Download Pedro Miguel Azevedo Veloso Improving derived Listeria phage

Escola de Engenharia
Pedro Miguel Azevedo Veloso
Improving derived Listeria phage endolysins
properties at low temperatures
Outubro 2014
Escola de Engenharia
Pedro Miguel Azevedo Veloso
Improving derived Listeria phage endolysins
properties at low temperatures
Tese de Mestrado
Mestrado em Bioengenharia
Trabalho realizado sob a orientação de
Doutor Leon D. Kluskens
Outubro 2014
É autorizada a reprodução parcial desta tese apenas para efeitos de investigação, mediante
declaração escrita do interessado, que a tal se compromete,
Universidade do Minho, __ /__ /____
Assinatura:_________________________________________________
Aknowledgements
Agradecimentos
Agradecimentos
A vida é uma longa caminhada e, apesar de este ser apenas mais um capítulo que agora se encerra,
dela fazem parte várias pessoas. Pessoas essas que de forma direta ou indireta me ajudaram a
conseguir alcançar objetivos, metas. É a essas pessoas que expresso, de seguida, os meus sinceros
agradecimentos por me terem apoiado ao longo deste projeto.
Em primeiro lugar quero agradecer ao meu orientador, Doutor Leon Kluskens, por me ter dado a
oportunidade de estar presente num projeto científico ambicioso, por todo o conhecimento e
conselhos transmitidos, por ter permitido aumentar o meu gosto pela área da biologia molecular
assim como pela disponibilidade que sempre demonstrou ao longo de todo este projeto.
Agradecer à Graça, que desde o primeiro dia me ajudou de forma incansável, demonstrando sempre
enorme disponibilidade, espírito de entreajuda, apoio e compreensão mesmo nos momentos mais
difíceis. Obrigado pelo conhecimento e experiência transmitidos.
Agradecer ao Hugo, que apesar de ter entrado um pouco mais tarde no projeto, me ajudou com
todo o seu conhecimento, pragmatismo e criatividade ajudando a contornar obstáculos que, por
diversas vezes, se colocaram no caminho.
Aos meus colegas de laboratório: Luís, pelos conselhos prestados, boas conversas e momentos de
bom humor; à Catarina pela sua grande simpatia; ao José pelas boas conversas tecnológicas que
tivemos. À Marta e Patrícia, colegas de mestrado, pela sua prontidão e disponibilidade em ajudar.
Aos meus amigos de sempre, Pedro, Rui, João e Maria João pelo apoio prestado e pela boa
disposição em todos os momentos.
À Ana, meu ombro amigo, meu porto de abrigo, minha conselheira. Obrigado teu apoio incondicional
e preciosos conselhos transmitidos durante este capítulo da minha vida.
E por fim, o mais importante, à minha família, mãe, pai, irmã e avós. Obrigado por todo o esforço
que fizeram para que conseguisse alcançar os meus objetivos pessoais e académicos. Obrigado por
todo o apoio nos bons e maus momentos. Obrigado por me terem incutido desde sempre bons
valores humanos. Espero um dia conseguir retribuir-vos tudo aquilo que me deram. Ser-vos-ei
eternamente grato!
x
Abstract
Resumo
Abstract
Listeria monocytogenes is a Gram-positive opportunistic pathogen that can grow in a wide variety of
conditions and is responsible for listeriosis, a potential fatal disease, associated to the ingestion of
contaminated food. The concerns about the upsurge of widespread reported cases, combined with
emerging antibiotic-resistance amongst pathogenic bacteria, such as L. monocytogenes, demand for
the development of novel preservation techniques that ensure the safety of food products.
Endolysins, which originate from virulent bacteriophages, are responsible for the hydrolysis of the
covalent bonds in peptidoglycan layer of the host cell. These enzyme properties represents a good
alternatively approach against Gram-positive foodborne pathogens without altering the organoleptic
properties of food products.
However, in most of the cases, the activity and stability of naturally occurring enzymes is significantly
lower than the biotechnological industry needs. Besides, there is a lack of research advances in lytic
activity improvements of endolysins in food storage conditions.
The experimental work developed in the scope of this thesis aimed at directing endolysin activity
towards refrigeration temperatures against L. monocytogenes through the use of directed evolution
strategies – error-prone PCR and cryodrilling.
