Download The ancestral role of Brachyury: expression of NemBra1 in the basal

Dev Genes Evol (2003) 212:563–570
DOI 10.1007/s00427-002-0272-x
ORIGINAL ARTICLE
Corinna B. Scholz · Ulrich Technau
The ancestral role of Brachyury: expression of NemBra1 in the basal
cnidarian Nematostella vectensis (Anthozoa)
Received: 27 June 2002 / Accepted: 3 September 2002 / Published online: 20 November 2002
Springer-Verlag 2002
Abstract The T-Box transcription factor Brachyury plays
important roles in the development of all bilateral animals
examined so far. In order to understand the ancestral
function of Brachyury we cloned NemBra1, a Brachyury
homolog from the anthozoan sea anemone Nematostella
vectensis. Anthozoa are considered the basal group
among the Cnidaria. First NemBra1 expression could be
detected at the blastula/gastrula transition and gene
activity persists until adulthood of the animals. In situ
hybridization shows that NemBra1 expression in gastrulae
and early planula larvae is restricted to a circle around the
blastopore. When the larvae begin to metamorphose into
primary polyps, the expression zone extends into the
developing mesenteries. In adult polyps Brachyury
expression persists in the mesenteries, but is excluded
from the septal filament and the differentiated retractor
muscles, which also develop from the mesenteries. We
conclude that the ancestral function of Brachyury was in
specifying the blastopore and its endodermal derivatives.
Keywords Mesoderm · Cnidaria · Brachyury ·
Blastopore · Nematostella vectensis
Introduction
The evolutionary transition between the diploblastic and
the triploblastic animals is marked by the emergence of
the mesoderm. This major step in evolution is correlated
with an enormous diversification of animal body plans. It
is therefore conceivable that genes involved in the
evolution of the mesoderm were also important players
in the evolution of animal body plans. In order to
Edited by D. Tautz
C.B. Scholz · U. Technau ())
Molecular Cell Biology, Institute of Zoology,
Darmstadt University of Technology, Schnittspahnstrasse 10,
64287 Darmstadt, Germany
e-mail: [email protected]
Tel.: +49-6151-166244
Fax: +49-6151-166077
understand the diplo-triploblastic transition on a molecular level, we started cloning genes involved in mesoderm
formation in Bilateria from diploblastic animals.
In vertebrates one of the key transcription factors
involved in regulation of mesoderm differentiation is the
T-box gene Brachyury (Hermann et al. 1990; Beddington
et al. 1992; Kispert et al. 1995; O’Reilly et al. 1995;
reviewed in Smith 1997, 1999). Brachyury is first
expressed pan-mesodermally in the marginal zone and
becomes restricted to the axial mesoderm, i.e. the
notochord, upon gastrulation (Wilkinson et al. 1990).
Vertebrate Brachyury has a conserved dual role in
differentiation of the posterior mesoderm and axis
elongation which seems to be a consequence of its role
in cell motility (Wilkinson et al. 1990; Smith et al. 1991;
Conlon and Smith 1999; Beddington et al. 1992). While
notochord expression is conserved among all chordates
(Yasuo and Satoh 1998; Bassham and Postlethwait 2000)
comparative expression analysis of Brachyury homologs
in basal deuterostomes (echinoderms and hemichordates)
suggest that the ancestral expression in basal deuterostomes was in fore- and hindgut formation (Peterson et al.
1999a, b; Shoguchi et al. 1999; Tagawa et al. 1998; Croce
et al. 2001). After metamorphosis Brachyury expression
appears also in meso- and metacoel, the more posterior
parts of the mesoderm (Peterson et al. 1999b). Thus,
Brachyury expression in mesodermal tissues and in the
developing gut appears to be ancestral within the
deuterostomes.
In the protostome Drosophila and other insects the
Brachyury homolog T-related gene (Trg) is expressed in
the hindgut of developing larvae (Kispert et al. 1994).
Recent studies showed that Trg is also required for the
specification of the visceral caudal mesoderm (Kusch and
Reuter 1999). The ancestral function of Brachyury in the
Bilateria became evident by the recent expression analysis in a member of the second major protostome clade,
the Lophotrochozoa. In the polychaete annelid Platynereis dumerilii the Brachyury homolog Pd-bra is expressed
around the slit-like blastopore, which develops into foreand hindgut, similar to the gut formation in basal
564
deuterostomes, indicating a homology of these structures
(Arendt et al. 2001). The marine gastropod Patella
vulgata also shows Brachyury expression at the posterior
edge of the mouth-forming blastopore and later along the
AP axis (Lartillot et al. 2002). Likewise, the arrow worm
Paraspadella gotoi expresses Brachyury at the blastopore,
similar to embryos of both Deuterostomia and Protostomia (Takada et al. 2002). In conclusion, the common
ancestor of all bilaterians most likely first expressed
Brachyury in the blastopore which developed into foreand hindgut (Arendt et al. 2001; Technau 2001).
