Download Murine gammaherpesvirus 68 open reading frame 35 is required for

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Cell culture wikipedia, lookup

List of types of proteins wikipedia, lookup

Amitosis wikipedia, lookup

Interferon wikipedia, lookup

JADE1 wikipedia, lookup

Transcript
1
Murine gammaherpesvirus 68 open reading frame 35 is required for efficient lytic
2
replication and latency
3
4
Running title: Characterization of MHV68 ORF35
5
6
The Contents Category for the paper: Animal Viruses – Large DNA
7
8
Shin-ichi Hikita, Yusuke Yanagi, and Shinji Ohno
9
10
Department of Virology, Faculty of Medicine, Kyushu University, Fukuoka 812-8582,
11
Japan
12
13
#
14
Mailing address
15
Shinji Ohno
16
Department of Virology, Faculty of Medicine, Kyushu University, Fukuoka 812-8582,
17
Japan; TEL: +81-92-642-6138 / FAX: +81-92-642-6140;
18
E-mail: [email protected]
Corresponding author:
19
20
21
22
23
24
25
26
Summary: 231 words, Text: 4872 words,
Tables and figures : 7
27
SUMMARY
28
Murine gammaherpesvirus (MHV) 68, a natural pathogen of field mice, is related to
29
human gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated
30
herpesvirus (KSHV). The open reading frame (ORF) 35 of MHV68 and its homologues
31
of EBV and KSHV are located in the gene cluster composed of ORF34 to ORF38 in
32
which each gene overlaps with adjacent ones. Although MHV68 ORF35 was reported to
33
be an essential gene, its function during infection is presently unknown. In this study, we
34
show, by analyzing ORF35-transfected cells, that three serine residues in the C-terminus
35
are responsible for the phosphorylation, and that the ORF35 protein forms
36
homo-oligomers via a predicted coiled-coil motif. The ORF35 protein expressed by
37
transfection was preferentially located in the cytoplasm of cells uninfected or infected
38
with MVH68. The recombinant virus lacking ORF35 (35S virus) exhibited the genome
39
replication and expression of lytic proteins comparable to those of the wild-type (WT)
40
virus, but reduced levels of virus production, suggesting that the ORF35 protein acts at
41
the virion assembly and/or egress step. Lytic replication in the lung after intranasal
42
infection and the frequency of ex vivo reactivation from latency after intraperitoneal
43
infection were lower in 35S virus-infected mice than those in mice infected with the WT
44
or marker-reverted virus. Our results indicate that ORF35 is not essential for MHV68
45
lytic replication, but plays an important role in efficient viral replication and reactivation
46
from latency.
47
48
49
50
51
52
INTRODUCTION
Human gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's sarcoma
53
associated virus (KSHV), are involved in a number of malignant diseases. EBV causes
54
Burkitt's lymphoma, Hodgkin lymphoma, nasopharyngeal carcinoma, and gastric
55
carcinoma (Burke et al., 1990; Epstein et al., 1964; Longnecker et al., 2013; Nonoyama
56
et al., 1973; Weiss et al., 1987), whereas KSHV is a causative agent of Kaposi's sarcoma,
57
multicentric Castleman's disease, and primary effusion lymphoma (Chang et al., 1994;
58
Damania & Cesarman, 2013; Said et al., 1996; Soulier et al., 1995). The narrow host
59
range of EBV and KSHV makes it difficult to study molecular mechanisms of their lytic
60
replication and latency in experimental animals.
61
Murine gammaherpesvirus (MHV) 68, isolated from field mice such as bank
62
voles and wood mice (Blaskovic et al., 1980), is a member of 2-herpesviruses (or
63
Rhadinovirus) and shares sequence homology with the human gammaherpesviruses
64
(Efstathiou et al., 1990; Virgin et al., 1997). Because of the biological and genetic
65
similarity, MHV68 infection is considered to be a useful animal model of human
66
gammaherpesviruses (Barton et al., 2011; Simas & Efstathiou, 1998). In addition,
67
MHV68 lytically infects cells of various species (Svobodova et al., 1982), allowing us to
68
study the lytic infection of gammaherpesviruses.
69
MHV68 has at least 80 genes (Virgin et al., 1997), and shares many genes
70
involved in DNA replication and virion assembly with other herpesviruses (Dunn et al.,
71
2003; Virgin et al., 1997; Yu et al., 2003). The open reading frame (ORF) 35 is
72
conserved among gammaherpesviruses including KSHV (Russo et al., 1996), herpesvirus
73
saimili (Albrecht et al., 1992), EBV (Baer et al., 1984), and equine herpesvirus 2 (Telford
74
et al., 1995). The ORF35 gene has been shown to be essential for MHV68 lytic infection,
75
by a signature-tagged mutagenesis screening (Song et al., 2005), but its function in
76
MHV68 replication has not been determined.
77
Although KSHV ORF35 protein is predominantly localized in the cytoplasm
78
(Masa et al., 2008), its role during lytic infection is also poorly understood. In herpes
79
simplex virus (HSV)-1 and -2, UL14, a homologue of ORF35 (Dolan et al., 1998;
80
McGeoch et al., 1988; Mills et al., 2003), exists as a minor component of the virion
81
particle (Cunningham et al., 2000; Wada et al., 1999) and exerts multiple functions
82
including apoptosis inhibition (Yamauchi et al., 2003) and chaperone activity (Yamauchi
83
et al., 2002). An HSV-1 UL14 mutant virus exhibits lower growth efficiency in vitro and
84
lower pathogenicity in experimental mice (Cunningham et al., 2000).
85
In this study, we characterized the properties of MHV68 ORF35. Our results
86
show that ORF35 is not essential for MHV68 replication but plays an important role after
87
the expression of late viral proteins. Intranasal infection of mice with MHV68 lacking
88
ORF35 resulted in lower virus yield during acute replication in the lung. Further, the
89
mutant virus had a defect in reactivation from infected splenocytes.
90
91
92
RESULTS
93
ORF35 is a phosphorylated protein.
94
To characterize the ORF35 protein, we prepared a plasmid expressing ORF35 tagged
95
with the Flag epitope at the N-terminus. Immunoblotting analysis with anti-Flag antibody
96
revealed two specific bands at 26 kD and 28 kD in transfected HEK293T cells (Fig. 1a).