Different attempts were done for the isolation of listerial phages from livestock industries effluents
and consequently identification and improvement of lytic activity of its derived endolysins.
An in silico analysis of two different lysins – Ply500 and Ply511 – were performed to provide
contextualization about their structure and domains. Although both proteins possess modular
structure, Ply511 has a central catalytic domain and a not well characterized binding domain which
contrasts to Ply500 domain organization. Protein expression in large and micro-scales of wild-type
proteins was successfully done and confirmed by performing antibacterial tests against L.
monocytogenes 5725.
To enhance the activity of endolysins against L. monocytogenes cells, modified endolysins were
constructed by amplifying their sequences using error-prone PCR technique and cloning into pQE-30
vector. The cloned vectors were transformed in E. coli JM109 competent cells, however no colonies
were obtained.
At the same time, using PlyP100 endolysin, a second approach based on the biotic interaction
between phage-host at successively temperature was done to promote phage adaptation and
consequently enzymatic evolution.
xiv
Resumo
Listeria monocytogenes é um agente patogénico oportunista Gram-positivo, responsável por provocar
listeriose, doença potencialmente mortal associada ao consumo de alimentos contaminados. A
preocupação inerente à sua capacidade de sobreviver numa grande variedade de condições, o
crescente número de surtos da doença e o aumento da resistência a antibióticos obrigam a que
novas estratégias de conservação e preservação dos alimentos sejam desenvolvidas.
Endolisinas derivadas de fagos são enzimas responsáveis pela lise das células do hospedeiro. Uma
vez que não alteram as propriedades organoléticas dos alimentos, o uso destas enzimas representa
uma boa alternativa na eliminação de agentes patogénicos Gram-positivos.
Contudo, a baixa atividade e estabilidade das enzimas no seu estado natural torna-se incompatível
com as necessidades industriais.
Este trabalho experimental visou o melhoramento das propriedades líticas das endolisinas a
temperaturas de refrigeração recorrendo a técnicas de evolução direta – error-prone PCR e
cryodrilling.
Numa primeira abordagem foram efectuadas tentativas para o isolamento de fagos de Listeria a
partir de efluentes de indústria pecuária com posterior identificação e melhoramento das
propriedades líticas das respetivas endolisinas. No entanto, as tentativas não foram bem-sucedidas.
Foi efetuada a análise bioinformática das duas diferentes endolisinas – Ply500 and Ply511 – para
se obter informações precisas sobre a sua estrutura. Apesar das duas proteínas possuírem uma
estrutura modular, Ply511 apresenta um domínio catalítico central com função desconhecida e por
conseguinte, pouco caracterizado, relativamente à organização modular de Ply500. A expressão das
respetivas endolisinas wild-type em larga e micro escalas foi efetuada com sucesso e confirmada
através de testes antibacterianos contra L. monocytogenes 5725.
Para melhorar a atividade lítica das respetivas endolisinas, as sequências foram amplificadas por
error-prone PCR, clonadas no vetor pQE-30 e transformados em células competentes E. coli JM109.
No entanto, não foram obtidas quaisquer colónias.
Ao mesmo tempo, usando a endolisina PlyP100, uma nova abordagem baseada no princípio de
interação biótica entre fago-hospedeiro, foi efetuada a temperaturas sucessivamente mais baixas de
forma a promover a evolução/adaptação do fago e consequentemente da endolisina.
