytes were collected from recipient mice after 18 h and the CFSE-labelled populations were
detected by flow cytometry (FACScan; Becton Dickinson) and
analysed using CellQuest software (Becton Dickinson). Specific cytotoxic effector function in the spleen was determined by a reduction
in target (CFSElo) cells relative to control cells (CSFEhi).
Mouse trapping procedures. M. domesticus were live-trapped
using Longworth (Jacob et al., 2002) or Elliott traps (Moro et al.,
2003) from free-living populations located in four Australian
locations including: Walpeup (Victoria: 35u 139 S 149u 489 E),
Gungahlin (Australian Capital Territory: 35u 59 S 142u 129 E),
Boullanger Island (Western Australia: 30u 199 S 115u 009 E) and
Macquarie Island (an oceanic subantarctic island south of Tasmania:
54u 309 S 158u 579 S). Blood was collected from mice by cardiac
puncture and serum was extracted by centrifugation at 800 g for
2 min. Salivary glands were collected from trapped mice following
autopsy. The numbers of mice trapped at the Boullanger Island,
Macquarie Island, Walpeup and Gungahlin sites were 27, 40, 38 and
12, respectively (total=117).
MCMV isolation and RFLP analysis. The method used for
purifying MCMV isolates from salivary glands of M. domesticus and
generation of viral DNA was as described previously (Booth et al.,
1993), except that M210B4 cells were used for the generation of viral
DNA. Approximately 2 mg MCMV DNA was digested for 4 h at
37 uC with 12 U EcoRI (Promega) and then electrophoresed on a
0?8 % agarose gel for 16 h at 70 V.
Real-time qPCR. We recently described a real-time qPCR system
(GeneAmp 5700 Sequence Detection System, Applied Biosystems) to
detect ie1 sequences of the N1 and G4 strains of MCMV (Farroway
et al., 2005). In this study, we have also used real-time qPCR to
detect the ie1 sequence of K181. These strains are distinguished by
variable nucleotide sequences located within the immunodominant
H2Ld CTL epitope encoded within the ie1 gene (Lyons et al., 1996).
The reverse primer (N1/G4/K181 R) was used for the detection of
all viral sequences, whilst the forward primers N1 F and G4/K181 F
were used for the detection of N1 or G4 and K181 ie1 viral
sequences, respectively (Table 1). The probes, N1, G4 and K181
(Table 1), were used in conjunction with the primers to detect the
N1, G4 and K181 ie1 sequences, respectively, to produce a 126 bp
product. PCR conditions including primer and probe concentrations, reagent mix, thermal cycling conditions and negative controls
were as described previously (Farroway et al., 2005). The rodent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer and
probe system (Applied Biosystems) was used as an internal standard
for viral DNA extraction. Plasmids containing the HindIII L fragment of the N1, G4 or K181 strains were used as positive controls
and standards (Farroway et al., 2005) as the HindIII L fragment of
MCMV encodes the ie1 gene (Keil et al., 1987). Calculated standard
curves had correlation coefficients (r) that ranged from 0?93 to 1?00
(Table 1). Data were further processed to determine the number of
viral genome copies (g organ)21. The limit of detection of this assay,
with the detection of 1 genome per reaction, was 3?56103 MCMV
genomes g21.
ELISA. Antibody specific for MCMV was detected in serum samples
using ELISA as described previously (Lawson et al., 1988). MCMV
antigen preparations were obtained following the infection of
M210B4 cells (as for TCV stocks) with K181 and at 100 % cytopathic effect, viral antigen was collected from the supernatant by
centrifugation at 18 000 g for 2 h at 4 uC (Beckman L8-70M, SW41
rotor). Sera collected from naı̈ve BALB/c mice were used as negative
controls. Sera collected from BALB/c mice inoculated intraperitoneally (i.p.) three times, at 2 week intervals, with 26104 p.f.u.
K181 and bled 2 weeks after the third inoculation were used as positive controls. Samples were considered positive at the dilution where
absorbance values were three standard deviations greater than the
mean of the absorbances achieved by the negative controls. Antibody
titres are the reciprocal of this dilution.
Table 1. Primers, probes and standard curves for real-time qPCR
Primer/probe name
Primer/probe sequence (5§–3§)
N1F*
G4/K181F
N1/G4/K181RD
N1 probe
G4 probe
K181 probe
TACGGCTGTTTCAAATCTGAGTTT
TACGGCTGTTTCAGATCTGAGTTT
CCTACGTAGCTCATCCAGACTCTCT
ACCTAGACTTCATGCCCCCTAATCTAGG
ACCCACACTTCATGCCCCCTAGCCTAGG
ACCCACACTTCATGCCCACTAATCTAGG
Plasmid
Standard curve
N1d
G4d
K181d
N1§
G4§
K181§
y=21?18ln(x)+38?6
y=21?40ln(x)+39?5
y=21?23ln(x)+39?4
y=21?44ln(x)+38?3
y=21?58ln(x)+41?1
y=21?39ln(x)+40?6
r2
0?867
0?978
0?940
1?000
0?966
0?955
*F, Forward primer.
DR, Reverse primer.
d§Plasmids containing the N1, G4 and K181 HindIII L fragments were diluted in nuclease-free water
containing DNA extracted from the salivary glandsd or lungs§ of naı̈ve adult BALB/c mice to create
standard curves for the conversion of real-time qPCR CT scores (y) to copy number of viral genomes (x).