97
We then examined three ORF35 mutants in which 25, 32, or 55 residues from the
98
C-terminus were truncated (C25, C32 and C55) (Fig. 1b and 1c). C25 exhibited two
99
bands like the full-length ORF35, while only a single band was detected in C32- or
100
C55-expressing cells (Fig. 1c). MHV68 ORF35 includes 11 serine and 4 threonine
101
residues which are predicted to be phosphorylated when analyzed by NetPhos 2.0 Server
102
(Center for Biological Sequence Analysis, Technical University of Denmark
103
[http://www.cbs.dtu.dk/services/NetPhos/]) (Fig. 1b). As both C32 and C55 lacked
104
three serine residues at positions 124, 126, and 129 which were phosphorylation
105
candidates (Fig. 1b), we hypothesized that the upper band of full-length ORF35 could be
106
caused by phosphorylation at these serine residues. We constructed the AAA mutant that
107
has all of the three serine residues replaced with alanine. As expected, the AAA mutant
108
gave a single band with the similar molecular weight to that of the lower band of the
109
full-length ORF35 (Fig. 1d), indicating that the upper band is a phosphorylated ORF35 at
110
these serine residues. We evaluated which serine residues of the three were important for
111
the phosphorylation, but the results indicated that all of the three serine residues influence
112
the phosphorylation status to some extent (data not shown). To examine the involvement
113
of other residues in the phosphorylation, we treated the full-length ORF35 or the AAA
114
mutant with alkaline phosphatase. The treatment diminished the upper band of the
115
full-length ORF35 (Fig. 1d). However, the phosphatase did not affect the mobility of the
116
26kD bands of the full-length ORF35 and the AAA mutant, indicating that the three
117
serine residues are solely responsible for the phosphorylation of ORF35.
118
119
A putative coiled-coil motif in ORF35 mediates homo-oligomerization.
120
MHV68 ORF35 protein is predicted to have two coiled-coil motifs (amino acid positions
121
41-73 and 100-112) according to ISREC-Server (SIB ExPASy Bioformatics Resources
122
Portal [http://embnet.vital-it.ch/software/TMPRED_form.html]) (Fig. 2a). As the motif is
123
known to mediate protein-protein interactions, we investigated the oligomer formation of
124
the ORF35 protein. Co-immunoprecipitation (Co-IP) assay using Flag- and HA-tagged
125
ORF35 proteins revealed the interaction between ORF35 proteins (Fig. 2b lane 2 and Fig.
126
2c lane 2). To determine the region(s) responsible for the interaction, we prepared a series
127
of the N- or C-terminus truncated mutants (N17, N26, N33, N56, N76, C16,
128
C25, C32, and C55), and investigated the interaction between the full-length ORF35
129
and each of the truncation mutants or the AAA mutant. The results showed that the
130
residues at positions 34 to 76 were critical, but the phosphorylation was dispensable, for
131
the interaction (Fig. 2b and 2c). Similar results were obtained by Blue-Native (BN)
132
polyacrylamide gel electrophoresis (PAGE). The full length ORF35 and N17, N26 and
133
N33 mutants exhibited two bands around 18 kD and 66 kD likely corresponding to
134
monomer and multimer forms, respectively (Fig. 2d). N56 had the diminished band
135
around 66 kD and formed much smaller complexes. Truncation of N-terminus 76
136
residues almost abolished the complex formation (Fig. 2d). The data implicate the first
137
predicted coiled-coil motif at positions 41 to 73 in oligomer formation of ORF35.
138
Interestingly, the C-terminus truncation mutants tended to efficiently make complexes for
139
unknown reasons (Fig. 2c).
140
141
Repeats of 7 amino acid residues, usually expressed as (a-b-c-d-e-f-g)n , are required to
142
form the coiled-coil motif. In general, nonpolar residues at positions a and d facilitate
143
hydrophobic interactions, whereas polar residues at positions e and g provide binding
144
specificity through electrostatic interactions (Fig. 2a). We analyzed the importance of the
145
charged residues at positions e and g for oligomerization using three substitution mutants;
146
K44E/E49R, R56E/H58E/E63R, and K105E/E107R (Fig.2a). By Co-IP assay, we found
147
that the K44E/E49R and R56E/H58E/E63R exhibited reduced ability to oligemerize with
148
the full-length ORF35, whereas the K105E/E107R still interacted efficiently (Fig. 2c).
149
Taken together, the charged amino acid residues in the first putative coiled-coil motif are
150
likely critical for the homo-oligomerization of the ORF35 protein.
151
152
ORF35 is mainly localized in the cytoplasm.
153
Next, we performed immunofluorescence staining to investigate the subcellular
154
localization of ORF35. When expressed by plasmid-mediated transfection, Flag-ORF35
155
was localized predominantly in the cytoplasm, and only a small part was detected in the
156
nucleus (Fig. 3a and 3b). ORF35-HA and the AAA mutant were also similarly distributed
157
(data not shown). This pattern of the subcellular distribution is similar to that of KSHV
158
ORF35 in transfected cells (Masa et al., 2008). Further, the localization of Flag-ORF35
159
expressed by transfection was not affected by MHV68 infection (Fig. 3b and 3c).
160
161
ORF35 is required for efficient replication in vitro.
162
To examine the role of ORF35 in the life cycle of MHV68, we constructed a bacterial
163
artificial chromosome (BAC) clone encoding the ORF35 stop mutant (35S) virus, which
164
possesses an ectopic stop codon, a frameshift mutation, and a SacI recognition site after
165
the overlapping sequence with ORF34 (Fig. S1a). We also produced a BAC clone to
166
generate the recombinant virus expressing unphosphorylated ORF35 (AAA virus) (Fig.
167
1d). Restriction enzyme digestion and agarose gel electrophoresis confirmed the expected
168
structures for these BAC-cloned genomes (Fig. S1b).
169
170
ORF35 has been reported to be an essential gene (Song et al., 2005). However, NIH3T3
171
cells transfected with BAC-35S developed cytopathic effect (CPE) (data not shown),
172
suggesting that the gene may not be an essential gene. There was no unexpected mutation
173
in the targeted region of the virus genome in the infected cells (data not shown). We also
174
excluded the contamination of 35S with the WT virus, by SacI digestion (Fig.S1c). The
175
SacI marker-reverted (35R) virus and the AAA virus were also recovered without
176
difficulty. After removal of the BAC cassette, all these viruses were used for further
177
experiments.