As a step to resolve the evolutionary origin of this gene
and its basic function before its implication in mesoderm
formation, a Brachyury homolog (HyBra1) was isolated
from the diploblastic cnidarian Hydra (Technau and Bode
1999). HyBra1 is expressed in the endoderm of the
polyp’s head (i.e. the hypostome) and acts very early in
head formation. However, the hydrozoan Hydra is
considered a rather derived organism among the Cnidaria
and a connection between the hypostome of the adult
hydra polyp and the blastopore of Bilateria is not obvious.
Also, embryogenesis in Hydra does not offer any clue in
this respect. Hydra embryos gastrulate by multipolar
immigration, then form a cuticle and go into a diapause of
variable length. The young polyps hatch directly from the
cuticle stage, thereby skipping the planula stage, which is
the typical larva of cnidarians (Martin et al. 1997).
A more suitable organism to study gene expression in
early embryos and for tracing back ancestral gene
functions is the sea anemone Nematostella vectensis
(Hand and Uhlinger 1992; Fritzenwanker and Technau
2002). Nematostella belongs to the Anthozoa, which are
considered more basal than the hydrozoan Hydra (Bridge
et al. 1992, 1995; Collins 2002). The Nematostella
embryo develops via a coeloblastula and an invagination
gastrula into a planula larva. During metamorphosis into
young polyps they develop the hypostome with mouth
and tentacles at their former posterior end, which is the
site of gastrulation (Hand and Uhlinger 1992). Here we
present the isolation of the Nematostella Brachyury
homolog, NemBra1, and show the first in situ hybridizations in Nematostella. The analysis supports the view of
an ancestral function of Brachyury in designating the
blastoporal region and the tissue derived from the
blastopore.
Materials and methods
Animal culture
Adult polyps of N. vectensis were kept in Nematostella medium
(NM; 1/3 artificial seawater; Tropic Marin, Dreieich) at 18C and
fed four times per week with nauplius larvae of Artemia salina.
Spawning was induced as described (Fritzenwanker and Technau
2002). The medium was changed once a week.
Cloning of NemBra1 and a b-actin fragment
The NemBra1 fragment was amplified from embryonic first strand
cDNA by PCR with degenerate primers (Bra-1: 5' AYGGNMGNMGNATGTTYCC 3') and Bra-3: 5' RAANSCYTTNGCRAANGG
3'). PCR conditions were: 3 min at 94C (1 cycle); 1 min at 94C,
1 min at 42C, 1 min at 72C (35 cycles); 10 min at 72C. A
fragment of the expected size was obtained, cloned into TA cloning
vector TOPOII (Invitrogen) and sequenced. Full length NemBra1
(GenBank accession AF540387) was obtained by 3' and 5' RACE
(Frohman 1995; Gene Racer Kit, Invitrogen). The resulting RACE
sequences were used to design specific primers and to amplify the
full-length clone from first strand cDNA.
The actin fragment (GenBank accession AF327845) was
obtained by nested PCR with degenerate primers (Act5': 5'
GGNGTNATGGTNGGNATG 3'; Act3': 5' DATCCACATYTGYTGRAA 3'; nested ActDeg5.2: 5' AARATGACNCARATHATGTT 3'; nested ActSpez3: 5' GCGGTCGGCGATGCCTGG 3')
from first strand cDNA. PCR was carried out as follows: 3 min at
94C (1 cycle); 1 min at 94C, 1 min at 44C, 1 min at 72C
(35 cycles); 5 min at 72C. The amplified fragment was cloned into
TA cloning vector pGEM-T (Promega) and sequenced.
RT-PCR expression analysis
RT-PCR expression analysis was performed on cDNA of different
embryonic stages using specific primers against NemBra1 and actin
[NemBra1: NemBra2/5 (5' ATAAACAAAACTCTGGGGGAC 3')
and NemBra2/31 (5' TTTAGACTCGTGATCTCTTCG 3'); actin:
ActSpez5 (5' GCTAACACTGTCCTGTCT 3') and ActSpez3'A (5'
TGGAAGGTGGACAGGGAA 3')]. The PCR conditions for NemBra1 were: 3 min at 94C (1 cycle); 1 min at 94C, 1 min at 46C,
1 min at 72C (35 cycles); 5 min at 72C.