The CT score is the cycle at which a statistically significant increase in the magnitude of the fluorescent
signal was first detected.
http://vir.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
1125
S. Gorman and others
Statistical analyses. Viral titres and ELISA results were compared
between treatments using one-way analysis of variance (followed by
Tukey’s post-hoc analysis) or the Student’s t test as appropriate.
Values reported represent mean±standard error unless stated otherwise.
RESULTS
Mixed infection can be established in the
salivary glands of mice simultaneously infected
with two MCMV strains
To determine whether mixed infection with more than one
genetic variant of MCMV could be established experimentally BALB/c mice were inoculated simultaneously with two
strains of MCMV. The wild-type strains N1 and G4 were
engineered to encode lacZ thus generating the recombinant
viruses N1lacZ and G4lacZ, respectively. Mice were inoculated i.p. with equal quantities (26104 p.f.u. a piece)
of wild-type virus and a recombinant strain expressing
b-galactosidase in one of four wild-type and recombinant
virus combinations: N1+N1lacZ, N1+G4lacZ, G4+
N1lacZ or G4+G4lacZ. To determine that a mixed infection
could be established in experimentally infected mice, the
salivary glands and lungs, which are sites of MCMV persistence and latency (Balthesen et al., 1993; Henson &
Neopolitan, 1970; Kurz et al., 1997), were assayed for
MCMV using the plaque assay. Organs were collected at
14 days post-inoculation when MCMV infection was
expected to be maximal and at 35 days when MCMV infection is no longer considered acute but persistent. At 14 days
post-inoculation, infectious virus was detected in the
salivary glands of all mice (Fig. 1b). At 35 days titres were
variable, yet infectious virus was detected in the salivary
glands of most but not all mice (Fig. 1c). Virus was not
detected in the lungs by plaque assay. Previously, using TCV
stocks of MCMV, we were occasionally able to isolate virus
from lung homogenates of mice at 14 days post-infection
i.p. with 26104 p.f.u. of either wild-type MCMV or
rMCMV-lacZ.
The presence of wild-type and recombinant strains was
determined by staining viral plaques for the expression of
b-galactosidase. The presence of both wild-type (Fig. 1a,
WT) and recombinant virus (Fig. 1a, REC) was detected in
the salivary glands of most mice for all coinfection combinations at 14 days post-infection (Fig. 1b). The number of
mixed infections detected decreased with time as virus began
to be cleared from the salivary glands (Fig. 1c). Mixed
infection was detected in all mice infected with recombinant
MCMV. When mice were infected via the intranasal route
of infection, considered to be a more ‘natural’ route of
infection (Mocarski & Kemble, 1996), similar results were
Fig. 1. Viral titres in the salivary gland after simultaneous coinfection with a mixture of two MCMV strains. Wild-type (WT)
and recombinant (REC) b-galactosidase-expressing viruses
were identified by staining mouse embryonic fibroblast monolayers infected with salivary gland homogenates from MCMVinfected mice with X-Gal, as shown in (a). Adult female BALB/
c mice were i.p. infected with a total of 46104 p.f.u. Salivary
glands were removed from mice (n=6) at 14 (b) and 35 (c)
days post-infection and tested for the presence of infectious
MCMV by plaque assay in conjunction with staining for bgalactosidase expression by recombinant MCMVs (open symbols). Wild-type viral titres are shown as closed symbols. Lines
represent geometric means (limit of detection <500 p.f.u. g”1).
Fractions shown on the top right of each box are the number
of mice per infection group with both recombinant and wildtype viruses detected in salivary gland samples. Note that
rMCMV-lacZ stably expresses b-galatosidase in vivo as all plaques isolated from the salivary glands of mice infected with
either N1lacZ or G4lacZ turn blue upon staining with X-Gal.
1126
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
Journal of General Virology 87
Mixed infection of immunocompetent mice with MCMV
obtained where both wild-type and recombinant viruses
were detected in the salivary glands of at least one mouse per
treatment group at both 14 and 35 days post-infection
(unpublished data). These results demonstrate that a mixed
infection can be readily established in the salivary glands of
BALB/c mice simultaneously inoculated with two MCMV
strains.
The use of recombinant viruses encoding b-galactosidase
has several disadvantages. Recombinant viruses can be less
competitive than wild-type viruses due to the immunological burden of the transgene. In this study, titres of the wildtype virus G4 were significantly greater than the recombinant G4lacZ at 14 days post-infection in the salivary glands
of mice coinfected with G4 and G4lacZ (Fig. 1b, P=0?006).
In addition, viral plaques and thus b-galactosidase expression were not detected from organ samples of mice with
low-level persisting or latent infections. We chose to use a
specific real-time qPCR assay to circumvent these problems
and have used this assay previously to detect the presence of
the ie1 sequences of the N1 and G4 MCMV strains in the
salivary glands of infected mice (Farroway et al., 2005).
Additional primers and probes for the detection of the ie1
sequence of the K181 strain were developed. The specificity
of the primers and probes (Table 1) for the detection of the
N1, G4 or K181 ie1 sequences was tested by using alternate
strain-specific primers and probe sets to detect the presence
of the ie1 sequence of a particular strain in salivary gland
samples, which were collected from BALB/c mice infected
i.p. with 26104 p.f.u. of the viral strain. Salivary glands
from these mice contained infectious virus as determined by
the plaque assay. Primers and probes were specific for the
detection of the appropriate viral sequences only (data not
shown).