xv
Index
xvi
Index
Agradecimentos .......................................................................................................................... x
Abstract ..................................................................................................................................... xiv
Sumário ....................................................................................................................................... x
List of abbreviations .................................................................................................................. xxiv
List of figures .......................................................................................................................... xxviii
List of tables ............................................................................................................................. xxiv
CHAPTER 1 – Introduction and Background .............................................................................. 1
1. Listeria monocytogenes and listeriosis .................................................................................... 3
1.1. Adaptation mechanisms ................................................................................................ 4
1.2. Antimicrobial resistance ................................................................................................. 4
2. Bacteriophages as potential means to battle listeriosis ............................................................ 5
2.1. Listeria phages .............................................................................................................. 7
3. Endolysins ............................................................................................................................. 9
3.1. Different types of endolysis ............................................................................................ 9
3.2. Endolysin structure ...................................................................................................... 10
4. Strategies for endolysins improvement ................................................................................. 11
4.1. Phage adaptation “cryodrilling”.................................................................................... 12
4.2. Directed evolution: site-directed mutagenesis Vs. random mutagenesis ........................ 12
4.3. Site-directed mutagenesis ............................................................................................. 13
4.3.1. Domain swapping .............................................................................................. 14
4.4. Random mutagenesis for in vitro directed enzyme evolution ......................................... 15
4.4.1. Chemical mutagenesis....................................................................................... 15
4.4.2. Mutator strains .................................................................................................. 16
4.4.3. Site-saturanting mutagenesis ............................................................................. 16
4.4.4. Error-prone PCR ................................................................................................ 17
5. Advances in molecular engineering of endolysins .................................................................. 18
5.1. Advances using site-directed mutagenesis .................................................................... 19
5.1.1. Advances using domain-swapping ..................................................................... 19
5.2. Advances using random-mutagenesis .......................................................................... 20
6. Main goals of this work ........................................................................................................ 21
xviii
CHAPTER 2 – Materials and Methods ..................................................................................... 25
1. Bacterial strains, endolysins and plasmids ........................................................................... 25
2. Listeria phage isolation ........................................................................................................ 26
2.1. Non-lysogenic strains selection ..................................................................................... 26
2.2. Effluent samples and phage detection .......................................................................... 27
2.3. Phage isolation and propagation ................................................................................... 27
3. Protein production ............................................................................................................... 28
3.1. Large-scale production ................................................................................................. 28
3.1.1. Culture and induction ........................................................................................ 28
3.1.2. Cell lysis............................................................................................................ 28
3.1.3. Purification ........................................................................................................ 28
3.1.4. Polyacrylamide gel electrophoresis (SDS-PAGE) ................................................. 29
3.1.5. Protein quantification ......................................................................................... 29
3.2. Micro-scale protein production experiments .................................................................. 30
3.3. Host preparation and antibacterial assays ..................................................................... 30
4. Bioinformatic tools ............................................................................................................... 31
4.1. In silico analysis of bacteriophage endolysins ................................................................ 31
4.2. Primers design ............................................................................................................. 32
5. Cloning ................................................................................................................................ 32
5.1. Polymerase chain reaction (PCR) techniques ................................................................ 33
5.1.1. Error-prone PCR ................................................................................................ 33
5.1.2. Colony-PCR ....................................................................................................... 33
5.2. Plasmid extraction and digestion .................................................................................. 34
5.3. Ligation ........................................................................................................................ 35
5.4. Agarose gel electrophoresis .......................................................................................... 35
6. Transformation .................................................................................................................... 35
6.1. Competent cells ........................................................................................................... 36
6.1.1. Chemio-competent cells .................................................................................... 35
6.1.2. Electrocompetent cells ...................................................................................... 36
6.2. Transformation and plasmid replication ........................................................................ 36
6.2.1. Heat-shock transformation ................................................................................. 36