In situ hybridization
The in situ hybridization protocol developed for Nematostella was
based on a protocol for Hydra (Grens et al. 1995), however, with
several important modifications. The jelly surrounding the embryos
was dissolved by treatment with 2% cysteine in NM pH 7.6 for 15–
20 min on a rotary shaker. Isolated embryos were fixed in 1.25%
glutaraldehyde/4% paraformaldehyde (in NM) overnight at 4C.
The samples were stored in methanol at –20C. Primary polyps
were allowed to relax in NM prior to fixation. The animals were
anesthetized by carefully adding an equal volume of 7.13% MgCl2
and incubating the animals for 8–10 min at room temperature. Then
the animals were cauterized with 2% HCl in NM for 5 min at 4C,
followed by several washes in NM, and were fixed with 4% PFA/
1.25% glutaraldehyde. Fixed animals were rehydrated by a series of
washes in methanol/PBS/0.02% Triton X-100 (PBT; 100%, 75%,
50%, 25%, twice at 0% methanol/PBT) for 5 min each step and
were treated with proteinase K (20 g/ml) for 18 min, followed by
0.4% glycine/PBT, two washes in 0.1 M triethanolamine and two
washes in 0.25% (v/v) acetic anhydride/0.1 M triethanolamine. The
specimens were washed twice in PBT and refixed in 4%
paraformaldehyde for 20 min. After several PBT washes the
animals were transferred into hybridization solution (50% formamide, 4 SSC, 5 Denhardt’s, 0.1% CHAPS, 200 g/ml yeast
RNA, 100 g/ml heparin and 0.1% Tween 20) incubating for 10 min
in PBT/hybridization solution (1:1) and 10 min in hybridization
solution at room temperature (RT). Prehybridization was done at
55C for at least 2 h. Hybridization was carried out at 55C for 36–
60 h with a final probe concentration of 0.25 ng/l. Free probe was
removed by nine changes of 50% formamide/4 SSC/0.1% Tween
at 55C for 1 h each. In the last washing step samples were cooled
down to RT. After two washes in PBT and one washing step in
MAB (100 mM maleic acid/150 mM NaCl; pH 7.5) the samples
were blocked in blocking solution (Roche) at RT for at least 2 h.
Animals were incubated overnight at 4C in anti DIG-APconjugated antibody (Roche; 1:2,000 in blocking solution). After
565
several washes with MAB over 24 h the specimens were transferred
into NTMT (100 mM NaCl; 100 mM Tris-HCl, pH 9.5; 50 mM
MgCl2; 0.1% Tween 20; 1 mM levamisol). Detection was carried
out with NBT/BCIP (Roche) in a 1:50 dilution in NTMT at 37C.
The color reaction was stopped in ethanol.
Vibratome sections
After in situ hybridization adult polyps were mounted in 14% BSA/
0.44% gelatine in PBS/2.5% glutaraldehyde. Fifteen minutes after
fixation, blocks were cut in the vibratome in slices of 50–100 m
thickness.
Results
Isolation of the Brachyury homolog NemBra1
and an actin homolog Nemactin from N. vectensis
Using PCR and RACE we cloned a homolog of the T-box
gene Brachyury from N. vectensis. As a positive control in
expression analysis by RT-PCR and in situ hybridization
experiments, we also cloned a 585-bp fragment of an
actin by PCR. The Nematostella actin fragment shows
97% amino acid identity to Xenopus cytosolic b-actin.
The cDNA sequence of the Brachyury homolog
contains 1,763 bp. Conceptual translation of the single
open reading frame predicts a protein of 480 amino acids.
An alignment with T-domains of other Brachyury
proteins shows that the T-domain of Nematostella
Brachyury is 82% identical to that of Xenopus Brachyury
and shares all conserved motifs characteristic for
Brachyury homologs (Fig. 1A). By comparison, the
carboxyterminal activation domain shows only 21%
amino acid identity to the Xenopus protein. A phylogenetic analysis clearly shows that Nematostella Brachyury
belongs to the Brachyury subfamily of T-box proteins
(Fig. 1B). Within the Brachyury proteins, Nematostella
Brachyury clusters with other cnidarian Brachyury homologs, for instance the Hydra ortholog HyBra1 (Fig. 1B).