Mixed infection can be detected in the salivary
glands and lungs of mice asynchronously
infected with two MCMV strains
Real-time qPCR was used to determine if a mixed infection
could be established in vivo after serial inoculations with two
MCMV strains. BALB/c mice were injected i.p. with
46104 p.f.u. G4 or mock infected with diluent. After
28 days, mice were reinjected i.p. with either 46104 p.f.u.
G4, K181 or mock infected with diluent. There were four
treatment groups (n=6 mice per treatment): G4+G4,
G4+K181, G4+diluent and diluent+diluent. These treatments were chosen to determine whether the K181 strain
could reinfect mice already infected with the G4 virus. An
interval of 28 days between infections was chosen to avoid
the peak of the IE1-specific CTL response, which is maximal
6–8 days after i.p. infection with either G4 or K181,
although significant CTL activity was detected as late as
50 days post-infection (see Fig. 3). The salivary glands and
lungs were removed from mice 35 days after the initial
inoculation and tested for infectious virus by plaque assay
and for the ie1 DNA sequences of G4 and K181 using the
real-time qPCR assay.
http://vir.sgmjournals.org
Fig. 2. Detection of MCMV strains in tissues, CTL responses
and serum antibody titres following serial coinfection with G4
and K181. Adult female BALB/c mice were infected i.p. with
46104 p.f.u. G4 and then 28 days later with the same dose of
G4 or K181. In some treatments, diluent (RPMI with 2 % FCS)
was used to inoculate mice. Organs were removed from mice
(n=6) 35 days after the primary inoculation. Viral titres in the
salivary glands as detected by the plaque assay are shown in
(a) where lines represent geometric means. Salivary glands (b)
and lungs (c) were tested for the presence of G4 (closed symbols) and K181 (open symbols) ie1 DNA sequences by realtime qPCR. At 34 days post-infection, target cells were pulsed
with G4 IE1 peptide (d) or K181 IE1 peptide (e) and adoptively transferred into three mice from each group, respectively.
After 18 h, lysis of targets by splenocytes was determined by
FACS analysis. MCMV-specific antibody titres are shown for
serum collected at 35 days post-infection (f) as detected by
ELISA. Data are from individual mice infected with G4+G4
(circles), G4+K181 (triangles), diluent+G4 (diamonds) or
diluent+diluent (crosses). For (b)–(f) lines represent arithmetic
mean values with negative samples not shown.
Neither infectious virus nor viral DNA was detected in the
salivary glands or lungs of negative control mice (diluent
only, Fig. 2). Even though the number of mice containing
infectious MCMV varied from two to four (Fig. 2a), there
was no difference in viral titres in the salivary glands when
all groups were compared (F=1?18, P=0?34). Secondary
infection with the same or a different MCMV strain did not
reduce viral titres, with the salivary glands of four of six
mice treated with G4+G4 or G4+K181 positive for
infectious virus (Fig. 2a). Infectious virus was not detected
in the lungs of mice from any treatment group. G4 and K181
ie1 sequences were simultaneously detected in the salivary
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
1127
S. Gorman and others
with mice infected with only one virus (Fig. 2f, F=111?9,
d.f.=17, P<0?001; Tukey’s post-hoc, P<0?001). The significant boost in antibody titres following secondary infection
confirmed that a memory response was elicited in mice from
the G4+G4 and G4+K181 treatments. Despite the boost in
MCMV-specific antibody titres, a mixed infection with G4
and K181 was still detected in the salivary glands (Fig. 2b)
and lungs (Fig. 2c) of some mice sequentially infected with
G4 and then K181.
Fig. 3. Target cells pulsed with K181 IE1 peptide or G4 IE1
peptide were adoptively transferred into mice (n=3) i.p.
infected with 46104 p.f.u. K181 or G4 at 6, 19 and 49 days
post-infection. After 18 h, spleens were removed and the in vivo
lysis of target cells was determined. Values are mean±SEM.
glands (two of six, Fig. 2b) and the lungs (one of six, Fig. 2c)
of mice sequentially injected with G4 and then K181,
indicating that a mixed infection can be established in
BALB/c mice when sequentially inoculated with two MCMV
strains.
Specific CTL responses were measured in the spleens of
infected mice using an in vivo assay, which tested the ability
of splenocytes to lyse adoptively transferred target cells
pulsed with either the K181 or G4 IE1 peptides. The advantage of this assay over the tetramer-based and gamma interferon intracellular staining methods is that the capacity of
viral-specific CTL to lyse IE1 targets is measured in vivo. The
K181 and G4 nona-peptides contain an immunodominant,
H2Ld-restricted CD8+ T-cell epitope located within the ie1
gene (Del Val et al., 1988; Lyons et al., 1996; Reddehase et al.,
1989). In mice initially infected with the G4 virus, spleen
cells recognized G4 IE1 targets (Fig. 2d) and not K181 IE1
targets, with the exception of one mouse from the G4+G4
treatment group (Fig. 2e). Lysis of G4 IE1 (Fig. 2d) but not
K181 IE1 (Fig. 2e) target cells was detected in the spleens of
mice from the G4+K181 treatment. Thus, in twice-infected
mice there were limited cross-reactive CTL responses.
