Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Reading DNA and Mutations Activity 1. 2. 3. 4. 5. Split into 2 groups Take a big piece of paper Record your DNA sequence Make Amino Acids Make Proteins DNA Amino Acid Protein A DNA SENTENCE! • Here's the sequence: GCATGCTGCGAAACTTTGGCTGA Separate into Codons • First, try separating the sequence into three-letter codons. Codons • You can do this three ways: GCA TGC TGC GAA ACT TTG GCT GAG CAT GCT GCG AAA CTT TGG CTG AGC ATG CTG CGA AAC TTT GGC TGA Where did you start? • How can you tell which of the three codon "reading frames" is the correct one? • All genes begin with the three-letter sequence "ATG," which encodes the amino acid methionine (Met). Therefore, the correct reading frame will contain the codon "ATG." Amino Acids • Review "What is the Universal Genetic Code?" on the right side of this page. • Then use the Code, shown below, to determine the amino acid sequence • Once you've translated the DNA sequence, go back and try to make each of the mutations discussed at right. Order • • • • DNA Codons (start at Met – ATG) Amino Acids Protein Mutation Types Point mutations are single nucleotide base changes in a gene's DNA sequence. : Insertion mutations and deletion mutations add or remove one or more DNA bases. This type of mutation can change the gene's protein product in the following ways: • Missense mutations are point mutations that result in a single amino acid change within the protein. • Nonsense mutations are point mutations that create a premature "translation stop signal" (or "stop" codon), causing the protein to be shortened. • Silent mutations are point mutations that do not cause amino acid changes within the protein. • Insertion and deletion mutations cause frameshift mutations, which change the grouping of nucleotide bases into codons. • This results in a shift of "reading frame" during protein translation. MUTATE A DNA SENTENCE! • It's time to try your hand at mutating a DNA sequence. • Here's the sequence: GCATGCTGCGAAACTTTGGCTGA Mutation Effects Missense mutation: • What does a missense mutation look like? • How does it change the amino acid sequence? Nonsense Mutation: • What does a nonsense mutation look like? • How does it change the amino acid sequence? Frame Shift: • You can make more than one frameshift mutation. • What do they look like? • How do they change the amino acid sequence? • Notice how a single amino acid can be encoded by a number of different codons. • What are some examples of silent mutations in the DNA sequence?