Download PBS End of Course Assessment Review Packet

PBS End of Course Assessment Review Packet
KEY
Unit 1—The Mystery:
Name 5 pieces of evidence that might be obtained at a crime scene that could help solve the crime.
Draw a diagram showing the relationship between the following terms: nucleotide, gene, DNA Double
Helix, chromosome. LABEL ALL STRUCTURES
Using simple shapes, draw and label all parts of a nucleotide:
Name all four bases of DNA – which bases are structurally similar to one another? Which bases pair with
each other? Which base is NOT present in RNA?




Adenine
2 rings: purines
Thymine (not present in RNA)
Guanine
1 ring: pyrimidines
Cytosine
What do restriction enzymes do? (1.2.3)
cut DNA in a specific location
What does gel electrophoresis do? Which way does DNA run on the gel?
Separate DNA pieces for comparison
DNA is negative, therefore it runs toward the positive end
How does DNA differ from person to person?
Nucleotide sequence
Write the strand of DNA that would bind with this strand: ATCGTCAGG
TAGCAGTCC
Mark on this strand of DNA where the restriction enzyme HaeIII would cut (GG-CC).
ATTCC GGTATACGGCTAATACC GGTTATAGCG
TAAGG CCATATGCCGATTATGG CCAATATCGC
10. Parts of an experiment:
The independent variable is the one that is altered. The dependent variable
measured, its measurement depends on the independent variable.
The experimental group is the one you experiment on while the control group
unaltered. It is important because you use it to compare against the group where the
independent variable is applied.
Unit 2—Diabetes:
Create a chart that compares Type 1 and Type 2 diabetes - include symptoms, treatment, how it works,
and who generally suffers from it.
Type I Diabetes
Does NOT produce insulin
Childhood onset
Insulin injection
Insulin pump
Both
Increased thirst
Increased urination
Exercise
Diet
Type II Diabetes
Produces insulin, but can’t
use it
Adult onset
Oral medication
Insulin injection
Draw a graph showing the results of glucose tolerance testing for someone with Type I diabetes and
someone with Type II Diabetes.
Type 1 and Type 2 diabetes
are represented in the same
way on the GTT graph.
Draw a graph showing the results of insulin testing for someone with Type I Diabetes, someone with Type
II diabetes, and a healthy person.
Amy is type II diabetic,
Nick is type I diabetic,
Patrick is normal.
Explain the difference between negative and positive feedback. Give an example of each. (2.1.3)
Positive: causes a reinforcement of the original action so the input causes
the reaction to increase.
Negative: causes the system to stop doing the original action and to
either take no action or to perform an opposite action.
Diagram the feedback relationship of blood glucose and the hormones insulin and glucagon.
Explain the difference between dehydration synthesis and hydrolysis.
DEHYDRATION: loss of water by the joining of a molecule
HYDROLYSIS: addition of water by breakdown of a molecule
.
Identify each of the following pictures as a lipid, carbohydrate, or lipid. Explain how you know based on the
structure.
phospholipid
carbohydrate Glucose
c) protein
Explain the process of calorimetry and how it is used to measure the amount of energy in a food.
What is osmosis - explain it in your own words. Draw a simple picture if you need to.
Diffusion of water through a selectively permeable membrane
For each beaker below, a) label the solution as hypotonic, hypertonic, or isotonic and b) draw an arrow
showing water movement.
ISO
HYPO
HYPER
Why are diabetics constantly dehydrated and urinating so often? Relate your answer to osmosis and the
lab we performed using the model cells (dialysis tubing).
HYPERTONIC: fluids leaving cells to decrease % glucose in blood
List 3 complications of diabetes, give a brief description of it, and tell what body system it affects. (2.3.3)
Foot complications: poor circulation
Stroke: blood clot, loss function on side of the body
Eye complications: glaucoma
Unit 3—Sickle Cell Disease:
Draw normal blood cells and then draw sickled blood cells. Describe the differences between these two
cells.
Sickled blood cells
are crescent shaped.
How is anemia diagnosed? Describe and name the procedure and give the results expected for someone
with anemia (hint: see 3.1.1)\
Hematocrit is used to diagnose anemia
Male <42%; Female <35%
Name and describe the role of each of the four component of blood.