However, it is not closely related to a recently identified
second Brachyury gene from Hydra, HyBra2 (Technau,
unpublished data). We therefore termed the Nematostella
Brachyury gene NemBra1.
Spatial and temporal expression analysis
of NemBra1 during early embryogenesis
Embryogenesis of N. vectensis begins with two to four
rounds of radial cleavage. Cleavage then becomes
somewhat irregular until a coeloblastula has formed
about 8–10 h after fertilization. Subsequently, gastrulation
occurs by epiboly (or invagination) at one pole, forming
the blastopore. By about 24 h of development the
postgastrula has differentiated cilia on its ectodermal
layer and starts moving around as a planula larva with the
former blastopore at its posterior end. At about 7 days of
development the planula starts to metamorphose into a
primary polyp. During this process, tissue from the
Fig. 1A, B Sequence analysis of NemBra1. A Amino acid sequence alignment (ClustalW) with Brachyury T-domains of
different organisms. B Phylogenetic analysis of T-domains using
the Maximum likelihood program PUZZLE (Strimmer and von
Haeseler 1997). JTT was used as model of substitution, the
parameter alpha of the gamma distribution was 0.68 indicating a
strong rate of heterogeneity. One thousand replica calculations
were performed. Numbers are percent of statistical support (Ce
Caenorhabditis elegans, M mouse, As Halocynthia roretzi, Dm
Drosophila melanogaster, X Xenopus, Am Amphioxus, Zf zebrafish,
Pd Platynereis dumerilii, Pf Ptychodera flava, Hp Hemicentrotus
pulcherrimus, Nem Nematostella vectensis, Hy Hydra vulgaris, Trg
T-related gene (Drosophila), Pod Podocoryne carnea, He Hydractinia echinata)
566
Fig. 2 RT-PCR expression analysis with NemBra1 and Nemactin.
PCR primers for NemBra1 are flanking an intron, ruling out
contamination of cDNA with genomic DNA when the RT-PCR
produced one band in the expected size
blastopore has retracted inside the body cavity and
develops into the mouth. The first four tentacles then
develop from the outer margins of the former blastopore.
At the same time, two mesenteries (septae) form from the
endodermal cell layer starting at two opposing parts of the
blastopore, which now is more oval or slit-like. The
primary polyps are able to feed and rapidly grow to larger
sizes, developing additional mesenteries and tentacles,
always between existing ones. During growth of the
juvenile polyps retractor muscles develop on one side of
the endodermal mesenteries (Hand and Uhlinger 1992). In
adults, cells of the mesenteries also contribute to the
differentiation of gametes.
We first analyzed the temporal expression profile of
NemBra1 and Nematostella cytosolic b-actin during
embryogenesis by RT-PCR on pooled embryos of defined
stages. While Nemactin is expressed at constant levels
throughout embryogenesis including unfertilized eggs,
NemBra1 is not expressed maternally and gene expression
is first detectable at the blastula/gastrula transition and
persists until adulthood (Fig. 2). In larger juvenile polyps
that were cut in the middle of the body column, NemBra1
transcripts can be equally detected in both halves,
suggesting that expression is not restricted to one side
of the animal.
In order to analyze the spatial expression pattern of
NemBra1 we established an in situ hybridization protocol
for embryos and primary polyps of N. vectensis. In situ
hybridization shows that actin is expressed evenly in
embryos of all stages and primary polyps (Fig. 3A–D). By
comparison, no expression of NemBra1 could be detected
in early cleavage embryos and morula stages (Fig. 4A–C),
consistent with the RT-PCR data. A clear signal of
NemBra1 expression could be detected in late gastrula
and early planula larvae. The expression zone is restricted
to a circle around the blastopore of the developing larvae
(Fig. 4E, F). During metamorphosis into primary polyps
the NemBra1 expression is found in the endodermal part
of the blastopore, where it concentrates at two opposing
ends, the anlagen for the first two mesenteries (Fig. 5A).
In primary polyps, NemBra1 is expressed around the
polyp’s mouth and in the growing mesenteries, including
the progenitors of muscle tissue (Fig. 5B, C). Vibratome
cross sections of adult polyps revealed that NemBra1
Fig. 3A–E Expression of the Nematostella b-actin during embryogenesis. A Unfertilized egg, B blastula, C planula, D metamorphosing planula, E primary polyp. Stronger signals are due to
denser tissue. Bars correspond to 100 m
expression persists in the mesenteries, however, the
expression is usually restricted to one side of the twolayered mesenteries only. Expression is excluded from the
retractor muscle cells that form on one side of the
mesenteries and it is also excluded from the distal tip, the
septal filament (Fig. 5D–F).
