Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Cancer results from mutations in genes regulating cell growth • Two classes of genes are involved: • 1) Oncogenes - positive regulators promote cancer by hyperactivity (one allele is enough) • 2) Suppressor genes - negative regulators, promote cancer by loss of activity (two allele must be mutated) • The first tumor suppressor- Rb (retinoblastoma) • The most frequent mutated tumor suppressor - p53 • p53 was first cloned at the weizmann institute and is mutated in > 50% of all cancer. • 25,000 papers published on p53 in 22 years How p53 functions as a tumor suppressor? Evidence that p53 is a tumor suppressor (II) • • • Transformation of primary rat embryo fibroblasts (REF) with a combination of two different oncogenes (e.g. myc+ras) gives rise to transformed foci. Wild type p53 (wtp53) can suppress the transformation of REF by oncogenes. M utant forms of p53, found in tumors,can not suppress transformation(in fact, • they enhance tra nsformat ion). C onclusion: p53 is a tu m or suppre ssor. myc +ras myc +ras+ wtp53 myc +ras+ mutp53 Additional evidence that p53 is a tumor suppressor • 1. Li-Fraumeni syndrome. An inherited syndrome offamilial • 2 Re-introduction of wt p53 into human cancer-derived, p53-negative cells. Parental (non- cancer. Affected fami ly members tend to develop cancer at early age (below 40). The most common tumors are br east cancer and soft tissue sarcoma, but other types of cancer are al so frequent. In the majority of families (about 80%), affected individuals carry one mutated germline allele of p53 (in all somatic cells of their body). In the tumors of the LFS pat ients, the normal allele is either lost or mutated, and only the mutant allele is retained. As a result, the tumor cells do not express any wt p53. corrected) cells form tumor s in nude mice. Stable cell lines can be obtained which express low levels of wt p53. In some cases, the cells grow more slowly in culture and are non-tumorigenic in nude mice. In other cases the cells grow normally in culture, but still are non-tumorigenic in mice. Sim ilarly, reintroduction ofwt p53 in p53-negative mouse yl mphoma cells causes a reduct ion of tumorigenicity in syngeneic mice. • 3. p53 knock-out mice. The mice appear healthy upon birth (with some specific exceptions- a percentage of femal e embryos die because of a defect in neural tube closure). Mice develop more or less normally, with no gross developmental defects after birth. However, within very few months, all mice develop cancer and die. The predominant type of cancer is lymphoma of T cell or igin. Induction of cell death by active p53 Parental M1 M1-p53Val135 clones at 32oC Activation of temperature sensitive p53 prevents transformation Myc + Ras + no p53 temperature sensitive p53 ts p53 in mutant conformation ts p53 in wild type conformation 100 1 N I 200 II Transactivation Proline rich III 300 IV Specific DNA binding Protein-protein interactions, Transcriptional repression apotosis V 393 C Negative regulation NLS1 of DNA binding Tetramerisation Most of p53 mutations are found in the conserved regions of the central DNA binding domain (Ko LJ & Prives C, Genes & Dev. 10:1054-1072, 1996) (Cho Y et al., Science 265:346-55, 1994) Activated p53 Transactivation p21/Waf1 Other genes Other activities (C terminal = TFIIH binding?) (N terminal = SH3 binding?) Bax, IGF-BP3, Fas, killer/DR5, Noxa, PIG3, p53AIP1, PIDD, Puma etc, etc, etc Apoptosis Growth arrest Growth arrest, apoptosis Functional p53 DNA damage, oncogene activation Loss of p53 function Three Experimental Systems 1. Primary and Secondary Targets of p53 2. Target genes related to apoptosis 3. Comparison of p53 and p73 A chip of 10,000 genes is more than ten thousand northern blots Filter hybridization MDM2 LIG1 PCNA p21 Representation of 7000 genes on 1 cm2 chip DIRECT AND INDIRECT