6.2.2. Electroporation .................................................................................................. 37
xix
7. Directed evolution screening assay ....................................................................................... 37
7.1. Mutant libraries ............................................................................................................ 37
7.2. Screening tests ............................................................................................................. 37
7.2.1. Low temperature tests ....................................................................................... 38
7.2.2. High salt conditions ........................................................................................... 38
8. Cryodrilling .......................................................................................................................... 39
CHAPTER 3 – Results and Discussion..................................................................................... 41
1. Background ......................................................................................................................... 45
2. Listeria phage isolation......................................................................................................... 45
3. In silico analysis of bacteriophage endolysins........................................................................ 46
4. Protein expression preliminary tests ..................................................................................... 48
4.1. Large-sclae protein production ...................................................................................... 48
4.2. Micro-scale protein expression and preliminary tests ..................................................... 48
4.3. Lytic activity – Low temperatures vs. Room temperatures .............................................. 51
5. Cloning ................................................................................................................................ 52
5.1. Gene amplification ........................................................................................................ 52
5.2. Plasmid linearization and ligation .................................................................................. 54
5.3. Transformation ............................................................................................................. 54
6. Cryodrilling .......................................................................................................................... 56
CHAPTER 4 – Conclusions and Future Perspectives ................................................................ 59
1. Conclusions and future perspectives ........................................................................................ 63
Bibliography.......................................................................................................................... 66
Annexes ............................................................................................................................... 76
xx
List of abbreviations
BCA - Bicinchoninic acid assay
CaCl2 – Calcium chloride
CBD – Cell-Binding Domain
CEB – Centre of Biological Engineering
DLA – Double-layer agar
DNA – Desoxyribonucleic Acid
ds – Double-stranded
ECD – Enzymatic Catalytic Domain
ECDC – European Centre Disease Prevention and Control
EFSA – European Food Safety Authority
ep – Error-prone
FDA – U.S. Food and Drug Administration
GAD – Glutamate Decarboxylase System
GlcNAc – N-acetylglucosamine acid
GRAS – Generally Recognized as Safe
ICTV – International Committee on the Taxonomy of Viruses
IPTG – Isopropyl β-D-1-thiogalactopyranoside
LB – Lysogeny Broth
mDAP – meso-2,6-diaminopimelic acid
MurNA – N-acetylmuramic acid
PBS – Phosphate Buffered Saline
PCR – Polymerase Chain Reaction
PEG – Polyethyleneglycol
PG – Peptidoglycan
PPI – Protein-protein interactions
RCA – Rolling-circle
rT – Room temperature
RM – Random Mutagenesis
RNA – Ribonucleic Acid
xxiv
SDM – Site-Directed Mutagenesis
SDS-PAGE - Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis
ss – Single-stranded
SSM – Site-Saturating Mutagenesis
Tm – Melting temperature
Tris – Tris(hydroxymethyl)aminomethane
TAE – Tris-Acetate-EDTA
TSB – Tryptic Soy Broth
xxv
List of figures
Chapter 1
Figure 1 – Phage life cycle: lytic and lysogenic. Phage attaches to host and injects genetic material.
In lytic cycle the genomic material is transcripted and replicated by replication and protein synthesis
mechanisms of the host cell used to assemble new phage particles and subsequent release by
cellular lysis. In the lysogenic cycle the phage genome integrates chromosomal DNA of the host
without cell death Adapted from Campbell (2003). ...................................................................... 6
Figure 2 - Representation of peptidoglycan differences between Gram-positive (left) and Gramnegative (right) cells and different type of endolysins mode of action. 1) Glycosidases; 2)
Muramidases; 3) lytic transglycosidases; 4) Amidases; 5), 6), 7) e 8) Endopeptidases. Withdrawn
from Oliveira et al., (2012) ......................................................................................................... 10
Figure 3 – Overview of the QuickChange Lightning site-directed mutagenesis method. ................ 14
Figure 4 – Diagram scheme comparing the most conventionally random mutagenesis procedures to
ep-RCA evidencing the complexity and time-consuming of each method. ..................................... 18
Chapter 2
Figure 1 - Representation scheme of pQE30 cloning vector used to clone the endolysins sequences
of ply500 and ply511 ................................................................................................................. 25
Figure 2 - 96-wells plate scheme of antibacterial assay against L. monocytogenes 5725 using Ply500
expressed in micro-scale conditions. Protein expression was tested for 24 and 48 h. Endolysin 68
was used as positive control against outer membrane permeabilzed of P. aeruginosa cells. Negative
controls are present in dashed lines wells. Blue wells represents protein expression in 4mL tube;
yellow wells the protein expression in micro-scale; green wells protein expression of 200 µL collected
from 4 mL expression tube and pink wells represent the protein production in 1 mL collected from
four wells. ................................................................................................................................. 31
Figure 3 - 96-wells plate scheme of antibacterial assay against L. monocytogenes 5725 using Ply500
expressed in micro-scale conditions. Protein expression was tested for 24 and 48 h. Endolysin 68
was used as positive control against outer membrane permeabilzed of P. aeruginosa cells. Negative
controls are present in dashed lines wells. Blue wells represents protein expression in 4mL tube;
yellow wells the protein expression in micro-scale; green wells protein expression of 200 µL collected
xxvi
from 4 mL expression tube and pink wells represent the protein production in 1 mL collected from
four wells. ................................................................................................................................. 38
Chapter 3
Figure 1 – SDS- PAGE electrophoresis gel 12%, stained with Coomassie Blue, for Ply511 (A) and
Ply500 (B) proteins. M, Protein Ladder (10-250 kDa) from NEB; F1, 2, 3, and 4, fractions 1, 2, 3
and 4 of eluted proteins; W, wash; FT, flow through. The proteins were eluted with elution buffer
containing 250 mM imidazole concentration............................................................................... 48
Figure 2 - Antibacterial assays of Ply500 endolysin against normal and permeabilized L.