Discussion
Homologs of the T-box gene Brachyury have been
isolated from a wide range of metazoan phyla (reviewed
in Technau 2001). We recently cloned the first Brachyury
homolog from the cnidarian Hydra (Technau and Bode
1999). The diploblastic Cnidaria evolved at least 600 million years ago and are thought to be descendents of one of
the most basal metazoans. However, no Brachyury gene
has been reported so far from the Anthozoa, which are
considered the more basal class of Cnidaria compared to
the Hydrozoa such as Hydra, Podocoryne or Hydractinia
(Bridge et al. 1992, 1995; Collins 2002).
567
Fig. 4A–F Spatial expression analysis of NemBra1 by in situ hybridization. A Eight-cell-stage embryo, B early cleavage, C blastula, D
gastrula, E planula, view on the blastopore, F planula, lateral view. Bars correspond to 100 m
No T-box genes have been reported so far from protists
and none are found in the yeast genome. Hence, it is
feasible that the T-box gene family arose with the
evolution of animal multicellularity. The anthozoan N.
vectensis is to date the most basal metazoan from which
the T-box gene Brachyury has been isolated and might
therefore give clues about the ancestral role of this gene in
metazoan evolution.
NemBra1 is more than 80% identical in the T-domain
on the amino acid level to orthologous proteins of
vertebrates. This strikingly high degree of sequence
conservation indicates that a strong selection pressure
must exist to maintain the precise structure of the Tdomain, which is the DNA-binding domain. All amino
acids that have been shown to be implicated in dimerization and DNA-binding of the T-domain of Xenopus
Brachyury (Mller and Herrmann 1997) are conserved in
NemBra1, suggesting that the NemBra1 T-domain also
functions similarly on a molecular level, i.e. that it binds
to similar binding sites on the DNA.
The comparison of basal deuterostome and protostome
primary larvae suggests that in Urbilateria Brachyury
specified the fore- and hindgut as well as parts of the
posterior mesoderm (reviewed in Technau 2001 and
references therein). This gut developed as part of the
blastopore (Arendt et al. 2001). In Hydra expression is
confined to the hypostome, the tissue surrounding the
mouth (Technau and Bode 1999). According to the
gastraea theory of Haeckel (1896), Hydra’s mouth
corresponds to the blastopore of other animals. Unfortunately, Hydra embryos gastrulate through multipolar
ingression of single cells (Martin et al. 1997), and hence
do not have a well-defined blastopore. It is therefore not
clear, how the mouth of the adult Hydra polyp relates to
the blastopore of Bilateria.
By contrast, the anthozoan Nematostella has a welldefined blastopore (Hand and Uhlinger 1992), which
marks the posterior end of the planula larva and later
develops into the mouth of the polyp. NemBra1 is
expressed continuously around the blastopore. From these
data it seems obvious that the hypostome of Hydra is a
derived structure of the blastopore. We therefore propose
that the blastoporal expression is ancestral for all
diploblasts and triploblasts. No information on Brachyury
is currently available from the sponges, so it is therefore
still unclear whether the blastoporal expression is also
ancestral for metazoans as a whole. However, given the
strong conservation of the cnidarian T-box, we also
expect the presence of Brachyury in sponges.
Interestingly, Nematostella Brachyury has a second
expression domain in the mesenteries. Mesenteries are
endodermal lappets that start developing from two
568
Fig. 5A–F NemBra1 expression in metamorphosing larvae and
polyps. A Metamorphosing planula, B primary polyp, C sense
control with primary polyp, D schematic cross-section through an
adult sea anemone (modified after Barnes 1963), E schematic
drawing of vibratome cross-section (F) through the gastric region
of a juvenile polyp showing NemBra1 expression in one of the
mesenteries. The arrow (B) indicates the polyp’s mouth opening,
the arrowheads (B) point to the first two mesenteries (ec ectoderm,
en endoderm, m mesogloea, sf septal filament, rmf retractor muscle
filament). Bars correspond to 100 m
opposing poles of the blastopore in the metamorphosing
planula larva. In these mesenteries the endodermal
retractor muscle cells of Nematostella develop. How does
the blastoporal expression relate to the muscle differentiation and to mesoderm specification? The analysis of all
larval stages in Nematostella reveals a contiguous
expression of Brachyury in the blastopore and the
developing mesenteries. It is therefore conceivable that
during bilaterian evolution the mesoderm originated from
a subpopulation of cells in the blastoporal region,
specified by Brachyury.