TARGETS CHX INHIBITS PROTEIN SYNTHESIS AND PREVENTS ACTIVATION OF SECONDARY TARGETS Effect of Cycloheximide on H1299 val135 Cells Only ˜10% of the genes changed expression in all 3 repeats et al. 2000) Primary p53 target genes in presence of CHX 38 24 (Coller Clustering of 259 genes upregulated without CHX at least three times > 2.5 fold a. 9 genes (false?) b. All 38 primary c. 87% of primary p53 - Upregulated Genes in H1299-Val135 system GENE/ PROTEIN NAME p21waf1 MIC1 - member of TGF-b family MDM2 PCNA GADD45 Mitochondrial Stress 70 (Mortalin2) p57KIP2-CDK inhibitor 1C RATIO FUNCTION PIG3-p53 induced gene 3 FAS/APO1 BAX-Bcl2 associated X protein BAK1- Bcl2 antagonist/killer 1 11.0 3.8 3.7 1.5 38.0 10.0 8.3 CELL CYCLE 3.9 3.0 1.5 APOPTOSIS P53 - Upregulated Genes in H1299-Val135 system GENE/ PROTEIN NAME DDB2-Nucleotide Excision Repair LIG1 - DNA ligase 1 ERCC5 - DNA Excision Repair related TDG - G/T mismatch DNA Glycosylase RPA1 - Replication Factor A Protein 1 RATIO FUNCTION 6.5 DNA REPAIR 2.3 1.9 1.8 1.6 MAPK14 MAP4K5 Activaes Jun N-term Kinase MAP2K1 - MEK1 3.8 1.6 1.5 KINASE MYD88 - Myeloid differentiation Retinoic Acid Receptor Beta FKBP4 HOXD3 - Homeobox protein CSPG2 - Chondroitin sulfate proteoglycan 2 5.4 4.6 3.1 1.8 2.0 RECEPTOR DEVELOP. IMMUNOPHIL. DEVELOP. ECM p53- DRIVEN APOPTOSIS A different cell line (M1) that undergoes apoptosis by p53 at 32 APOPTOSIS : - Apoptosis is a genetically controlled program of cell death, also referred to as cell suicide or Programmed Cell Death (PCD). - It is an evolutionary conserved mechanism. - It ultimately leads to elimination of undesired cells •either superfluous •or potentially harmful when damaged - It plays an essential role during developmental as well as adult stages by allowing tissue remodeling, tissue renewal and maintenance of tissue homeostasis Pro apop Anti apop APOPTOSIS IN LTR6 CELLS AT 32C. Sub G1 SCATTER PLOTS OF 404 GENES THAT WERE REGULATED BY P53 IN LTR6 CELLS C B 2h M1 2h M1 12h LTR6 9h LTR6 A 2h M1 D 2h M1 Clustering of 404 genes based on expression kinetics at 32C Control Cell type Time (hr) M1 2hr M1 12 M1 12hr LTR6 2 6 M1 9 12 2 LTR6 2 LTR6 2hr M1 6 9 12 12 2 LTR6 6 9 12 A B C D E F Kinetics of transcriptional activation Relative ratio 120 100 Cluster E Cluster D Cluster C 80 60 40 20 0 M1 2 6 9 12 M1 2 6 9 12 M1 2 6 9 12 Apoptosis related genes upregulated by p53 H1299 Val Cells ACCESSION NO. X63717 U82987 U00115 U16811 MOUSE ACCESSION NO. AB021961 M83649 U82532 J04953 Z16410 AW060710 X74504 AF064071 RATIO OF EXPRESSION (12h) Fas/APO-1 cell surface antigen 9.8 Bcl-2 binding component 3 (bbc3) PUMA 30.5 Bcl-6 6.8 Bak 7.4 LTR 6 Cells p53 Fas antigen/TNFR6 TNFR18 Gelsolin Btg1 EST=PIG8 (Etoposide induced) T10 mRNA/human sentrin/SUMO-1 Apaf-1 HUMAN 57.8 54.5 11.3 2.9 9.0 6.2 4.3 7.2 ACCESSION NO. A1909620 X89101 A1923712 X04412 X61123 R11732 U83117 AL135220 Northern Analysis of LTR6 Cells Apaf-1 mRNA induced at 32 C by ts-p53 APAF-1 promoter contains p53 target at -604 bp 800 400 RRRCWWGYYY N{0-13 bp} RRRCWWGYYY APAF-1 AGACATGTCT GGAGACCCTAGGA cGACAAGCCC BAX tcACAAGTTa G AGACAAGCCT GADD45 GAACATGTCT AAGCATGCTg MDM2 GGACAcGTCC GGtCAAGTTg p53 Binding to APAF-1 Target by Gel Shift Analysis Others Oligo p53 Oligo Oligo Oligo Oligo A A: B: C: D: A + Ab A + x’sX x’sA A A A + + mut B C D + + + AGACATGTCTGGAGACCCTAGGACGACAAGCCC AGACATGTCT CGACAAGCCC AGACATGTCTGGAGAC CGACAAGCCC AGAaATGTCTGGAGACCCTAGGACGAaAAGCCC Apoptotic stimuli p53 Bax PUMA Bcl-2 Smac Cyt c /dATP Apaf-1 Caspase-9 IAPs Caspase-3 Cellular targets Apoptosis p53 p53 family members Comparison of p73 and p53 induced genes Scatter plot Activated p53 p21/Waf1 /Cip1 cyclin E, D, cdk 2,4,6 1 4 .3 .3 GADD4 5 p21 cdk inactivation Rb fam ily (active) cyclin B cdc 2 p21 Rb E2F (inactive) G1 arrest G2 arrest Melanoma p16 p16 CDK4 cy cD CDK4 Breast cy cD Retina, Lung RB P RB E2 F X E2 F G1 Active S