monocytogenes 5725 cells. The endolysins were expressed in 4 mL broth and cell lysis was done by
sonication (A). Protein expression was done in 5 wells (200 µL each well) then joined (1 mL) and
sonicated (B). Endolysins were expressed in 200 µL of a 96-wells plate (C). Also protein expression
was induced in 4 mL broth (D). Next 200 µL were transferred to 96-wells. Cell lysis was done by
chloroform vapors. In all the cases the expression conditions were 16°C during 24 h or 48 h with
1.5 mM IPTG concentration. E. coli JM109 wild-type was used as negative control. ..................... 49
Figure 3– Kinetics of antibacterial assays of Listeria phage endolysins Ply500 and Ply511 at
refrigeration temperatures (A) and room temperatures (B). Negative control was done using 180 µL
bacterial suspension mixed with 20 µL of PBS. ........................................................................... 51
Figure 4. – PCR of amplified protein genes using temperature gradient between 55-65°C. Gradient
temperatures from left to right: 55°C, 57°C, 60°C, 62°C, 65°C. Agarose gel 1% concentration,
stained with Sybr Safe and run at 90 V. Legend: M – DNA 1 kb ladder. ....................................... 52
Figure 5 – Amplified endolysins sequences by ep-PCR. The generated products possess 1020 bp
(plyP500) and 1176 bp (plyP511) and were then double digested by using selected restriction
enzymes and purified. Agarose gel 1% concentration, stained with Sybr Safe and run at 90 V. Legend:
M – 1 kb ladder. ........................................................................................................................ 53
Figure 6 – Double digestion of pQE-30 cloning vector in agarose gel 0.7% concentration in order to
promote better separation of digested plasmid The gel was stained with Sybr Safe and run at 90 V.
Legend: M – DNA 1 kb ladder. ................................................................................................... 54
Figure 7 – Representative illustration pQE-30 vector cloned with ply500 (A) and ply511 (B) using
Vector NTI software. The ligation generates two plasmids with different lengths – 4039 bps and 4465
bps, respectively. Both genes are cloned between BamHI and SalI restriction sites...................... 55
xxvii
Figure 8 – Colony-PCR results after “heat-shock” transformation using NZY5α E. coli competent
cells. Only pQE-30 + ply500 ligation were assembled by competent cells. Agarose gel 1%
concentration, stained with Sybr Safe run 90 V. Legend: M – DNA 1 kb ladder. ........................... 56
Figure 9 – PCR of amplified endolysins sequences derived from co-evolved (wells 1-5) and evolved
(wells 6-10) adapted phages. Amplified products were visualized by 1% agarose gel, stained with
Syber Safe, at 90 V. The marker (M) is 1 kb ladder. .................................................................... 57
Figure 10 – Example of sequencing chromatogram of adapted plyP100 endolysin derived from coevolutionary adapted phage. The putative mutations are highlighted. PlyP100CE1_Fw and
PlyP100CE_Rv are the primers used for gene sequencing. ........................................................ 59
xxviii
List of tables
Chapter 2
Table 1 - L. monocytogenes pathogen strains, references and serovars used for phage isolation.. 40
Table 2 - Designed primers for endolysins sequences amplification. ply500 (primers 1 e 2) e ply511
(primers 3 e 4). Underlined are shown the restriction sites for enzymes BamHI and SalI. Melting
temperatures also are present in this table. ................................................................................ 26
Table 3 – PCR conditions for amplification of ply500 and ply511 endolysins sequences in ErrorProne PCR and Colony-PCR. The volumes were calculated for 50 µL of final reaction volume. .... 34
Table 4 – Used primers for amplification of the PlyP100 endolysins derived from phage adapted
assays. This primers were already available in the group primers collection. Underlined are shown
the restriction sites for enzymes NcoI and BamHI, respectively.. ................................................. 39
Table 5 – PCR conditions for amplification of plyP100 from phage adapted endolysins. The volumes
were calculated for 30 µL of final reaction volume. The initialization step at 95°C during 10 minutes
was used in order to promote the release of phage DNA. ............................................................ 40
Chapter 3
Table 1 – Putative binding and catalytic domains for Ply500 and Ply511 endolysins. ................... 47
Table 2 – Amplified plyP100 sequences of the 5 different phage plaques isolated from Co-Evolution
(CE) and Evolution (E) populations. Once amplified the sequences were aligned and compared to the
original plyP100. Point mutations are observable at specific positions. Legend: A – adenine, T –
thymine, G – guanine, C – cytosine, * – absence of nucleotide. ................................................. 58
xxix
Chapter 1
Introduction and
Background
CHAPTER 1
INTRODUCTION AND BACKGROUND
1. Listeria monocytogenes and listeriosis
The genus Listeria is an important group of Gram-positive and anaerobic bacteria with low G+C
content and it is closely related to Bacillus, Clostridium, Enterococcus, Streptococcus and
Staphylococcus [1]. It can be isolated from various sources, such as soil, water, effluents and human
and animal faeces [2]. Currently it is divided into six species: L. monocytogenes, L. ivanovii, L.