Cross-reactive CTL responses were detected 7 days after i.p.
inoculation of BALB/c mice with 46104 p.f.u. K181 or G4
(Fig. 3) but were undetectable at 20 days post-infection.
Sera obtained from mice 35 days after the initial inoculation
were tested by ELISA for MCMV-specific antibodies. There
was a significant increase in antibody titres in the sera of
mice sequentially infected with two viruses as compared
1128
We also examined viral loads in the salivary glands and lungs
128 days post-primary infection, at a time when virus was
expected to be latent or cleared from the infected mice. At
this time, in mice sequentially infected with G4 and then
K181 (G4+K181), we detected G4 ie1 DNA in the salivary
glands (6?6±6?66102 viral copies g21) and lungs (4?1±
0?36103 viral copies g21) but not K181 ie1 DNA. Thus, a
mixed infection consisting of the G4 and K181 viruses may
not be able to persist. Interestingly, G4 IE1-specific (38?6±
4?4 % lysis of G4 IE1 targets) but not K181 IE1-specific CTL
responses were detected in mice from the G4+K181
treatment at any time post-infection, suggesting that longlived IE1-specific CTL responses require viral persistence.
A mixed infection with two or more MCMV
genotypes is commonplace in free-living
Australian wild mice
The extent of mixed infection in free-living M. domesticus
population is unknown, although Booth et al. (1993)
detected a mixed infection in three mice from two Australian
sites by using RFLP analysis. We have also used RFLP
analysis to detect mixed infection in a free-living mouse
trapped from Gunghalin near Canberra, Australia. MCMV
variants were isolated by plaque purification from the
salivary glands of the mouse (C4). Four genetically distinct
MCMV isolates were identified in this mouse (Fig. 4, lanes
1–4). However, RFLP has limitations for determining
the extent of mixed infection with MCMV as it is timeconsuming, expensive and restriction sites may not be
located within highly variable genes. Instead, we used the
real-time qPCR assay to detect ie1 sequences, defined in this
study as corresponding with genotypes of the N1, G4 and
K181 strains of MCMV, in the salivary glands of free-living
mice trapped at four Australian locations as this technique is
inexpensive, rapid and repeatable.
The G4 and K181 ie1 genotype sequences were detected in
mice from all sites and concomitantly detected in the
salivary glands of mice trapped at each location, where the
prevalence of mixed infection ranged from 27?5 to 66?7 %
(Fig. 5a). In total, mixed infection was detected in the
salivary glands of 34?2 % (40 of 117) of trapped mice. While
copy numbers of each viral genotype detected in the salivary
glands was variable (Fig. 5b), there was no difference in the
number of viral genomes of G4 or K181 genotypes (g
salivary gland)21 from mice trapped in any location (F=
1?73, d.f.=233, P=0?10). However, mice from Boullanger
Island tended to have reduced loads of viral DNA than mice
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
Journal of General Virology 87
Mixed infection of immunocompetent mice with MCMV
Fig. 4. EcoRI restriction profiles of MCMV isolates purified
from the salivary glands of a mouse captured in Gunghalin
(ACT, Australia). Lanes 1–8 contain digests of isolates C4A,
C4B, C4C, C4D, C7A, N1, G4 and K181, respectively. Lane 9
contains 1 mg 1 kb plus DNA ladder (Gibco-BRL).
from the other tested sites. G4 or K181 ie1 genotypes were
detected in the salivary glands of 100 % of mice trapped on
Macquarie and Boullanger Islands, respectively (Fig. 5a).
Interestingly, the N1 ie1 sequence was not detected in the
salivary glands of any trapped mouse. The prevalence of
MCMV infection using real-time qPCR, ELISA and plaque
assay after results for all locations were pooled (n=117) and
was 94?0, 59?0 and 34?2 %, respectively.
DISCUSSION
We have shown that mixed infection with more than one
MCMV ie1 genotype is common in free-living mice from
various Australian locations. Mixed infections were also
experimentally established in the salivary glands and/or
lungs of BALB/c mice either simultaneously or asynchronously infected with two viral strains. We have also
documented coinfection of wild-type and recombinant
lacZ-expressing viruses of the same MCMV strain (for
http://vir.sgmjournals.org
Fig. 5. Detection of N1, G4 and K181 ie1 DNA sequences by
real-time qPCR in the salivary glands of free-living mice trapped
at four Australian locations. In (a) the prevalence of each ie1
sequence and in (b) the number of MCMV genomes (g salivary
gland)”1 are shown (means are shown by lines). The prevalence of mice infected with both G4 and K181 are shown
(G4+K181). Black bars/squares, Boullanger Island (BI);
hatched bars/circles, Macquarie Island (MI); white bars/triangles, Gunghalin (GU); grey bars/diamonds, Walpeup (WA).
example, N1+N1lacZ) as reported in previous studies
(Grzimek et al., 1999; Saederup et al., 1999). In situ hybridization techniques were used recently to determine that
dual infection of host cells occurs more frequently than
statistically predicted (Cicin-Sain et al., 2005). Mixed
infections can be established via the intranasal route of
infection, a more natural inoculation route of infection
(Mocarski & Kemble, 1996), which may mimic the natural
route of MCMV transmission (Mannini & Medearis, 1961;
Osborn, 1981) after inhalation or ingestion of saliva containing virus shed from the salivary glands of an infected
mouse (Plummer, 1973). Mixed MCMV infections may
thus be acquired by free-living M. domesticus by either the
simultaneous or sequential transmission of MCMV strains.