In all Bilateria, muscles are a major derivative of the
mesoderm and in vertebrates specification of the mesoderm by Brachyury is required for later expression of
myogenic factors (for review see Smith 1997, 1999). In
fact, ectopic expression of Brachyury in animal caps of
Xenopus embryos can induce the formation of muscle
tissue in a dose-dependent manner (O’Reilly et al. 1995).
A specification of muscle tissue by Brachyury might
therefore already exist in the diploblasts. Interestingly, in
the marine hydrozoan Podocoryne carnea, Brachyury, the
bHLH transcription factor twist, the zinc finger gene snail
and the myogenic factor mef2 are all expressed in
presumptive smooth and striated muscle cells in the
manubrium and in the bell (Spring et al. 2000, 2002). A
role of “mesodermal” and myogenic genes of Bilateria in
the differentiation of muscle tissue in diploblasts therefore
seems plausible. Yet, in adult polyps of Nematostella
Brachyury expression in the mesenteries is excluded from
the differentiated muscle tissue but present in the adjacent
tissue. Brachyury might therefore be required for the
competence of the tissue to differentiate into muscle
tissue, but in later stages of muscle differentiation.
Alternatively, Brachyury might function on a different
level. Instead of acting as a determinant of a specific type
of tissue it might have a role in morphogenetic movements involving changes in cell adhesion and cell
motility. In the sea urchin Lytechinus variegatus,
Brachyury is expressed in a dynamic manner around the
blastopore, i.e. cells of the invaginating endoderm turn on
Brachyury transiently as they are moving through the
blastopore, but turn it off as soon as they are involuted
(Gross and McClay 2001). Consistently, blocking Brachyury function results in a perturbation of gastrulation
movements in these organisms, but not in the expression
of endodermal and mesodermal marker genes (Gross and
McClay 2001). Also, in Xenopus and zebrafish, Brachyury seems to be involved in convergence and extension of
the notochord via one of its target genes, Wnt11
(Heisenberg et al. 2000; Tada and Smith 2000). Hence,
Brachyury expression in Nematostella could also reflect a
role in morphogenetic movements during gastrulation.
Studies to test these ideas are currently underway.
569
The expression pattern of NemBra1 might also have
implications for the evolution of bilaterian body axes. A
number of genes involved in anterior-posterior (AP) and
dorso-ventral (DV) axis formation in Bilateria have been
cloned from Cnidaria and some of them are expressed in a
localized manner (Schummer et al. 1992; Shenk et al.
1993; Broun et al. 1999; Technau and Bode 1999;
Hobmayer et al. 2000; Yanze et al. 2001; Hayward et al.
2002), suggesting that genes of the AP and DV axis are
present in these basal metazoans and may be involved in
the formation of the single apparent body axis in Cnidaria.
Whether this apparent body axis corresponds to the DV or
AP axis of Bilateria is unclear and a matter of debate
(Technau 2001; Meinhardt 2002). One possibility is that a
symmetry break occurred between the Cnidaria and the
Bilateria. An intermediate stage of such a symmetry break
would be a biradial pattern. In Nematostella the transition
from a radially symmetrical to a biradial pattern happens
during metamorphosis, when the circular blastoporal
Brachyury expression dissolves into two opposing expression domains, which mark the position of the first pair
of mesenteries. However, the recent identification and
expression analysis of the dpp homolog from the anthozoan coral Acropora millepora suggests that the symmetry break might already have occurred at the level of the
Anthozoa. In late gastrulae of Acropora, Am-dpp is
expressed asymmetrically at one margin of the blastopore
(Hayward et al. 2002). Anatomists have claimed for
decades that adult anthozoan polyps display features of
bilaterality: the retractor muscles in the mesenteries are
formed in an asymmetrical pattern and the slit-like mouth
has a differentiated siphonoglyph on one side (Barnes
1963). These morphological characters may be set up
during embryogenesis by genes involved in the formation
of bilaterian DV and AP axis.
Acknowledgements We would like to thank Eldon Ball and Emili
Sal for suggestions for the in situ hybridization protocol, Thomas
W. Holstein for continuous support and, together with Bert
Hobmayer, for critically reading the manuscript. This work was
funded by the DFG (TE-311–1/3).