178
179
Next, we analyzed the growth of the recombinant viruses. The titers of the cell-associated
180
and cell-free 35S virus were around 20-30 times lower than those of WT virus at later
181
time points regardless of M.O.I. (Fig. 4a and 4b). On the other hand, the yield of the 35S
182
virus in NIH3T3/F35 cells stably expressing Flag-ORF35 (Fig S2) was several times
183
higher than that in parental NIH3T3 cells (Fig. 4c), indicating that ORF35 is indeed
184
required for efficient virus growth. Further, the 35R virus exhibited growth kinetics
185
closely similar to WT virus, ascertaining that the attenuated growth of the 35S virus was
186
not due to unexpected mutations in other genes. The phosphorylation of ORF35 appears
187
to exhibit no effect on virus growth, as the AAA virus grew as efficiently as WT and 35R
188
viruses (Fig. 4a and 4b). Taken together, the data indicate that ORF35 is necessary for
189
efficient virus growth.
190
191
The 35S virus exhibits normal genome replication and lytic protein expression.
192
To determine which step(s) in replication of 35S virus was disturbed, we analyzed the
193
genome replication in virus-infected cells. In WT virus-infected cells, the amount of the
194
viral genome at 24 h after infection was around ten times higher than that at 3 h after
195
infection (Fig. 5a). When infected cells were treated with phosphonoacetic acid (PAA), a
196
viral DNA polymerase inhibitor, no genome replication was observed, as expected. All of
197
35S, 35R, AAA and WT viruses exhibited similar levels of the genome amplification
198
(Fig. 5a), indicating that ORF35 does not function before the DNA replication step.
199
200
Next, the expression of virus proteins in infected cells was also analyzed. In WT
201
virus-infected cells, many peptide bands were detected with anti-MHV68 serum at 24 h
202
after infection, and most of them disappeared when the cells were treated with PAA (Fig.
203
5b). Thus, most of the signals seen in WT virus-infected cells were likely viral late
204
proteins, as the expression of these proteins is known to be dependent on viral DNA
205
replication (Johnson & Everett, 1986; Mavromara-Nazos & Roizman, 1987). In 35S
206
virus- or AAA virus-infected cells, the pattern and intensity of the bands detected were
207
almost identical to those in WT virus-infected cells. The data indicate that the lack of
208
ORF35 does not affect the expression of late proteins.
209
210
ORF35 is needed for efficient lytic replication and latency in mice.
211
To examine the growth of recombinant viruses in vivo, anesthetized C57BL/6 mice were
212
intranasally infected with them, and virus titers in the lung were determined at 3 and 6
213
days post-infection. At each time point, the titer of the 35S virus was more than hundred
214
times lower than that of the WT virus, whereas 35R and AAA viruses grew comparably
215
to the WT virus (Fig.6a). The data indicate that ORF35 plays an important role in
216
efficient virus production in vivo. Again, there was no apparent effect of the ORF35
217
phosphorylation on lytic replication in vivo.
218
219
Next, we examined infected mice at the latent phase of infection. Splenomegaly as
220
evaluated by spleen weight, viral genomic copy number in splenocytes, and the frequency
221
of ex vivo reactivation from splenocytes were analyzed at 17 and 24 days after infection.
222
The mean spleen weight of 35S virus-infected mice was lower than that of WT, 35R, or
223
AAA virus-infected mice at 17 and 24 days after intranasal infection (though not
224
statistically significant at the latter time point), possibly reflecting reduced growth of the
225
35S virus in the lung. By contrast, the difference in spleen weight was not observed
226
among mice infected intraperitoneally with these 4 types of viruses (Fig. 6b). The mean
227
genome copy number of 35S virus-infected mice was significantly reduced as compared
228
with that of mice infected with the other types of viruses after intranasal infection (Fig.
229
6c). Again, the difference was not observed when mice were infected intraperitoneally
230
with these viruses. The data indicate that the 35S virus is able to establish latent infection
231
in the spleen almost as efficiently as the WT virus when inoculated intraperitoneally.
232
Notably, the reactivation frequency of the 35S virus was below the detection limit
233
independent of the route of infection (Fig. 6d), indicating that the 35S virus could not be
234
reactivated from the latent state. As preformed infectious viruses in disrupted splenocytes
235
were below the detection limit for any mouse group regardless of the infection route (data
236
not shown), the CPEs observed were caused not by preformed viruses, but by reactivation.
237
Taking together, we conclude that ORF35 also influences reactivation of MHV68 from
238
latency.
239
240
DISCUSSION
241
MHV68 ORF35 has been shown to be essential for lytic infection (Song et al., 2005), but
242
our data using the 35S virus indicate that the gene is not essential but necessary for
243
efficient lytic infection in vitro and in vivo. What accounts for the discrepancy? ORF35
244
homologues are located in the gene cluster comprising ORF34 to ORF38 (Baer et al.,
245
1984; Russo et al., 1996; Virgin et al., 1997). In KSHV-infected cells, two polycistronic
246
transcripts are synthesized from the gene cluster, the 3.4 kb mRNA encoding ORF35 to
247
ORF37 and 4.2 kb mRNA encoding ORF34 to ORF37 (Haque et al., 2006; Masa et al.,
248
2008). As MHV68 ORF35 is also encoded in a similar manner (data not shown), the
249
insertion of transposons into ORF35 may have affected the stability of the polycistronic
250
mRNA, thereby affecting the expression of the genes (ORF35 to ORF38) encoded in the
251
transcript. Although ORF36, ORF37 and ORF38 were shown to be nonessential
252
(knockout of ORF36 resulted in an attenuated phenotype) (Song et al., 2005), the
253
combined defect of ORF35 to ORF38 may have been lethal for MHV68. Alternatively, a
254
transcriptional control region for an essential gene(s) nearby such as ORF34 may be
255
present in the ORF35 coding region.
256
257
Since the genome replication and expression of lytic proteins in 35S virus-infected cells
258
were comparable to those in WT and 35R virus-infected cells, ORF35 likely functions in
259
the assembly and/or egress step after the production of late proteins. Our finding is
260
consistent with the previous report that HSV-1 UL14, a homologue of ORF35 (Mills et
261
al., 2003), is necessary for the efficient nucleocapsid egress from the nucleus
262
(Cunningham et al., 2000). It is estimated that HSV 1 UL14 is present at no more than a
263
few dozen molecules per virion (Cunningham et al., 2000). ORF35 homologues have not
264
been detected in virions of MHV68, KSHV, and EBV (Bortz et al., 2003; Johannsen et
265
al., 2004; Vidick et al., 2013; Zhu et al., 2005) although ORF35 of rhesus monkey
266
rhadinovirus was found in the virion (O'Connor & Kedes, 2006).