Previous investigations of mixed HCMV infection of human
populations have indicated that immune status may contribute towards the incidence of mixed infection (AravBoger et al., 2002; Chou, 1986; Drew et al., 1984; Gerna et al.,
1992; Huang et al., 1980; Shen et al., 1993; Spector et al.,
1984). Similarly, the immune status of wild mice may also
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
1129
S. Gorman and others
influence the incidence of mixed infection. Biological factors
that modify the immune status of mice include viral and
parasitic loads (Smith et al., 1993), breeding stress and
environmental factors that alter food abundance (Teo et al.,
1991). Mixed infection might occur in stressed individuals
during extreme events, such as mouse plagues (Booth et al.,
1993). However, the incidence (34?2 %, 40 of 117) of mixed
infection cannot be attributed solely to the immune status of
the mouse populations tested. Instead, mixed infection is
probably a feature of MCMV infection in the free-living
mouse. We hypothesize that mixed infection may promote
the persistence of MCMV in free-living mice through complementation, where the presence of a number of different
viral strains would increase genetic variation and thus
enhance the fitness of the coinfecting viruses as a population. In addition, MCMV may have an increased ability to
evade immune responses of the host, due to enhanced
variation within immune targets of the coinfecting viruses.
The frequent detection of the G4 and K181 ie1 genotypes
among wild house-mice may indicate an increased capacity
of these viruses to persist and transmit among their hosts in
comparison to viruses with the N1 ie1 genotype. The lack of
detection of the N1 ie1 sequence was an unexpected result
and this strain is probably a unique variant. We have
preliminary data (S. Nikolovski & S. Gorman, unpublished
results), which indicates that the G4 strain has an enhanced
capacity to transmit from infected mice to their cage-mates
compared with N1. As also demonstrated by Wheat et al.
(2003), real-time qPCR is more sensitive than plaque assay
and ELISA for detecting MCMV infection. Following the
immunization of BALB/c mice with a TCV stock of G4,
Morley et al. (2003) could not detect viral titres in mice
challenged 90 days later with a salivary gland-derived stock
of K181. The technique used in our experiments, real-time
qPCR, was a more sensitive method of detection, with mixed
infections identified at early times post-infection. However,
there are limitations associated with using this real-time
qPCR system to detect mixed infection with MCMV. It is
uncertain whether differences detected within ie1 reflect real
strain differences between coinfecting MCMV strains. Lyons
et al. (1996) defined five groups of isolates with naturally
occurring variant sequences at the IE1 Ld-restricted CTL
epitope. The G4, N1 and K181 IE1 sequences correspond to
groups 2, 4 and 5, and without incorporating the additional
sequence variations of groups 1 and 3 in this study we may
have underestimated the extent of mixed infection. In
addition, the gB gene may be an appropriate target for the
identification of specific MCMV variants as it contains a
highly variable antibody-binding sequence (Xu et al., 1996),
and has been used to detect mixed infection in man with
HCMV (Meyer-König et al., 1998).
We have shown that mice already infected with MCMV
can be reinfected with a new strain, despite viral-specific
immune responses, indicating that sterilizing immunity
to MCMV does not occur. Pre-existing antibody and
CTL responses did not prevent reinfection, even though
1130
MCMV-specific antibody titres were increased in serum
following secondary infection. Furthermore, the absence of
K181 IE1-specific CTL responses together with the resolution of polyclonal CTL responses 20 days after infection
with G4 probably enabled the dissemination of K181 into
the salivary glands and lungs. Prior infection with G4
induced G4 IE1-specific CTL responses, but these did not
prevent reinfection with the heterologous strain K181.
Lyons et al. (1996) found that G4-primed CTLs could lyse
both heterologous K181 IE1 peptide-pulsed targets and
homologous G4 IE1 peptide-pulsed targets. While our data
confirms this, we only found this phenomenon to occur
early after MCMV infection. It is possible that dissemination
of K181 occurred via the infiltration of mononuclear
phagocytes of the peritoneal cavity into the salivary glands
and lungs, without further virus replication. It is uncertain
whether a productive infection with K181 was established, as
we have not used reverse transcription techniques to detect
viral RNA of early- or late-expressing genes (e.g. gB).
CTL are required for the clearance of acute MCMV infection in BALB/c mice, as adoptive transfer of sensitizedCD8+ T cells limits MCMV dissemination, prevents tissue
destruction and protects mice from lethal MCMV disease
(Reddehase et al., 1984, 1987, 1988). Recently, it has been
shown that adoptive transfer of memory CD8+ T cells
specific for the Ld-restricted IE1 epitope were highly
protective in mice (Pahl-Seibert et al., 2005) and similar
data were obtained with regard to HCMV IE1-specific CD8
responses in human transplant recipients (Bunde et al.,
2005). In addition, CMV infection occurs in a substantially
lower proportion of seropositive than seronegative transplant recipients (Singh et al., 2005) and maternal immunity
is associated with a reduced risk of congenital CMV disease
(Fowler et al., 2003). Nonetheless, our data indicates that it
may be very difficult to prevent reinfection in the face of an
established CTL response in immunocompetent mice. In
immunocompetent people, immunity to HCMV does not
entirely prevent clinical disease after reinfection with a new
strain of virus. Naturally infected HCMV seropositive and
Towne strain vaccinated seronegative volunteers received a
low-passage Toledo strain as the challenge virus (Adler et al.,
1995; Plotkin et al., 1989). Although most volunteers who
were either naturally seropositive for HCMV or who had
been vaccinated with Towne resisted clinical disease more
effectively than naı̈ve individuals, clinical disease was still
observed in some immunized individuals.