References
Arendt D, Technau U, Wittbrodt J (2001) Evolution of the
bilaterian larval foregut. Nature 409:81–85
Barnes RD (1963) Invertebrate zoology. Saunders, Philadelphia
Bassham S, Postlethwait J (2000) Brachyury (T) expression in
embryos of a larvacean urochordate, Oikopleura dioica, and the
ancestral role of T. Dev Biol 220:322–332
Beddington RS, Rashbass P, Wilson V (1992) Brachyury – a gene
affecting mouse gastrulation and early organogenesis. Development Suppl 1992:157–165
Bridge D, Cunningham CW, Schierwater B, DeSalle R, Buss LW
(1992) Class-level relationships in the phylum Cnidaria:
evidence from mitochondrial genome structure. Proc Natl Acad
Sci 89:8750–8753
Bridge D, Cunningham CW, DeSalle R, Buss LW (1995) Classlevel relationships in the phylum Cnidaria: molecular and
morphological evidence. Mol Biol Evol 12:679–689
Broun M, Sokol S, Bode HR (1999) Cngsc, a homolog of
goosecoid, participates in the patterning of the head, and is
expressed in the organizer region of Hydra. Development
126:5245–5254
Collins AG (2002) Phylogeny of Medusozoa and the evolution of
cnidarian life cycles. J Evol Biol 15:418–432
Conlon FL, Smith JC (1999) Interference with Brachyury function
inhibits convergent extension, causes apoptosis, and reveals
separate requirements in the FGF and activin signalling
pathways. Dev Biol 213:85–100
Croce J, Lhomond G, Gache C (2001) Expression pattern of
Brachyury in the embryo of the sea urchin Paracentrotus
lividus. Dev Genes Evol 211:617–619
Fritzenwanker JH, Technau U (2002) Induction of gametogenesis
in the basal cnidarian Nematostella vectensis (Anthozoa). Dev
Genes Evol 212:99–103
Frohman MA (1995) In: Dieffenbach CW, Dveksler GS (eds) PCR
primer – a laboratory manual. CSHL, New York, pp 381–409
Grens A, Mason E, Marsh JL, Bode HR (1995) Evolutionary
conservation of a cell fate specification gene: the Hydra
achaete-scute homolog has proneural activity in Drosophila.
Development 121:4027–4035
Gross JM, McClay DR (2001) The role of Brachyury (T) during
gastrulation movements in the sea urchin Lytechinus variegatus. Dev Biol 239:132–147
Haeckel E (1896) In: Systematische Phylogenie. 2.Teil: Systematische Phylogenie der wirbellosen Thiere (Invertebrata).
Reimer, Berlin
Hand C, Uhlinger KR (1992) The culture, sexual and asexual
reproduction, and growth of the sea anemone Nematostella
vectensis. Biol Bull 182:169–176
Hayward DC, Samuel G, Pontynen PC, Catmull J, Saint R,
Miller DJ, Ball EE (2002) Localized expression of a dpp/
BMP2/4 ortholog in a coral embryo. Proc Natl Acad Sci
99:8106–8111
Heisenberg CP, Tada M, Rauch GJ, Saude L, Concha ML,
Geisler R, Stemple DL, Smith JC, Wilson SW (2000)
Silberblick/Wnt11 mediates convergent extension movements
during zebrafish gastrulation. Nature 405:76–81
Herrmann BG, Labeit S, Poustka A, King TR, Lehrach H (1990)
Cloning of the T gene required in mesoderm formation in the
mouse. Nature 343:617–622
Hobmayer B, Rentzsch F, Kuhn K, Happel CM, Cramer von
Laue C, Snyder P, Rothbcher U, Holstein TW (2000) WNT
signalling molecules act in axis formation in the diploblastic
metazoan Hydra. Nature 407:186–189
Kispert A, Herrmann BG, Leptin M, Reuter R (1994) Homologs of
the mouse Brachyury gene are involved in the specification of
posterior terminal structures in Drosophila, Tribolium, and
Locusta. Genes Dev 8:2137–2150
Kispert A, Koschorz B, Herrmann BG (1995) The T protein
encoded by Brachyury is a tissue-specific transcription factor.
EMBO J 14:4763–4772
Kusch T, Reuter R. (1999) Functions for Drosophila brachyenteron
and forkhead in mesoderm specification and cell signalling.