seeligeri, L. innocua, L. welshimeri, and L. grayi.
L. monocytogenes it is classified as psychrotolerant organism as its optimal growth temperature can
vary between 30 and 37ᵒC. It is considered to be highly pathogenic causing listeriosis, a foodborne
illness that can induce death (20-30% of fatality rate) especially in risk groups such as elderly,
pregnant women and other people with impaired immune system. In this case invasive listeriosis
can be triggered causing meningitis, meningoencephalitis, endocardiditis,septicemia, premature
births, neonatal listeriosis, stillbirths or misbirths [3][4][5] . Non-invasive listeriosis can cause gastrointestinal infections and mainly affects healthy individuals.
It is associated with the ingestion of contaminated food mainly in a wide variety of ready-to-eat foods
such as milk, seafood, fish products, meats and meat products [6]. However, the consumption of
soft cheese and seafood is the main responsible for the most human listeriosis cases reported [7].
Since 1960’s decade the listeriosis has become more widespread which has been correlated to the
increased use of refrigerators, consumption of processed foods and extension of shelf-life food
products. According to most recent reports from the European Food Safety Authority (EFSA) and the
European Centre Disease Prevention and Control (ECDC) the number of cases with listeriosis
infections in Europe is on the increase from 0.1 cases per 100.000 in 2000 to 0.3 cases per
100.000 in 2006. It also refers to Germany, Ireland, Lithuania, the Netherlands, Spain and United
Kingdom (UK) as the countries with highest number of infections in the same period [8].
However the increasing demand of consumers for clean-label products in most recent years also has
led to a greater scientific investigation, which consequently increased the characterization of this
pathogen becoming a well-studied model.
Not all strains of L. monocytogenes are equally capable to cause disease in humans and only four
serovars – 1/2a, 1/2c, 1/2b and 4b – of the 13 identified for this strain are responsible for 98% of
the reported listeriosis cases. The strains with 4b serovar are responsible for most food-borne
outbreaks of listeriosis and for the sporadic cases which can suggest that this serovar can possess
unique mechanisms of virulence [9].
3
CHAPTER 1
INTRODUCTION AND BACKGROUND
1.1.
Adaptation mechanisms
In food industry usually low temperatures, low pH conditions and high salt concentrations are the
common conditions in order to preserve food products. However, L. monocytogenes has the ability
to generate adaptation mechanisms to maintain its activity, stability and growth, making it difficult to
control this pathogen in the food industry [10]. At low temperatures the mechanisms consists mainly
in changing the membrane composition increasing unsaturated and shortening fatty acids chains
[11], production of cold shock proteins [11][12] and accumulation of solutes as cryoprotectants
[13][14]. For survival under acidic stress the induction of specific proteins (GroEL, ATP synthase and
transcriptional regulators) [15], mechanism of pH homeostasis achieved by proton transport chain,
the glutamate decarboxylase system (GAD) [16] and the two-component regulatory system LisR/
LisK [17] are the main mechanisms of adaptation in low pH conditions. The pathogen also possess
osmoadapation mechanisms such as the induction of salt shock proteins, accumulation of
compatible solutes such as glycine betaine, proline betaine, acetyl carnitine, carnitine, ϒbutyrobetaine as osmoprotectants. Furthermore, this bacteria has the ability to change the
expression levels of transcription genes under adverse conditions through the association of the
alternative sigma factor with RNA polymerase core [10].
1.2.