A further reason for preventing reinfection is the growing
evidence from immunocompromised transplant patients
that the presence of multiple HCMV gB variants correlates
with higher virus loads, an increased prevalence of HCMV
disease and a higher rate of graft rejection (Coaquette et al.,
2004). To be effective, it may be necessary for future HCMV
vaccines to induce durable polyclonal CTL immune
responses such as those observed early during infection,
to prevent reinfection with different viral strains. This will be
a major challenge in vaccine development.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
Journal of General Virology 87
Mixed infection of immunocompetent mice with MCMV
ACKNOWLEDGEMENTS
Drew, W. L., Sweet, E. S., Miner, R. C. & Mocarski, E. S. (1984).
We acknowledge the assistance of Micah Davies and Lisa Farroway
(CSIRO Division of Sustainable Ecosystems, Gungahlin, ACT), who
trapped mice at Gungahlin and Walpeup (Australia), respectively, and
to Dr Jane Allan for her critique of the manuscript. This research was
supported by the Grains Research and Development Corporation
(CSV16), the Pest Animal Control Cooperative Research Centre and
the Australian Antarctic Division.
Farroway, L. N., Singleton, G. R., Lawson, M. A. & Jones, D. A.
(2002). The impact of murine cytomegalovirus (MCMV) on
REFERENCES
Adler, S. P., Starr, S. E., Plotkin, S. A., Hempfling, S. H., Buis, J.,
Manning, M. L. & Best, A. M. (1995). Immunity induced by primary
Multiple infections by cytomegalovirus in patients with acquired
immunodeficiency syndrome: documentation by Southern blot
hybridization. J Infect Dis 150, 952–953.
enclosure populations of house mice (Mus domesticus). Wildl Res
29, 11–17.
Farroway, L. N., Gorman, S., Lawson, M. A., Harvey, N. L., Jones,
D. A., Shellam, G. R. & Singleton, G. R. (2005). Transmission of two
Australian strains of murine cytomegalovirus (MCMV) in enclosure
populations of house mice (Mus domesticus). Epidemiol Infect 133,
701–710.
Fowler, K. N., Stagno, S. & Pass, R. F. (2003). Maternal immunity
human cytomegalovirus infection protects against secondary infection among women of childbearing age. J Infect Dis 171, 26–32.
and prevention of congenital cytomegalovirus infection. JAMA 289,
1008–1011.
Allan, J. E. & Shellam, G. R. (1984). Genetic control of murine
Gardner, M. B., Officer, J. E., Parker, J., Estes, J. D. & Rongey, R. W.
(1974). Induction of disseminated virulent cytomegalovirus infection
cytomegalovirus infection: virus titres in resistant and susceptible
strains of mice. Arch Virol 81, 139–150.
Arav-Boger, R., Willoughby, R. E., Pass, R. F., Zong, J. C., Jang, W. J.,
Alcendor, D. & Hayward, G. S. (2002). Polymorphisms of the
cytomegalovirus (CMV)-encoded tumour necrosis factor-a and
b-chemokine receptors in congenital CMV disease. J Infect Dis
186, 1057–1064.
Balthesen, M., Messerle, M. & Reddehase, M. J. (1993). Lungs are a
major organ site of cytomegalovirus latency and recurrence. J Virol
67, 5360–5366.
Booth, T. W., Scalzo, A. A., Carrello, C., Lyons, P. A., Farrell, H. E.,
Singleton, G. R. & Shellam, G. R. (1993). Molecular and biological
characterization of new strains of murine cytomegalovirus isolated
from wild mice. Arch Virol 132, 209–220.
Britt, W. J. & Alford, C. A. (1996). Cytomegalovirus. In Field’s
Virology, 3rd edn, pp. 2221–2230. Edited by B. Field, D. Knipe &
P. Howley. Philadelphia: Lippincott-Raven.
Bunde, T., Kirchner, A., Hoffmeister, B. & 8 other authors (2005).
Protection form cytomegalovirus after transplantation is correlated
with immediate early 1-specific CD8 T cells. J Exp Med 201,
1031–1036.
by immunosuppression of naturally chronically infected wild mice.
Infect Immun 10, 966–969.
Gerna, G., Baldanti, F., Zavattoni, M., Sarasini, A., Percivalle, E. &
Revello, M. G. (1992). Monitoring of ganciclovir sensitivity of
multiple human cytomegalovirus strains coinfecting blood of an
AIDS patient by an immediate-early antigen plaque assay. Antiviral
Res 19, 333–345.
Grzimek, K., Podlech, A. J., Steffens, H.-P., Holtappels, R.,
Schmalz, S. & Reddehase, M. J. (1999). In vivo replication of
recombinant murine cytomegalovirus driven by the paralogous
major immediate-early promoter-enhancer of human cytomegalovirus. J Virol 73, 5043–5055.
Henson, D. & Neapolitan, C. (1970). Pathogenesis of chronic mouse
cytomegalovirus infection in submaxillary glands of C3H mice. Am
J Pathol 58, 255–267.