267
268
The 35S virus was able to replicate lytically in NIH3T3 cells in vitro and the mouse lung
269
in vivo (albeit at lower efficiencies) and exhibited virus genomic load similar to those of
270
the other recombinant viruses in splenocytes after intraperitoneal infection, but it failed to
271
reactivate from splenocytes. Since ORF35 is not detected in latently infected cells
272
(Ebrahimi et al., 2003; Martinez-Guzman et al., 2003), it may function at a step(s) after
273
reactivation triggering. The MHV68 lytic replication in myeloma cells was reported to be
274
inefficient (Forrest & Speck, 2008; Sunil-Chandra et al., 1993). This low permissivity of
275
B cells to MHV68 may be a reason for the inability of the 35S virus to reactivate from
276
latently infected cells, because even mild growth impairment of the 35S virus, as
277
compared with the WT virus, would become highly significant in this context.
278
279
Structural analysis revealed that there are two putative coiled-coil motifs in ORF35. The
280
coiled-coil motif is known to mediate protein-protein interactions for such functions as
281
transcription, intracellular transport, and virus entry (Mason & Arndt, 2004; Wang et al.,
282
2012). Charged amino acid residues at positions e and g in the coiled-coil motif usually
283
determine the binding specificity for target proteins, and recruit viral or host proteins by
284
making complexes. The first motif was found to be involved in homo-oligomerization of
285
ORF35. The second motif may also have some roles in the function of ORF35. To
286
explore this possibility, we are currently studying host proteins interacting with ORF35.
287
288
MATERIALS AND METHODS
289
Plasmid constructions. The putative ORF35 coding region (Virgin et al., 1997) was
290
tagged with the Flag-epitope at the N-terminus, and subcloned into an expression vector
291
pCA7, a derivative of pCAGGS (Niwa et al., 1991), or a retrovirus vector pMXs-IP
292
(Kitamura et al., 2003). ORF35 tagged with the influenza hemagglutinin (HA) epitope at
293
the C-terminus was subcloned into pCA7. All truncation and amino acid substitution
294
mutants were generated by PCR-based mutagenesis, tagged with the Flag epitope, and
295
subcloned into pCA7. Primer sequences used for subcloning and mutagenesis will be
296
provided upon request. The coding sequence of the P1 bacteriophage cre-recombinase
297
was subcloned into pMXs-IP.
298
299
Cells. HEK293T and NIH3T3 cells were maintained in Dulbecco’s Modified Medium
300
supplemented with 10% FBS and Penicillin/Streptomycin referred to here as culture
301
medium (CM). Plat-E cells, a retrovirus packaging cell line (Morita et al., 2000), were
302
maintained in CM supplemented with 1 g Puromycin ml-1 (InvivoGen) and 10 g
303
Blasticidin ml-1 (InvivoGen). NIH3T3 cells stably expressing Flag-tagged ORF35
304
(NIH3T3/F35 cells) and cre-recombinase (NIH3T3/Cre cells) were generated by
305
infecting the cells with respective retroviruses generated form Plat-E cells transfected
306
with appropriate retrovirus plasmids, followed by 1 g Puromycin ml-1 selection and
307
limiting dilution.
308
309
Viruses. To prepare virus stocks, NIH3T3 cells were infected with each of the
310
recombinant viruses, and both cells and culture medium were collected when CPE was
311
complete. The harvested samples were centrifuged, and the pellets were suspended in CM.
312
After freezing and thawing twice, the samples were centrifuged and the supernatant was
313
kept at -80C. Infectious viruses were titrated by limiting dilution assay using NIH3T3
314
cells and expressed as TCID50. Virus titers of the 35S virus stock were comparable when
315
examined by limiting dilution assay using NIH3T3 and NIH3T3/F35 cells.
316
317
Antibodies and antiserum. Anti-MHV68 sera were harvested from three
318
MHV68-infected mice and pooled. Rabbit anti-Flag polyclonal antibody (pAb) (Sigma;
319
F7425), mouse anti-Flag monoclonal antibody (mAb) (Sigma; F1804), Rabbit anti-HA
320
pAb (MBL; 561 ), rabbit anti-Lamin A pAb (Santa Cruz Biotech; sc-20680), mouse
321
anti-Tubulin mAb (Santa Cruz Biotech; sc-5286), goat anti-rabbit IgG conjugated with
322
horse radish peroxidase (HRP) (Amersham Biosciences), goat-anti mouse IgG conjugated
323
with HRP (Jackson ImmunoResearch), donkey anti-mouse IgG (H+L) conjugated with
324
Alexa Fluor 488 or 594 (Molecular Probes), and donkey anti-rabbit IgG (H+L)
325
conjugated with Alexa Fluor 488 or 594 (Molecular Probes) were purchased from
326
indicated suppliers.
327
328
Immunoprecipitaition. HEK293T cells were transfected with appropriate combinations
329
of expression plasmids. At 24 h after transfection, the cells were washed with PBS and
330
lysed with IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% Nonidet P-40, 1 mM
331
EDTA, 5% glycerol) supplemented with the protease inhibitor cocktail (Sigma).
332
Insoluble debris was removed by centrifugation, and a small amount of the supernatant
333
was kept as the whole cell lysate (WCL) sample. The remaining supernatant was
334
pre-cleared by incubating with Protein-A Sepharose (GE Healthcare), and then mixed
335
with fresh Protein-A Sepharose and appropriate antibody. After washing intensively with
336
IP buffer without the protease inhibitor cocktail, proteins in the precipitate were
337
solubilized in the SDS loading buffer (Ito et al., 2013) and boiled.
338
339
Dephosphorylation assay. Dephosphorylation assay was performed as previously
340
reported (Jia et al., 2005). HEK293T cells were transfected with the expression plasmid
341
of interest. At 48 h after transfection, the cells were re-suspended into NEB Buffer 3 (100
342
mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT; New England BioLabs)
343
followed by freezing and thawing twice. Cell debris was removed by centrifugation and
344
the supernatant was treated with calf intestine alkaline phosphatase (New England
345
BioLabs) or mock treated. After adding the same volume of 2SDS loading buffer, the
346
sample was boiled.
