Download Tiger Trade

Name ___________________________________ Class _______ Date ______________
Tiger Trade
Use modern molecular biology lab techniques
to determine if parts of a critically endangered
species are being traded illegally.
Lab Bench Used
Molecular biology techniques such as DNA sequencing are important tools for
enforcing laws that protect threatened or endangered species. Just as human tissue
collected at a crime scene can yield DNA “fingerprints” that can be used to identify
victims and suspects, unidentifiable animal tissues such as dried shark fins, powdered
mammal bone and teeth, and dried internal organs can be analyzed to determine if
they were taken from protected species.
In this virtual lab activity you will act as a wildlife forensic specialist. You will
use DNA sequencing to determine if parts of tigers—carnivores protected by laws in
some countries—are being illegally traded.
Enter the Virtual Bio Lab and select the title of this lab activity from the “DNA”
menu on the whiteboard. You will be taken to the virtual Molecular lab bench.
The Case
The tiger is a large and critically endangered predatory cat. It is endangered due to
habitat loss and also in large part because there is high demand for its bones, teeth,
organs, and skin for use in traditional medicines in parts of Asia. Governments have
restricted and in many cases outlawed this trade, but the black market for tiger parts
remains strong.
Your wildlife forensics lab has received unidentified samples of powdered
mammalian teeth and bone that were confiscated from luggage at international
airports in and around Southeast Asia. Your task is to compare DNA sequences
extracted from the physical evidence with DNA that you know was sampled from a
tiger. If there are any matches, you will know that tiger tissues are being traded.
Choose the "DNA from Mammal Bone and Tooth Samples" preset from the
clipboard on the right side of the lab bench. You will see DNA samples taken from
unidentified mammalian bone samples loaded into three microcentrifuge tubes in the
tube rack. There is also a fourth tube with DNA extracted from powdered teeth of
similarly unknown origin. Roll over the tubes to review their contents. The
polymerase reagents “Taq” and “dNTPs tag” have already been added to these
samples.
Part A: DNA Preparation
Use the following procedures to complete the investigation.
 Prepare a tube for tiger DNA. Drag an empty microcentrifuge tube from the jar
to the tube rack. Hover over the tube and then click in the blank gray box on the
face of the tube rack so you can label the tube. Use “Tiger DNA” or something
similar as your label.
 Load the tiger DNA. In the Species Selector, the tiger will already be selected for
you. Click on the pipette icon below the species list. You now have a pipette
loaded with tiger DNA. Hover over your newly labeled tiger DNA tube until the
pipette straightens up. Click to put the DNA into the tube. Once the pipette is
Copyright © Pearson Education, Inc., or its affiliates. All Rights Reserved.
Virtual Bio Lab
1
DNA: Tiger Trade
Name ___________________________________ Class _______ Date ______________
leaning to the right, you’ll know that the DNA is in the tube. Here is an image
showing the three positions of the pipette and what they indicate:
You can also lift the tube to see that it now contains a translucent blue fluid.
 Add reagents to the tiger DNA tube. Add “Taq” and “dNTPs tag” to your tiger
DNA tube. Do this by clicking on the Taq jar, which will give you a loaded
pipette, and then hovering over the tube and clicking as you did with the DNA
pipette to insert the reagent into the tube. Do the same with “dNTPs tag.” (Do not
add “dNTPs.”) These PCR reagents have already been added to the other tubes.
 Add primers to all your tubes. You will now select primers that are specific to
the ATP6 gene, which will serve as the point of comparison between your tiger
DNA sample and the DNA extracted from the unidentified samples. Click on the
small projector behind the tube rack to open the primer controls. For each of the
primers shown below, select it in the list, click the pipette icon beneath the list,
and use the loaded pipette to add that primer to each tube in the rack. Be sure to
reload the primer pipette before adding to the next tube. To reload, simply click
the pipette’s tip on the pipette icon below the list of primers. Be sure to add both
primers to all of the tubes!