Huang, E. S., Alford, C. A., Reynolds, D. W., Stagno, S. & Pass, R. F.
(1980). Molecular epidemiology of cytomegalovirus infections in
women and their infants. N Engl J Med 303, 958–962.
Hudson, J. B. (1988). Further studies on the mechanism of
centrifugal enhancement of cytomegalovirus infectivity. J Virol
Methods 19, 97–108.
Cardin, R. D., Abenes, G. B., Stoddart, C. A. & Mocarski, E. S.
(1995). Murine cytomegalovirus IE2, an activator of gene expression,
Jacob, J., Ylönen, H. & Hodkinson, C. G. (2002). Trapping efficiency
is dispensable of growth and latency in mice. Virology 209, 236–241.
of Ugglan traps and Longworth traps for house mice in southeastern Australia. Wildl Res 29, 101–103.
Chalmer, J. E., Mackenzie, J. S. & Stanley, N. F. (1977). Resistance to
murine cytomegalovirus linked to the major histocompatibility
complex of the mouse. J Gen Virol 37, 107–114.
Chandler, S. H., Handsfield, H. H. & McDougall, J. K. (1987).
Isolation of multiple strains of cytomegalovirus from women
attending a clinic for sexually transmitted disease. J Infect Dis 155,
655–660.
Chou, S. W. (1986). Acquisition of donor strains of cytomegalovirus
by renal-transplant recipients. N Engl J Med 314, 1418–1423.
Keil, G. M., Ebeling-Keil, A. & Koszinowski, U. H. (1987).
Immediate-early genes of murine cytomegalovirus: location, transcripts and translation products. J Virol 61, 526–533.
Kim, K. S. & Carp, R. I. (1971). Growth of murine cytomegalovirus in
various cell lines. J Virol 7, 720–725.
Kurz, S., Steffens, H. P., Mayer, A., Harris, J. R. & Reddehase, M. J.
(1997). Latency versus persistence or intermittent recurrences:
evidence for a latent state of murine cytomegalovirus in the lungs.
J Virol 71, 2980–2987.
Cicin-Sain, L., Podlech, J., Messerle, M., Reddehase, M. J. &
Koszinowski, U. H. (2005). Frequent coinfection of cells explains
Lawson, C. M., Grundy, J. E. & Shellam, G. R. (1988). Antibody
functional in vivo complementation between cytomegalovirus
variants in the multiply infected host. J Virol 79, 9492–9502.
responses to murine cytomegalovirus in genetically resistant and
susceptible strains of mice. J Gen Virol 69, 1987–1998.
Coaquette, A., Bourgeois, A., Dirand, C., Varin, A., Chen, W. &
Herbein, G. (2004). Mixed cytomegalovirus glycoprotein B genotypes
Lutarewych, M. A., Quirk, M. R., Kringstad, B. A., Li, W., Verfaillie,
C. M. & Jordan, M. C. (1997). Propagation and titration of murine
in immunocompromised patients. Clin Infect Dis 39, 155–161.
cytomegalovirus in a continuous bone marrow-derived stromal cell
line (M2-10B4). J Virol Methods 68, 193–198.
Del Val, M., Volkmer, H., Rothbard, J. B., Jonjic, S., Messerle, M.,
Schickedanz, J., Reddehase, M. J. & Koszinowski, U. H. (1988).
Molecular basis for cytolytic T-lymphocyte recognition of the
murine cytomegalovirus immediate-early protein pp89. J Virol 62,
3965–3972.
http://vir.sgmjournals.org
Lyons, P. A., Allan, J. E., Carrello, C., Shellam, G. R. & Scalzo, A. A.
(1996). Effect of natural sequence variation at the H-2Ld-restricted
CD8+ T cell epitope of the murine cytomegalovirus ie1-encoded
pp89 on T cell recognition. J Gen Virol 77, 2615–2623.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
1131
S. Gorman and others
Manning, W. C. & Mocarski, E. S. (1988). Insertional mutagenesis of
the murine cytomegalovirus genome: one prominent alpha gene
(ie2) is dispensable for growth. Virology 167, 477–484.
Manning, W. C., Stoddart, C. A., Lagenaur, L. A., Abenes, G. B. &
Mocarski, E. B. (1992). Cytomegalovirus determinant of replication
for murine cytomegalovirus immediate-early antigens mediate
protective immunity. J Virol 61, 3102–3108.
Reddehase, M. J., Jonjic, S., Weiland, F., Mutter, W. & Koszinowski,
U. H. (1988). Adoptive immunotherapy of murine cytomegalovirus
Mannini, A. & Medearis, D. N. Jr (1961). Mouse salivary gland virus
adrenalitis in the immunocompromised hose: CD4-helper-independent
antiviral function of CD8-positive memory T lymphocytes derived
from latently infected donors. J Virol 62, 1061–1065.
in the salivary glands. J Virol 66, 3794–3802.
infections. Am J Hyg 73, 329–343.
Reddehase, M. J., Rothbard, J. B. & Koszinowski, U. H. (1989).
Meyer-König, U., Ebert, K., Schrage, B., Pollak, S. & Hufert, F. T.
(1998). Simultaneous infection of healthy people with multiple
A pentapeptide as minimal antigenic determinant for MHC class
I-restricted T lymphocytes. Nature 337, 651–653.
human cytomegalovirus strains. Lancet 352, 1280–1281.
