Download Last5

Species complex
Chapter 13
• What is a species?
• Morphology, phylogenetic distinctiveness, ecology
• Reproductive continuity (rem: definitions of populations)
• We discuss multiple species (evolutionary units) even if
not "biological species"
• A very typical problem evolutionary biologists face
Implies chromosomal
similarity
• Remember: humans and
chimps very similar at
sequence level, but 1000s of
genes have been gained/lost
between the two through
duplication
• Hybridization referring to our
close ancestors could have
been possible, assuming
reconstruction of Neanderthal
genome correct
isolation-migration models
• IMAGINE: two species that you are
studying with genetic markers, and
you find out that they share some
alleles
• how is that possible???
• 1. clearly they hybridized, OMG,
gross
• 2. or, diversity from the ancestral
population has not yet been fixed for
alternate alleles in the 2 populations
• coalescent theory lets us calculate
these probabilities, and allow for
isolation NOT being immediate
And of course
often outbreeding
has fitness
consequences
Coalescent
simulations
• Recover possible historical scenario
by simulation
• Ancestral diversity, current diversity,
migration easy to simulate: does
SIMULATED DNA carry same
pattern as empirical data? If not,
reject...if yes, consider as one
possibility
• Easier to reject unlikely hypotheses
than separate all likely hypotheses,
increasing data helps
• may include effects of migration,
change in population size,
bottlenecks, and so on
Population expansion IN GENERAL:
Series of bottlenecks, reduced
diversity
Mutation,
drift,
and
migration
300,000 markers
reach equilibria that allow
Cluster analysis recapitulates inference of past migration and
migration distances
interbreeding
Ah to be alive
on a mid-September morn
fording a stream
barefoot, pants rolled up,
holding boots, pack on,
sunshine, ice in the shallows,
northern rockies.
Rustle and shimmer of icy creek waters
stones turn underfoot, small and hard as toes
cold nose dripping
singing inside
creek music, heart music,
smell of sun on gravel.
I pledge allegiance
I pledge allegiance to the soil
of Turtle Island,
and to the beings who thereon dwell
one ecosystem
in diversity
under the sun
With joyful interpenetration for all.
Gary Snyder
More than Feet...
• We are brains, language, art,
emotion
• “There are many competing
hypotheses for why we are the
last hominins left on Earth...”Zimmer
and Emlen
• We are monotypic - nothing else
quite like us.
Dolphin brains
• we aren’t the only species with large brains
• ...what is it about our brain that (we think) makes us so
different?
•
The discovery of spindle cells (neurons without extensive branching, known also as "von Economo neurons", or VENs) in the brains of the humpback whale,
fin whale, sperm whale, killer whale,[15][16] bottlenose dolphins, Risso's dolphins, and beluga whales[17] is another unique discovery. Humans, the great
apes, and elephants, species all well known for their high intelligence, are the only others known to have spindle cells[18](p242). Spindle neurons appear to
play a central role in the development of intelligent behavior. Such a discovery may suggest a convergent evolution of these species.[19]
art
• figurative art begins to appear in the fossil record around
40,000 years ago
• we are a visual species: reduced
reliance on olfactory sense
• apes have a duplicated opsin gene
lacking in other primates, has evolved
into color vision
• may be key event in identifying ripe/safe food: overall
reliance on vision
trichromatic vision is a complex adaptation
• as so often happens, it is a gene duplication that allowed
it
language
• when traits are shared, that is evidence
of recent common ancestry
• traits that vary between groups are
evidence of ancient common ancestry
• culture evolves under similar rules as
mutations in a gene
• linguistic similarities and differences
evolve temporally
• processes of mutation and drift, nonrandom people with whom we share
culture: assumptions about evolutionary
models can apply to culture
Mutation,
drift,
and
migration
300,000 markers
reach equilibria that allow
Cluster analysis recapitulates inference of past migration and
migration distances
interbreeding
how has selection continued to change us?
• as populations continue to find new habitats to live in,
there are signs of adaptation
• rare alleles at EPAS1 locus found primarily in
Tibetans: allow better survival at high altitude
• lactase persistence: allow additional calorie source to
pastoral communities
• modern world may be relaxing selection in other ways
traits being selected
• often involve life
history traits: age at
first reproduction,
body mass index,
physiology, and tradeoffs of these
• remember: selection
context-specific,
may be different in
different locations,
cultures...
emotion
• text: emotion causes motivation; motivation helps mammals
reach goals such as food or mates
• traits of emotion coincide with development of particular
neuronal structures, particular hormonal pathways (expressed
proteins)
• Sanger-Schachter theory of emotion: emotion is a function
both of cognition (thought) and physiological state
• these lead to the bonds we form: we know that oxytocin
(involved in maternal bonding/imprinting with offspring) and
vasopressin are two key players
on the topic of
love...
some mutations
change the length of a
particular fragment, and
can have major
phenotypic results
ctttcgatctctctctctctcgatac......
ctttcgatctctctctctctctctctcgatac
• simple sequence repeats (SSR) loci have
motifs (“words”) that can easily mutate during
replication
• strand
slippage, increase or decrease
number motifs
• not
often within genes, but in non-coding
regions that influence expression (e.g.
between promoter region and gene)
promoter
ctttcgatctctctctctctcgatac
promoter
ctttcgatctctctctctctctctctctcgatac
gene
gene
• proximity
of promoter region influences rate
of transcription (and thus amount of product)
• in
voles (and other mammals, it seems) can
affect number of vasopressin receptors in
brain
• more
vasopressin
receptors in prairie vole
more monogamy and social care by males
• fewer
receptors in meadow vole - more
promiscuity, and behavior can be changed by
providing additional receptors
expression is
behavior
• vasopressin receptor
has variable
expression across
species
• higher levels of
expression associated
with strong pairbonding (approaching
monogamy)
• experimentally
increasing expression
yes
• the homologous - orthologous - system works the same
way in humans. homozygotes for particular allele
classes have less persistent relationships
• as with MHC diversity influencing mate choice, our
genes and simple physiological and genomic
upregulation - out of our control - control much of what
we do!
mhc
•
MHC molecules “show”
processed proteins on
cell surface
•
immune system
responds (usually to your
benefit)
•
extreme diversity at this
locus: why?
molecule with benefits
•
diversity allows presentation/recognition of
diverse pathogen/foreign material (helps
immune system clear body of disease)
•
greater diversity, better presumed immune
response
•
•
(heterosis, overdominance: two forms
of increased fitness with heterozygosity)
so life (vertebrates) might act to increase
diversity somehow?
old shirts and
mate choice
•
Wedekind study: MHC
dissimilar mates
preferred?
•
T-shirts worn by guys,
presented to women - all
genotyped at MHC loci
•
greatest mismatch at
genotype (different
alleles) = greatest
“attraction”
being unusual and mating
Incongruity of primate species tree and DQA1
MHC-promoter
related region
gene gene tree.
Loisel D A et al. PNAS 2006;103:16331-16336
©2006 by National Academy of Sciences