347
348
Immunoblotting. NIH3T3 cells were infected with each of the recombinant viruses at an
349
M.O.I. of 0.5. Proteins in WCL at 24 h after infection were separated in
350
SDS-polyacrylamide gel, and transferred onto polyvinylidene difluoride (PVDF)
351
membranes. The membrane was blocked with Tris-buffered saline containing 0.05%
352
Tween-20 (TBS-T) and 5% skim milk, followed by the treatment with suitable
353
combinations of antibodies. After washing three times, the membrane was treated with
354
Chemi-Lumi One Super (Nacalai Tesque) for signal detection using VersaDoc 5000
355
imager (Bio-Rad).
356
357
BN- PAGE. HEK293T cells were transfected with appropriate expression plasmids. At
358
24 h after transfection, the cells were washed with PBS and lysed with NativePAGE
359
Sample Buffer (Invitrogen) supplemented with 5% n-dodecyl β-D-maltoside (DDM;
360
Invitrogen) and 0.05% Coomassie brilliant blue G250 (Invitrogen). Lysed proteins were
361
separated in 5-20% gradient gel, incubated with 20mM Tris-HCl (pH7.4) containing
362
150mM Glycine and 0.1% SDS at room temperature for 5 min, and then transferred onto
363
PVDF membranes. The membranes were incubated with 50mM Tris-HCl (pH7.4)
364
containing 2% SDS and 0.8% 2-mercaptoethanol at 55C for 30 min, and followed by
365
blocking and immunodetection as above.
366
367
Indirect immunofluorescent assay. NIH3T3 cells were infected with MHV68 for 1 h or
368
left uninfected. The supernatant was replaced with fresh medium and the cells were
369
transfected with pCA7-Flag-ORF35. At 17 h after transfection, the cells were stained
370
with appropriate combinations of antibodies (Ito et al., 2013). The stained cells were
371
observed under a confocal microscope (Radiance 2100; Bio-Rad).
372
373
Virus growth in cultured cells. NIH3T3 and NIH3T3/F35 cells were infected with each
374
of the recombinant viruses for 1 h at an M.O.I. of 0.05 or 3. At indicated days after
375
infection, infectious viruses in cells and supernatants were titrated, respectively.
376
377
Animal infection. All animal experiments were reviewed by the Institutional Committee
378
of Ethics on Animal Experiments of the Faculty of Medicine, Kyushu University, and the
379
facility guidelines for animal experiments and care were strictly followed. Sex- and
380
age-matched C57BL/6 mice were anesthetized by the mixture of medetomidine,
381
midazolam, and butorphanol, and then infected intranasally or intraperitoneally with 105
382
TCID50 of the recombinant viruses. The infected mice were housed in ventilated isolation
383
cages during infection. At 3 and 6 days after infection, virus titers in lung homogenates
384
were determined (Flach et al., 2009). At 17 and 24 days after infection, spleens were
385
harvested, weighed, and prepared for single cell suspensions. After removing red blood
386
cells, splenocytes were counted and used for the determination of reactivation frequency
387
and DNA isolation.
388
389
Ex vivo reactivation assay. A series of three-fold dilutions of splenocytes mixture
390
starting from 1.5  105 cells / well were overlaid on NIH3T3 cells seeded on 96-well
391
plate beforehand (Adler et al., 2001; Weck et al., 1996). The appearance of CPE in each
392
well was observed up to 2 weeks after overlay and the reactivation frequency of each
393
diluent was calculated. The presence of pre-formed infectious virus was checked
394
following the same procedure using splenocytes disrupted by freezing and thawing twice.
395
396
Measurement of viral genome copy number by real-time PCR. NIH3T3 cells infected
397
with each of the recombinant viruses were cultured with or without 200 g PAA (Sigma)
398
ml-1. DNA was extracted from virus-infected NIH3T3 cells at 3 h and 24 h after infection,
399
or mouse splenocytes using the GenElute Mammalian Genomic DNA Miniprep Kit
400
(Sigma) following the manufacturer's instructions. Quantitative PCR was carried out
401
using SYBR Premix Ex Taq II (Takara) and a Light Cycler 1.5 (Roche). A primer set for
402
ORF57 was used to quantify the virus genome and mouse ribosomal L8 gene (L8) was
403
also amplified for normalization (TABLE 1) (Flach et al., 2009). The PCR fragments of
404
ORF57 and L8 were subcloned and used as standard plasmids. For the copy number in
405
virus-infected NIH3T3 cells, data are shown as the copy number at 24 h after infection
406
relative to that at 3 h after infection. For the genomic load in splenocytes, the data are
407
shown as the copy number of ORF57 relative to 1000 copies of the ribosomal L8 gene.
408
409
Statistics. Statistical significance was analyzed using the unpaired Student’s t-test.
410
411
ACKNOWLEDGMENTS
412
We appreciate the technical assistance from The Research Support Center, Kyushu
413
University Graduate School of Medical Sciences. We also thank H. Adler and T.
414
Kitamura for generously providing the MHV68 BAC plasmid, and the retrovirus vector
415
and packaging cells, respectively. This study was supported in part by JSPS KAKENHI
416
grant 26460558.
417
418
REFERRENCES
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
Adler, H., Messerle, M. & Koszinowski, U. H. (2001). Virus Reconstituted from
Infectious Bacterial Artificial Chromosome (BAC)-Cloned Murine
Gammaherpesvirus 68 Acquires Wild-Type Properties In Vivo Only after
Excision of BAC Vector Sequences. Journal of virology 75, 5692-5696.
Albrecht, J. C., Nicholas, J., Biller, D., Cameron, K. R., Biesinger, B., Newman, C.,
Wittmann, S., Craxton, M. A., Coleman, H., Fleckenstein, B. & et al. (1992).
Primary structure of the herpesvirus saimiri genome. Journal of virology 66,
5047-5058.
Araujo, P. R., Yoon, K., Ko, D., Smith, A. D., Qiao, M., Suresh, U., Burns, S. C. &
Penalva, L. O. (2012). Before It Gets Started: Regulating Translation at the 5'
UTR. Comp Funct Genomics 2012, 475731.
Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J.,
Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S. &
Barrell, B. G. (1984). DNA-Sequence and Expression of the B95-8 Epstein-Barr
Virus Genome. Nature 310, 207-211.
Barton, E., Mandal, P. & Speck, S. H. (2011). Pathogenesis and host control of
gammaherpesviruses: lessons from the mouse. Annual review of immunology 29,
351-397.
Blaskovic, D., Stancekova, M., Svobodova, J. & Mistrikova, J. (1980). Isolation of
five strains of herpesviruses from two species of free living small rodents. Acta
virologica 24, 468.