Saederup, N., Lin, Y. C., Dairaghi, D. J., Schall, T. J. & Mocarski, E. S.
(1999). Cytomegalovirus-encoded b chemokine promotes monocyte-
Misra, V. & Hudson, J. B. (1980). Minor base differences between the
genomes of two strains of murine cytomegalovirus differing in
virulence. Arch Virol 64, 1–8.
associated viraemia in the host. Proc Natl Acad Sci U S A 96,
10881–10886.
Mocarski, E. S. Jr & Kemble, G. W. (1996). Recombinant cytomegalo-
Shen, C. Y., Chang, S. F., Chao, M. F. & 8 other authors (1993).
viruses for study of replication and pathogenesis. Intervirology 39,
320–330.
Cytomegalovirus recurrence in seropositive pregnant women attending obstestric clinics. J Med Virol 41, 24–29.
Morley, P. J., Ertl, P. F. & Sweet, C. (2003). High-frequency interferon-c-
Singh, N., Wannstedt, C., Keyes, L., Wagener, M. M. & Cacciarelli,
T. V. (2005). Who among cytomegalovirus-seropositive liver
secreting splenocytes specific for murine cytomegalovirus immediateearly-1 (IE-1) peptide 168YPHFMPTNL176 are insufficient to provide
complete protection from viral challenge. J Med Virol 69, 240–250.
transplant recipients is at risk for cytomegalovirus infection? Liver
Transpl 11, 700–704.
Moro, D., Lloyd, M. L., Smith, A. L., Shellam, G. R. & Lawson, M. A.
(1999). Murine viruses in an island population of introduced house
Singleton, G. R., Smith, A. L., Shellam, G. R., Fitzgerald, N. & Muller,
W. J. (1993). Prevalence of viral antibodies and helminths in field
mice and endemic short-tailed mice in Western Australia. J Wildl Dis
35, 301–310.
populations of house mice (Mus domesticus) in southeastern
Australia. Epidemiol Infect 110, 399–417.
Moro, D., Lawson, M. A., Hobbs, R. P. & Thompson, R. C. A. (2003).
Sissons, J. G. & Carmichael, A. J. (2002). Clinical aspects and
Pathogens of house mice on arid Boullanger Island and subantarctic
Macquarie Island, Australia. J Wildl Dis 39, 762–771.
Smith, A. L., Singleton, G. R., Hansen, G. M. & Shellam, G. (1993). A
Osborn, J. E. (1981). Cytomegalovirus and other herpesviruses. In
The Mouse in Biomedical Research, pp. 267–292. Edited by H. L.
Foster, J. D. Small, & J. G. Fox. New York: Academic Press.
Pahl-Seibert, M.-F., Jeulch, M., Podlech, J., Thomas, D., Deegen, P.,
Reddehase, M. J. & Holtappels, R. (2005). Highly protective in vivo
management of cytomegalovirus infection. J Infect 44, 78–83.
serologic survey for viruses and Mycoplasma pulmonis among wild
house mice (Mus domesticus) in southeastern Australia. J Wildl Dis
29, 219–229.
Spector, S. A., Hirata, K. K. & Newman, T. R. (1984). Identification
of multiple cytomegalovirus strains in homosexual men with acquired
immunodeficiency syndrome. J Infect Dis 150, 953–956.
function of cytomegalovirus IE1 epitope-specific memory CD8 T cells
purified by T-cell receptor-based cell sorting. J Virol 79, 5400–5413.
Teo, H. K., Price, P. & Papadimitriou, J. M. (1991). The effects of
Plotkin, S. A., Starr, S. E., Friedman, H. M., Gonczol, E. & Weibel,
R. E. (1989). Protective effects of Towne cytomegalovirus vaccine
protein malnutrition on the pathogenesis of murine cytomegalovirus
disease. Int J Exp Pathol 72, 67–82.
against low-passage cytomegalovirus administered as a challenge.
J Infect Dis 159, 860–865.
van Regenmortel, M. H. V., Fauquet, C. M. & Bishop, D. H. L. (2000).
Med Virol 15, 92–125.
Virus Taxonomy: Classification and Nomenclature of Viruses: Seventh
Report of the International Committee on Taxonomy of Viruses,
pp. 214–216. London: Academic Press.
Reddehase, M. J., Keil, G. M. & Koszinowski, U. H. (1984). The
Wheat, R. L., Clark, P. Y. & Brown, M. G. (2003). Quantitative
cytolytic T lymphocyte response to the murine cytomegalovirus. I.
Distinct maturation stages of cytolytic T lymphocytes constitute the
cellular immune response during acute infection of mice with the
murine cytomegalovirus. J Immunol 132, 482–489.
measurement of infectious murine cytomegalovirus genomes in
real-time PCR. J Virol Methods 112, 107–113.
Xu, J., Lyons, P. A., Carter, M. D., Booth, T. W., Davis-Poynter, N. J.,
Shellam, G. R. & Scalzo, A. A. (1996). Assessment of antigenicity and
Reddehase, M. J., Mutter, W., Munch, K., Buhring, H. J. &
Koszinowski, U. H. (1987). CD8-positive T lymphocytes specific
genetic variation of glycoprotein B of murine cytomegalovirus. J Gen
Virol 77, 49–59.
Plummer, G. (1973). Cytomegaloviruses of man and animals. Prog
1132
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 13 May 2017 11:14:38
Journal of General Virology 87