Development 126:3991–4003
Lartillot N, Lespinet O, Vervoort M, Adoutte A (2002) Expression
pattern of Brachyury in the mollusc Patella vulgata suggests a
conserved role in the establishment of the AP axis in Bilateria.
Development 129:1411–1421
Martin VJ, Littlefield CL, Archer WE, Bode HR (1997) Embryogenesis in Hydra. Biol Bull 192:345–363
Meinhardt H (2002) The radial-symmetric hydra and the evolution
of the bilateral body plan: an old body became a young brain.
BioEssays 24:185–191
Mller CW, Herrmann BG (1997) Crystallographic structure of the
T domain-DNA complex of the Brachyury transcription factor.
Nature 389:884–888
O’Reilly MA, Smith JC, Cunliffe V (1995) Patterning of the
mesoderm in Xenopus: dose-dependent and synergistic effects
of Brachyury and Pintallavis. Development 121:1351–1359
570
Peterson KJ, Cameron RA, Tagawa K, Satoh N, Davidson EH
(1999a) A comparative molecular approach to mesodermal
patterning in basal deuterostomes: the expression pattern of
Brachyury in the enteropneust hemichordate Ptychodera flava.
Development 126:85–95
Peterson KJ, Harada Y, Cameron RA, Davidson EH (1999b)
Expression pattern of Brachyury and Not in the sea urchin:
comparative implications for the origins of mesoderm in the
basal deuterostomes. Dev Biol 207:419–431
Schummer M, Scheurlen I, Schaller C, Galliot B (1992) HOM/
HOX homeobox genes are present in hydra (Chlorohydra
viridissima) and are differentially expressed during regeneration. EMBO J 11:1815–1823
Shenk MA, Bode HR, Steele RE (1993) Expression of Cnox-2 a
HOM/HOX homeobox gene in hydra, is correlated with axial
pattern formation. Development 117:657–667
Shoguchi E, Satoh N, Maruyama YK (1999) Pattern of Brachyury
gene expression in starfish embryos resembles that of hemichordate embryos but not of sea urchin embryos. Mech Dev
82:185–189
Smith J (1997) Brachyury and the T-box genes. Curr Opin Gen Dev
7:474–480
Smith J (1999) T-box genes: what they do and how they do it.
Trends Genet 15:154–158
Smith JC, Price BM, Green JB, Weigel D, Herrmann BG (1991)
Expression of a Xenopus homolog of Brachyury (T) is an
immediate-early response to mesoderm induction. Cell 67:79–
87
Spring J, Yanze N, Middel AM, Stierwald M, Groger H, Schmid V
(2000) The mesoderm specification factor twist in the life cycle
of jellyfish. Dev Biol 228:363–375
Spring J, Yanze N, Josch C, Middel AM, Winninger B, Schmid V
(2002) Conservation of Brachyury, Mef2, and Snail in the
myogenic lineage of jellyfish: a connection to the mesoderm of
Bilateria. Dev Biol 244:372–384
Strimmer K, von Haesseler A (1997) Likelihood-mapping: a simple
method to visualize phylogenetic content of a sequence
alignment. Proc Natl Acad Sci 94:6815–6819
Tada M, Smith JC (2000) XWnt11 is a target of Xenopus
Brachyury: regulation of gastrulation movements via dishevelled, but not through the canonical Wnt pathway. Development 124:2225–2234
Tagawa K, Humphreys T, Satoh N (1998) Novel pattern of
Brachyury gene expression in hemichordate embryos. Mech
Dev 75:139–143
Takada N, Goto T, Satoh N (2002) Expression pattern of the
Brachyury gene in the arrow worm Paraspadella gotoi
(Chaetognatha). Genesis 32:240–245
Technau U (2001) Brachyury, the blastopore and the evolution of
the mesoderm. BioEssays 23:788–794
Technau U, Bode HR (1999) HyBra1, a Brachyury homolog, acts
during head formation in Hydra. Development 126:999–1010
Wilkinson DG, Bhatt S, Herrmann BG (1990) Expression pattern of
the mouse T gene and its role in mesoderm formation. Nature
343:657–659
Yanze N, Spring J, Schmidli C, Schmid V (2001) Conservation of
Hox/Parahox-related genes in the early development of a
cnidarian. Dev Biol 236:89–98
Yasuo H, Satoh N (1998) Conservation of the developmental role
of Brachyury in notochord formation in a urochordate, the
ascidian Halocynthia roretzi. Dev Biol 200:158–170