Bortz, E., Whitelegge, J. P., Jia, Q., Zhou, Z. H., Stewart, J. P., Wu, T. T. & Sun, R.
(2003). Identification of proteins associated with murine gammaherpesvirus 68
virions. Journal of virology 77, 13425-13432.
Burke, A. P., Yen, T. S., Shekitka, K. M. & Sobin, L. H. (1990). Lymphoepithelial
carcinoma of the stomach with Epstein-Barr virus demonstrated by polymerase
chain reaction. Modern pathology : an official journal of the United States and
Canadian Academy of Pathology, Inc 3, 377-380.
Calvo, S. E., Pagliarini, D. J. & Mootha, V. K. (2009). Upstream open reading frames
cause widespread reduction of protein expression and are polymorphic among
humans. Proceedings of the National Academy of Sciences 106, 7507-7512.
Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. &
Moore, P. S. (1994). Identification of Herpesvirus-Like DNA-Sequences in
Aids-Associated Kaposis-Sarcoma. Science 266, 1865-1869.
Cunningham, C., Davison, A. J., MacLean, A. R., Taus, N. S. & Baines, J. D. (2000).
Herpes Simplex Virus Type 1 Gene UL14: Phenotype of a Null Mutant and
Identification of the Encoded Protein. Journal of virology 74, 33-41.
Damania, B. & Cesarman, E. (2013). Kaposi’s Sarcoma-Associated Herpesvirus,
p2080-2128: In Knipe DM, Howley PM (ed), Fields Virology, 6th ed., Wolters
Kluwer Health/Lippincott Williams & Wilkins Co, Philadelphia, PA.
Dolan, A., Jamieson, F. E., Cunningham, C., Barnett, B. C. & McGeoch, D. J.
(1998). The genome sequence of herpes simplex virus type 2. Journal of virology
72, 2010-2021.
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
Dunn, W., Chou, C., Li, H., Hai, R., Patterson, D., Stolc, V., Zhu, H. & Liu, F.
(2003). Functional profiling of a human cytomegalovirus genome. Proceedings of
the National Academy of Sciences 100, 14223-14228.
Dutia, B. M., Clarke, C. J., Allen, D. J. & Nash, A. A. (1997). Pathological changes in
the spleens of gamma interferon receptor-deficient mice infected with murine
gammaherpesvirus: a role for CD8 T cells. Journal of virology 71, 4278-4283.
Ebrahimi, B., Dutia, B. M., Roberts, K. L., Garcia-Ramirez, J. J., Dickinson, P.,
Stewart, J. P., Ghazal, P., Roy, D. J. & Nash, A. A. (2003). Transcriptome
profile of murine gammaherpesvirus-68 lytic infection. The Journal of general
virology 84, 99-109.
Efstathiou, S., Ho, Y. M., Hall, S., Styles, C. J., Scott, S. D. & Gompels, U. A. (1990).
Murine Herpesvirus 68 Is Genetically Related to the Gammaherpesviruses
Epstein-Barr-Virus and Herpesvirus Saimiri. The Journal of general virology 71,
1365-1372.
Epstein, M. A., Achong, B. G. & Barr, Y. M. (1964). Virus Particles in Cultured
Lymphoblasts from Burkitts Lymphoma. Lancet 1, 702-703.
Flach, B., Steer, B., Thakur, N. N., Haas, J. & Adler, H. (2009). The M10 locus of
murine gammaherpesvirus 68 contributes to both the lytic and the latent phases of
infection. Journal of virology 83, 8163-8172.
Forrest, J. C. & Speck, S. H. (2008). Establishment of B-cell lines latently infected with
reactivation-competent murine gammaherpesvirus 68 provides evidence for viral
alteration of a DNA damage-signaling cascade. Journal of virology 82,
7688-7699.
Haque, M., Wang, V., Davis, D. A., Zheng, Z. M. & Yarchoan, R. (2006). Genetic
organization and hypoxic activation of the Kaposi's sarcoma-associated
herpesvirus ORF34-37 gene cluster. Journal of virology 80, 7037-7051.
Ito, M., Iwasaki, M., Takeda, M., Nakamura, T., Yanagi, Y. & Ohno, S. (2013).
Measles Virus Nonstructural C Protein Modulates Viral RNA Polymerase
Activity by Interacting with Host Protein SHCBP1. Journal of virology 87,
9633-9642.
Jia, Q., Chernishof, V., Bortz, E., Mchardy, I., Wu, T.-T., Liao, H.-I. & Sun, R.
(2005). Murine Gammaherpesvirus 68 Open Reading Frame 45 Plays an Essential
Role during the Immediate-Early Phase of Viral Replication. Journal of virology
79, 5129-5141.
Johannsen, E., Luftig, M., Chase, M. R., Weicksel, S., Cahir-McFarland, E., Illanes,
D., Sarracino, D. & Kieff, E. (2004). Proteins of purified Epstein-Barr virus.
Proceedings of the National Academy of Sciences of the United States of America
101, 16286-16291.
Johnson, P. A. & Everett, R. D. (1986). DNA-Replication Is Required for Abundant
Expression of a Plasmid-Borne Late Us11 Gene of Herpes-Simplex Virus Type-1.
Nucleic acids research 14, 3609-3625.
Kitamura, T., Koshino, Y., Shibata, F., Oki, T., Nakajima, H., Nosaka, T. &
Kumagai, H. (2003). Retrovirus-mediated gene transfer and expression cloning:
Powerful tools in functional genornics. Exp Hematol 31, 1007-1014.
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
Kronstad, L. M., Brulois, K. F., Jung, J. U. & Glaunsinger, B. A. (2013). Dual short
upstream open reading frames control translation of a herpesviral polycistronic
mRNA. Plos Pathog 9, e1003156.
Kronstad, L. M., Brulois, K. F., Jung, J. U. & Glaunsinger, B. A. (2014). Reinitiation
after Translation of Two Upstream Open Reading Frames (ORF) Governs
Expression of the ORF35-37 Kaposi's Sarcoma-Associated Herpesvirus
Polycistronic mRNA. Journal of virology 88, 6512-6518.
Longnecker, R., Kieff, E. & Cohen, J. I. (2013). Epstein-Barr Virus, p1898-1959: In
Knipe DM, Howley PM (ed), Fields Virology, 6th ed., Wolters Kluwer
Health/Lippincott Williams & Wilkins Co, Philadelphia, PA.