Antimicrobial resistance of L. monocytogenes
The current treatment for listeriosis for immunocompromised patients is based on the application of
high doses of β-lactam antibiotics (ampicillin or penicillin) alone or in association with aminoglycoside
(gentamicin). For allergic people to β-lactam antibiotics the treatment consists in the combination of
trimethoprim with sulfonamide [18].
Usually L. monocytogenes is susceptible to a wide range of antibiotics, however, some recent studies
reported an increasing antimicrobial resistance to one or more relevant antibiotics in environmental
isolates [19][20][21]. In animals the use of antimicrobials can lead to new potential development of
antimicrobial-resistant zoonotic foodborne bacterial pathogens, such as L. monocytogenes, that can
subsequent be transmitted to humans as food contaminants.
Furthermore, spontaneous mutations of this foodborne pathogen agent or gene transfection between
antibiotic-resistant bacteria and L. monocytogenes cells may contribute to the increasing of
antimicrobial resistance and subsequent spreading in environment and food.
4
CHAPTER 1
INTRODUCTION AND BACKGROUND
2. Bacteriophages as a potential means to battle listeriosis
Bacteriophages or phages are viruses that infect specific bacterial cells and represent one of the
most abundant biological entities in nature and have been recognized by their potential use as
therapeutic agents in alternative to antibiotics [22]. The history of phages started over a century ago
(1986) when Ernest Hankin observed bacteriocidal activity against Vibrio cholera from filtered and
collected water from Ganges and Jumma River, in India. Almost 20 years after the first observations
by Hankin, two investigators, Frederick Twort, an English bacteriologist, and the French-Canadian
microbiologist Felix d’Herelle reintroduced the subject and independently identified filterable and
transmissible viral particles responsible for bacterial lysis. However, only d’Herelle continue to pursuit
this findings and named the viral particles as bacteriophages [23][24].
Phages are omnipresent and accidentally consumed through the ingestion of food or water, they are
presumed to be safe as undesirable effects have not been detected. Their different genome sizes,
from 17 kpb to 0.5 Mbp and the high frequency of novel genes found in newly characterized phage
genomes proof that bacteriophages are genetically extremely diversified. This genetic diversification
represent a great advantage in infection role as the ability of phages to evolve and circumvent the
defense mechanisms of the host is higher [25].
Bacteriophages are constituted by a protein or lipoprotein coat, called capsid, with different shapes
and sizes that encloses nucleic acid genome which can be single-stranded (ss) or double-stranded
(ds), circular or linear, DNA or RNA. The International Committee on the Taxonomy of Viruses (ICTV)
is responsible for the phage classification that is based on the properties of the virion as morphology
and type of nucleic acid form. Currently, over 5,500 phages are known, divided and recognized by
ICTV into one order and 14 families, among which 96% are tailed (belongs to Caudovirales order)
and possess double-stranded DNA (dsDNA) enclosed in icosahedral symmetry heads and three
different tails lengths subdivided in Myoviridae (25%) with contractile tails, Siphoviridae (61%) with
noncontractile and long tails and Podoviridae (15%) with short tails [26]. The remaining phages are
“cubic”, filamentous or pleomorphic and possess ssDNA, ssRNA or dsDNA as genome and represent
4% of phage population.
As a virus, phages are obligatory parasites and needs to infect the host cells. To be able to infect
host cells, phages attach to the cell through specific receptors in membrane surface using
mechanisms that depends of the virion morphology. The most usual mechanism consists in tail
contraction and enzymatic degradation of small portion of cell membrane allowing injection of genetic
material. Using the replication mechanisms of the host the synthesis of new phage particles occurs
5
CHAPTER 1
INTRODUCTION AND BACKGROUND
which are released by the action of produced lytic proteins responsible for cell lysis (lytic cycle).
Phage infection follows the lysogenic cycle, when phage infection leads to the integration of genetic
information into the chromosome of the bacterial host without cell death. In lysogenic cycle the phage
genome will assume a quiescent state called prophage coexisting in a stable form with the host. The
two possible life cycles of phages can be observed in Figure 1.
Fig. 1 – Phage life cycle: lytic and lysogenic. Phage attaches to host and injects genetic material. In lytic cycle the genomic
material is transcripted and replicated by replication and protein synthesis mechanisms of the host cell used to assemble
new phage particles and subsequent release by cellular lysis. In the lysogenic cycle the phage genome integrates
chromosomal DNA of the host without cell death Adapted from Campbell et al., (2003) [27].