Plasma: vehicle by which blood cells are carried
Red blood cell (RBC): carry oxygen from the lungs to the tissues and carbon dioxide back to the lungs to
be exhaled
White blood cell (WBC): destroy bacteria
Platelets: interact with clotting to prevent bleeding
Name 3 main symptoms of sickle cell anemia and how they affect daily life.
Chest/leg pain
Frequent infection
Trouble breathing
Fill in the blanks with the correct word in describing protein synthesis:
All instructions for proteins, like hemoglobin, are stored in our DNA, which is located in a cell’s nucleus.
This DNA must first be turned into mRNA, through a process called transcription. This process takes
place in the nucleus. The mRNA then takes the message to the cytoplasm, specifically to a ribosome.
This is where the process of translation takes place. A tRNA matches its anti-codons to a codon on the
mRNA. The tRNA then drops off its amino acid. Many of these monomers make up the final protein of
hemoglobin.
Name and describe the job of each of the three types of RNA:
mRNA: copy DNA for removal from the nucleus
rRNA: part of the ribosome
tRNA: anti-codons match with codons on mRNA
In Sickle Cell Anemia, Glutamic acid is changed to valine through a type of mutation called a substitution
in the DNA code. Glutamic acid is hydrophilic, meaning it likes water; but valine is hydrophobic, meaning
it hates water. How does this property affect the entire hemoglobin protein?
Transcribe this DNA sequence into mRNA, then tRNA, and then translate it into an amino acid sequence
using the genetic code found in Activity 3.2.2
Original
TACATCCGAAAATTTGATTTG
mRNA:
AUGUAGGCUUUUAAACUAAAC
tRNA:
Protein:
UACAUCCGAAAAUUUGAUUUG
Met/Start K G
L G D M
What is a karyotype? What sorts of diseases can and cannot be diagnosed using a karyotype?
A display of the chromosome pairs of a cell arranged by size and shape.
Diseases that are polyploidy are easily detected by karyotypes.
This process makes new body cells for repair & replacement: mitosis
This process makes sex cells of sperm and egg: meiosis
Each body cell has 46 chromosomes. Each gamete has 23 chromosomes.
What does HIPAA stand for and what does it say (in a one sentence summary)? (1.3.2)
Health Insurance Portability and Accountability Act
Gives patients specific rights regarding their personal health info.
Why does sickle cell disease run in families, yet is not present in every generation?
It is a recessive disorder
Remember that Best’s disease is a dominant disease. Draw a Punnett square to show the cross between a
woman without Best’s disease and a man who has one allele for Best disease and one allele without Best’s
disease. What is the chance that they will have a child with Best’s disease?
B
b
50% chance they will
b
Bb
bb
have a child with Best’s
disease
b
Bb
bb
Examine the pedigree below. Is this disease dominant or recessive - how do you know?
Recessive, the disease is not expressed
in every generation.
Draw the pedigree for the following family. Label all known GENOTYPES and put the individual’s name on
the pedigree: Natasha and Nathan are planning on having children. Each has a sister with sickle cell
disease. Neither Natasha nor Nathan nor any of their parents have the disease, and none of them has
been tested to see if they have the sickle cell trait.
Unit 4—Heart Disease:
In most of the body the arteries carry oxygenated blood and the veins carry deoxygenated blood. The
exception to this pattern is the heart. List the specific arteries and veins of the heart that are different from
the pattern seen in the rest of the body and explain how and why they are different.
Pulmonary vein and pulmonary artery: blood picks up oxygen in the lungs, therefore when the pulmonary
artery is coming away from the heart to the lungs it has not yet reached that supply of blood.
What is the pathway blood takes as it passes through the heart? Briefly state the path from body to heart to
lungs to heart to body.
What is heart rate? (Be sure to include units of measure!!)
A measure of cardiac activity usually expressed as the number of beats per minute (BPM)
What is blood pressure? How is it measured? What are the units of blood pressure?
Pressure exerted by the blood upon the walls of the blood vessels
Measured by sphygmomanometer
Units: millimeters of mercury
What does EKG stand for? What does it measure?
Electrocardiogram
Measurement of heart electrical activity
Name the two nodes of the heart and where each is located. Which one is called the “pacemaker”?
SA (sinoatrinal node): “pacemaker”
AV (avrioventricular node)
Trace the conduction of electrical impulses through the heart
What are two major functions of cholesterol in our bodies?