Martinez-Guzman, D., Rickabaugh, T., Wu, T. T., Brown, H., Cole, S., Song, M. J.,
Tong, L. & Sun, R. (2003). Transcription program of murine gammaherpesvirus
68. Journal of virology 77, 10488-10503.
Masa, S.-R., Lando, R. & Sarid, R. (2008). Transcriptional regulation of the open
reading frame 35 encoded by Kaposi's Sarcoma-associated herpesvirus. Virology
371, 14-31.
Mason, J. M. & Arndt, K. M. (2004). Coiled coil domains: stability, specificity, and
biological implications. Chembiochem : a European journal of chemical biology
5, 170-176.
Mavromara-Nazos, P. & Roizman, B. (1987). Activation of herpes simplex virus 1
gamma 2 genes by viral DNA replication. Virology 161, 593-598.
McGeoch, D. J., Dalrymple, M. A., Davison, A. J., Dolan, A., Frame, M. C., McNab,
D., Perry, L. J., Scott, J. E. & Taylor, P. (1988). The complete DNA sequence
of the long unique region in the genome of herpes simplex virus type 1. The
Journal of general virology 69, 1531-1574.
Mills, R., Rozanov, M., Lomsadze, A., Tatusova, T. & Borodovsky, M. (2003).
Improving gene annotation of complete viral genomes. Nucleic acids research 31,
7041-7055.
Morita, S., Kojima, T. & Kitamura, T. (2000). Plat-E: an efficient and stable system
for transient packaging of retroviruses. Gene therapy 7, 1063-1066.
Niwa, H., Yamamura, K. & Miyazaki, J. (1991). Efficient Selection for
High-Expression Transfectants with a Novel Eukaryotic Vector. Gene 108,
193-199.
Nonoyama, M., Huang, C. H., Pagano, J. S., Klein, G. & Singh, S. (1973). DNA of
Epstein-Barr virus detected in tissue of Burkitt's lymphoma and nasopharyngeal
carcinoma. Proceedings of the National Academy of Sciences of the United States
of America 70, 3265-3268.
O'Connor, C. M. & Kedes, D. H. (2006). Mass Spectrometric Analyses of Purified
Rhesus Monkey Rhadinovirus Reveal 33 Virion-Associated Proteins. Journal of
virology 80, 1574-1583.
Russo, J. J., Bohenzky, R. A., Chien, M. C., Chen, J., Yan, M., Maddalena, D.,
Parry, J. P., Peruzzi, D., Edelman, I. S., Chang, Y. & Moore, P. S. (1996).
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).
Proceedings of the National Academy of Sciences of the United States of America
93, 14862-14867.
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
Said, J. W., Chien, K., Takeuchi, S., Tasaka, T., Asou, H., Cho, S. K., deVos, S.,
Cesarman, E., Knowles, D. M. & Koeffler, H. P. (1996). Kaposi's
sarcoma-associated herpesvirus (KSHV or HHV8) in primary effusion
lymphoma: Ultrastructural demonstration of herpesvirus in lymphoma cells.
Blood 87, 4937-4943.
Simas, J. P. & Efstathiou, S. (1998). Murine gammaherpesvirus 68: a model for the
study of gammaherpesvirus pathogenesis. Trends in microbiology 6, 276-282.
Song, M. J., Hwang, S., Wong, W. H., Wu, T. T., Lee, S., Liao, H. I. & Sun, R.
(2005). Identification of viral genes essential for replication of murine
gamma-herpesvirus 68 using signature-tagged mutagenesis. Proceedings of the
National Academy of Sciences of the United States of America 102, 3805-3810.
Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazalshatem, D., Babinet, P.,
Dagay, M. F., Clauvel, J. P., Raphael, M., Degos, L. & Sigaux, F. (1995).
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric
Castleman's disease. Blood 86, 1276-1280.
Sunil-Chandra, N. P., Efstathiou, S. & Nash, A. A. (1993). Interactions of murine
gammaherpesvirus 68 with B and T cell lines. Virology 193, 825-833.
Svobodova, J., Blaskovic, D. & Mistrikova, J. (1982). Growth characteristics of
herpesviruses isolated from free living small rodents. Acta virologica 26,
256-263.
Telford, E. A., Watson, M. S., Aird, H. C., Perry, J. & Davison, A. J. (1995). The
DNA sequence of equine herpesvirus 2. Journal of molecular biology 249,
520-528.
Vidick, S., Leroy, B., Palmeira, L., Machiels, B., Mast, J., François, S., Wattiez, R.,
Vanderplasschen, A. & Gillet, L. (2013). Proteomic Characterization of Murid
Herpesvirus 4 Extracellular Virions. PLoS ONE 8, e83842.
Virgin, H. W. t., Latreille, P., Wamsley, P., Hallsworth, K., Weck, K. E., Dal Canto,
A. J. & Speck, S. H. (1997). Complete sequence and genomic analysis of murine
gammaherpesvirus 68. Journal of virology 71, 5894-5904.
Wada, K., Goshima, F., Takakuwa, H., Yamada, H., Daikoku, T. & Nishiyama, Y.
(1999). Identification and characterization of the UL14 gene product of herpes
simplex virus type 2. The Journal of general virology 80, 2423-2431.
Wang, Y., Zhang, X., Zhang, H., Lu, Y., Huang, H., Dong, X., Chen, J., Dong, J.,
Yang, X., Hang, H. & Jiang, T. (2012). Coiled-coil networking shapes cell
molecular machinery. Molecular Biology of the Cell 23, 3911-3922.
Weck, K. E., Barkon, M. L., Yoo, L. I., Speck, S. H. & Virgin HW, I. V. (1996).
Mature B cells are required for acute splenic infection, but not for establishment
of latency, by murine gammaherpesvirus 68. Journal of virology 70, 6775-6780.
Weiss, L. M., Strickler, J. G., Warnke, R. A., Purtilo, D. T. & Sklar, J. (1987).
Epstein-Barr viral DNA in tissues of Hodgkin's disease. The American journal of
pathology 129, 86-91.
Yamauchi, Y., Daikoku, T., Goshima, F. & Nishiyama, Y. (2003). Herpes Simplex
Virus UL14 Protein Blocks Apoptosis. Microbiology and Immunology 47,
685-689.
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
Yamauchi, Y., Wada, K., Goshima, F., Daikoku, T., Ohtsuka, K. & Nishiyama, Y.