Left primer
atgaacgaaaatctattcacc
Right primer
ttaagtattatcatgtaa
 Use PCR to amplify the ATP6 gene from each DNA sample. Drag each tube
into the PCR machine. Close the lid and click the green arrow to start running the
machine. This process, called polymerase chain reaction (PCR), makes multiple
copies of the particular gene you are targeting—in this case ATP6. PCR takes a
while, so click on the arrows on the main lab clock to advance time by a little
more than three hours. You will now see that the PCR reads “complete,” and that
35 cycles have been performed. Drag the tubes back to the tube rack.
Part B: DNA Sequencing
Now it’s time to sequence your amplified ATP6 gene samples. You will first
sequence the tiger's gene and then sequence the genes from the unidentified samples.
 Sequence the tiger DNA sample. Drag the tube near the sequencer drawer,
which is has a square outline on the lower edge of the face of the sequencer. The
sequencer drawer will open whenever you drag a tube nearby. Drop the tube into
the open slot, and click the drawer to close it. The sequencer controls window will
open automatically. Click “Start” to begin the process of sequencing the sample.
Again, this is a process that takes quite a bit of time in a real molecular biology
lab, so use the arrows on the clock to advance time. Ten hours should do it.
Copyright © Pearson Education, Inc., or its affiliates. All Rights Reserved.
Virtual Bio Lab
2
DNA: Tiger Trade
Name ___________________________________ Class _______ Date ______________
 Label and save the sequence. During or after the sequencing process, click on
the sequence to highlight it and then click on the field above it where you can give
the sequence a title such as “Tiger DNA ATP6 Sequence.” Once you have
completed writing a title, click “Save.” The virtual lab book now has your tiger
DNA ATP6 sequence saved. It will remain there until you delete it from the lab
book or end this Virtual Bio Lab session.
 Sequence the unknown DNA samples. Repeat the last two steps with the other
four samples. Be sure to title the sequences so you know which DNA sample—
which part of the forensic evidence—these different ATP6 gene sequences came
from. Don’t forget to save each sequence to the lab book.
Part C: Sequence Comparison
In the virtual lab book you can compare your standard tiger ATP6 gene sequence
with the ATP6 sequences from the four unknown samples.
 Organize the sequences in one place. To do this, open the first unknown bone
sequence (click on the ATCG icon), click on that sequence to highlight it, then
right-click and select "copy data." Make sure you’ve highlighted the whole
sequence, and not just a single nucleotide or two. Now, open the tiger sequence,
click in the empty white space below the sequence, and right-click "paste" to
paste the other sequence below the tiger’s sequence. You should now see the first
unknown bone ATP6 sequence beneath the tiger ATP6 sequence. Repeat this
process with the other three unknown sequences until all four unknown sequences
are pasted into the same page as the tiger sequence.
 Compare sequences. Compare the four unidentified sequences with the tiger
sequence. To do this, click on the tiger sequence, hold down the command or
control button on the keyboard, and click on another sequence. Both sequences
should now be highlighted in yellow. Now, click on the "differences" button.
Nucleotides that don’t match between the two sequences will be highlighted in
gray. (You can also highlight all five sequences and compare them all at once.
Sequences that differ from the topmost sequence will have gray-highlighted
nucleotides.)
 Draw conclusions. If there are any differences between an unknown sample’s
ATP6 sequence and the tiger ATP6 sequence, the DNA extracted from the sample
probably belongs to something other than a tiger, such as some other type of cat
or some other mammal entirely. A match, however, suggests that the sample is
indeed from a tiger, and tiger parts are being traded illegally.
1. Based on your DNA sequence analysis of the four suspected tiger samples, can
you infer that tiger parts are being traded? Explain.
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
Copyright © Pearson Education, Inc., or its affiliates. All Rights Reserved.
Virtual Bio Lab
3
DNA: Tiger Trade
Name ___________________________________ Class _______ Date ______________
2. Specifically, within the first 40 base pairs of the sequences, where do the non-matching
sequences differ with the tiger’s? Refer to each non-matching nucleotide by its number in the
sequence. Nucleotides 20 and 40 are labeled.
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
Copyright © Pearson Education, Inc., or its affiliates. All Rights Reserved.
Virtual Bio Lab
4
DNA: Tiger Trade