LDL: carrier of cholesterol
HDL: remove excess cholesterol
Is cholesterol hydrophobic or hydrophilic? How can it be carried in our hydrophilic bloodstream?
Amphipathic—both hydrophobic and hydrophilic
It can be carried in our hydrophilic bloodstream due to its hydrophilic properties.
What is atherosclerosis? How can it affect blood pressure?
Hardening of the arteries
Increases blood pressure due to narrowing of the arteries
Name four risk factors for developing heart disease.
High blood pressure
High cholesterol
Diabetes
Smoking
Being overweight (obese)
Family history
Unhealthy diet
Physical inactivity
Age
Make a chart comparing and contrasting LDL and HDL – include structure and function.
Which one is the major carrier of cholesterol?
Which one has more protein in its molecule?
Which one should have a level below 100 mg/dL?
Which one should have a level of above 40 mg/dL?
LDL
Low Density Lipoprotein
“bad”
Transporter
Level below 100 mg/dL
HDL
High Density Lipoprotein (more
protein)
“good”
Responsible for removing excess
cholesterol
Level about 40 mg/dL
What is a problem with a person with the FH mutation? Be specific. (4.3.2)
Autosomal dominant genetic disorder affecting the LDL receptor
The receptor becomes deformed and inefficient at binding LDL
Causes very elevated levels of LDL in the blood stream
What does PCR stand for? What is the purpose of PCR?
Polymerase Chain Reaction
Used to amplify a single copy or a few copies of a piece of DNA to see if there is a mutation
In this unit, we reviewed about three different DNA techniques from Unit 1. List them in the order that they
are performed. Explain how RLFPs, PCR, and gel electrophoresis are related.
PCR
RFLP
Gram Positive
Gram Negative
Gel
electroph
oresis
What is a
RFLP and how is it used in DNA analysis – be specific.
Restriction Fragment Length Polymorphism
When DNA is exposed to the same restriction enzyme, the DNA fragments produced by the enzyme may
be different lengths. Differences are known as polymorphisms.
Name and explain 3 procedures that could help treat a blockage in the heart.
Angioplasty: thread a thin tube through the arm/groin to the heart with a balloon on the end; when in place
the balloon is inflated to push the plaque out against the wall of the artery, widening the artery and
restoring blood flow.
Stent insertion: a balloon first expands the stent pushing it into place in the artery; the balloon and
catheter are pulled out leaving the stent in place.
Coronary artery bypass graft surgery: blood vessels or grafts used for bypass may be pieces of vein
taken from the legs or artery in the chest; one end is attached above the blockage and the other below—
thus blood is rerouted/bypasses
Unit 5—Infectious Disease:
Label all parts to the bacterial cell below:
A: capsule
B: cell wall
C: plasma membrane
D: cytoplasm
E: ribosome
F: plasmid
G: Pili
H: Bacterial Flagellum
I: Nucleoid (circular DNA)
?
Explain
the
Thick peptidoglycan cell wall
Thin peptidoglycan cell wall
structural
difference
Retains crystal violet dye
Stained by safranin counterstain
s
between gram positive and gram negative bacteria. What color is each after Gram staining? Why?
Purple
Pink
How can viruses be prevented? How can bacterial infections be prevented? How can each be treated?
Viruses
Bacteria
Prevention: avoid those who are sick, wash
Prevention: avoid those who are sick, wash
your hands frequently
your hands frequently
Treatment: bed rest and hydration (no
Treatment: includes antibiotics
treatment such as medication)
Briefly explain the function of each part of the immune system below:
Skin: protection, regulation, sensation
Phagocytes (like macrophages): used to detect foreign objects
Inflammation: eliminate the initial cause of cell injury, clear out necrotic cells and tissues damaged from the
original insult
B Cells: make anti-bodies in response to antigens
T Cells: a type of white blood cell
Unit 6—Post Mortem:
Match the organ to its body system:
B 1. Bladder
A. Cardiovascular System
A 2. Heart
B. Urinary System
C 3. Lungs
C. Respiratory System
C 4. Trachea
D. Digestive System
D 5. Pancreas
E. Immune System
B 6. Kidneys
F. Nervous System
F 7. Brain
D 8. Gall Bladder
A 9. Vein
F 10. Eye
F 11. Lymph Node
D 12. Teeth
B 13. Urethra
E 14. Thymus
E 15. Spleen
C 16. Larynx