(2002). Herpes simplex virus type 2 UL14 gene product has heat shock protein
(HSP)-like functions. Journal of cell science 115, 2517-2527.
Yu, D., Silva, M. C. & Shenk, T. (2003). Functional map of human cytomegalovirus
AD169 defined by global mutational analysis. Proceedings of the National
Academy of Sciences 100, 12396-12401.
Zhu, F. X., Chong, J. M., Wu, L. & Yuan, Y. (2005). Virion proteins of Kaposi's
sarcoma-associated herpesvirus. Journal of virology 79, 800-811.
622
623
624
TABLE
TABLE. 1 Primer sequence used for quantitative PCR
Name
ORF57-upper
ORF57-lower
L8-upper
L8-lower
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
5' 
CCTGAAGAGAACCCCTTGC
CGCCTGGCTGATACTTTAGG
CATCCCTTTGGAGGTGGTA
CATCTCTTCGGATGGTGGA
3'
644
FIGURE LEGENDS
645
Fig. 1 ORF35 is a phosphorylated protein. (a) Expression of Flag-ORF35 protein.
646
HEK293T cells were transfected with the vector expressing Flag-ORF35 or empty
647
plasmid. Whole cell lysates at 24 h after transfection were immunoblotted using anti-Flag
648
pAb. The addition of the Flag epitope reduced the protein mobility in the SDS-PAGE.
649
(b) Putative phosphorylated residues in MHV68 ORF35. Amino acid sequence of ORF35
650
is shown with single letters. Putatively phosphorylated serine (S) and threonine (T)
651
residues are highlighted. Underlines indicate the deleted region of the truncation mutants.
652
aa; amino acid residues. (c) Expression of truncated ORF35 proteins. HEK293T cells
653
were transfected with each of expression vectors, and the expression of C-terminally
654
truncated ORF35 proteins tagged with Flag epitope was analyzed by immunoblotting
655
using anti-Flag pAb. (d) Dephosphorylation assay. HEK293T cells were transfected with
656
each of expression plasmids, and cell lysates were treated with calf intestine alkaline
657
phosphatase (ALP) or mock treated. The samples were analyzed by immunoblotting.
658
659
Fig. 2 A putative coiled-coil motif in ORF35 mediates homo-oligomerization. (a) A
660
schematic illustration of truncation mutants and the predicted coiled-coil motifs in
661
ORF35. ORF35 protein and Flag epitope are shown as white and dark-gray boxes,
662
respectively. The numbers indicate amino acid residue positions of ORF35 in the
663
full-length and mutant constructs. Amino acid sequences of predicted coiled-coil motifs
664
in ORF35 (positions 41 to 73 and 100 to 112) are shown with single capital letters. Small
665
letters above the residues indicate the tentative positions (a to g) in the coiled-coil motif.
666
Amino acid residues replaced in the mutants are highlighted. (b and c) Co-IP assay of
667
N-terminally truncated mutants and AAA mutant (b) and C-terminally truncated mutants
668
and mutants with amino acid substitutions (c). HEK293T cells were transfected with each
669
of expression plasmids along with the ORF35-HA expression vector. At 24 h after
670
transfection, proteins were precipitated with anti-Flag mAb and examined by
671
immunoblotting. (d) BN-PAGE analysis. HEK293T cells were transfected with each
672
expression plasmid. At 24 h after transfection, proteins were separated by BN-PAGE,
673
blotted onto PVDF membrane, and reacted with anti-Flag mAb.
674
675
Fig. 3 Subcellular localization of ORF35 protein. (a and b) NIH3T3 cells were
676
transfected with pCA7-Flag-ORF35. At 24 h after transfection, the Flag epitope (red) and
677
Tubulin (a) or Lamin A (b) (green) were doubly stained. (c) NIH3T3 cells were infected
678
with MHV68 at an M.O.I. of 3 for 1 h and then transfected with pCA7-Flag-ORF35. At
679
17 h after transfection, the Flag epitope (red) and Lamin A (green) were doubly stained.
680
681
Fig. 4 Growth kinetics of ORF35 mutant viruses in vitro. (a and b) Growth kinetics of
682
recombinant viruses. NIH3T3 cells were infected with each of the BAC-removed viruses
683
at an M.O.I. of 0.05 (a) or 3 (b), and infectious viruses in culture supernatant or
684
cell-associated virus were titrated at indicated days after infection. (c) Growth kinetics of
685
the 35S virus in NIH3T3 and NIH3T3/F35 cells. Respective cells were infected with the
686
35S virus at an M.O.I. of 0.05, and infectious viruses were titrated at indicated days after
687
infection.
688
689
Fig. 5 Genome replication and lytic protein expression in virus-infected cells. (a)
690
Genome replication in NIH3T3 cells. Cells were infected with indicated viruses at an
691
M.O.I. of 0.5 and incubated with or without PAA. At 3 h and 24 h after infection, DNAs
692
were isolated and analyzed by real-time PCR. The data were normalized by the cellular
693
ribosomal L8 gene and expressed as relative increase of the copy number at 24 h after
694
infection as compared with that at 3 h. (b) Expression of lytic proteins. NIH3T3 cells
695
were infected with indicated viruses at an M.O.I. of 0.5 and incubated with or without
696
PAA. Expression of lytic proteins was analyzed by immunoblotting using anti-MHV68
697
serum.
698
699
Fig. 6 Lytic replication and latency of recombinant viruses in mice. (a) Lytic
700
replication in the lung. C57BL/6 mice were infected intranasally with 105 TCID50 of
701
indicated viruses. At 3 and 6 days after infection, virus titers in the lung were determined.
702
Each symbol represents an individual mouse and the bar indicates the mean value. N; the
703
number of mice in each group. (b) Evaluation of splenomegaly at 17 and 24 days after
704
infection. Mean spleen weight with standard deviation is shown. N; the number of mice
705
in each group. (c) Viral genomic load in the spleen at 17 and 24 days after infection. The
706
copy number of ORF57 relative to 1000 copies of the ribosomal L8 gene is shown. Each
707
symbol represents an individual mouse and the bar indicates the mean value. N; the
708
number of mice in each group. (d) Ex vivo reactivation from splenocytes. Mice were
709
infected with 105 TCID50 of indicated viruses intranasally or intraperitoneally. At 17 and
710
24 days after infection, a set of three fold dilutions of splenocyte mixture were overlaid
711
onto NIH3T3 cells. Frequency of CPE positive well was calculated. N; the number of
712
mice analyzed in each group.
713
714