6
CHAPTER 1
INTRODUCTION AND BACKGROUND
2.1.
Listeria phages
The first reports of specific L. monocytogenes phages date from 1940 and 1960. Currently more
than 500 Listeria specific phages have been isolated and characterized mainly in the course of phage
typing studies.
Usually the described Listeria-specific bacteriophages possess dsDNA genomes with sizes between
30-65 kb but a few possess larger genomes (124-140 kb). All Listeria phages belong to Caudovirales
order featuring long noncontractile tails (Siphoviridae family) or with complex contractile tails
(Myoviridae family). However, no Listeria specific podoviruses have ever been isolated which can be
related to the low diversity of morphological structure of this bacterial cells [28] [29].
Listeria bacteriophage genomes contain one module responsible for the encoding of structural
proteins, another responsible for encoding DNA functions as recombination, replication and repair.
It also contain a lysis cassette which contains holin and endolysin genes. A lysogeny control region
with the integrase gene is present in case of the temperate phages, which is responsible for mediate
integration of the phage genome into the chromosomal host genome and excision in induction
conditions. In fact many Listeria phages are temperate and most of them are capable of generalized
transduction [28].
There is already some application of Listeria phages in food industry although this application as
biocontrol of bacteria require some specific characteristics: phage must be strictly virulent, feature a
broad host-range, unable to perform generalized transduction, does not affect the pathogenicity or
virulence of the host and also does not integrate its genome on the genetic material of the host [30].
The well characterized Listeria phage P100 is already used as a biocontrol agent product and it
acquired the Generally Recognized as Safe (GRAS) status by U.S. Food and Drug Administration
(FDA). Furthermore P100 phage has been showing some interesting properties, displaying high
efficacy by removing Listeria contaminations from fish and cooked ham and Listeria biofilms in steel
surfaces [31][32][33].
There are also other FDA-approved anti-Listeria products such as a six-phages cocktail. This cocktail
was allowed to reduce Listeria occurrence in food production facilities of fresh cut produce and
melons [34]. Some other studies also showed interesting lytic properties of A511 phage against
Listeria contaminations on various ready-to-eat food samples providing up to 5 log reduction of this
foodborne pathogenic cells [35].
Despite showing many advantages, the use of lytic phages as biocontrol agents in food industry
remains unclear, especially in European countries where it remains uncertain whether phages can
7
CHAPTER 1
INTRODUCTION AND BACKGROUND
be considered as processing aids or as decontaminants or additives [36]. Furthermore, the lack of
studies about phage application in food industry performed in specific preparation, processing and
storage conditions is considered to be an obstacle for its application in this field [22].
An alternative way to phage application consists in the use of its recombinant encoded peptidoglycan
hydrolases (endolysins) which can be easier to approve than virus-based food additive. Endolysins
have no effect on the original organoleptic and texture properties on food and act as an innocuous
substance for human consumption, making these type of enzymes a good candidate for control of
foodborne pathogens [37].
3. Endolysins
The name endolysin was first coined in 1958 with the aim to designate a proteinaceous lytic
substance synthesized inside bacterial cells during phage multiplication and infection stage [38].
Endolysins are dsDNA bacteriophage encoded lytic enzymes that target the integrity of the cell wall
and degrade its main constituent, peptidoglycan (PG), causing cell lysis and the consequent release
of the bacteriophage progeny [39][40].
During phage infection lysins are produced and accumulated in the cytoplasm, however as they do
not have signal sequences to be translocated through the cell membrane this movement is controlled
by a holin. The holin is typically expressed in the late stages of the lytic infection cycle, forming a
pore in the cell membrane allowing cytoplasmic lysins to access the peptidoglycan, causing cell lysis
[41][42][43].
Endolysins are also capable to digest the cell wall when applied exogenously, especially in Grampositive organisms, such as L. monocytogenes, and can lyse the cell wall of healthy and uninfected
cells, originating the “lysis from without” phenomenon [39][44]. It proved its ability to be used as
alternative antimicrobial agents [40].
Numerous studies have been demonstrating the potential application of phage derived endolysins as
biocontrol agents in foods which has been considered a good alternative over other antimicrobial
agents. Their high specificity for the target pathogen leaves the natural and desired flora of the food
products untouched. Due to their proteinacious nature endolysins are noncorrosive and
biodegradable [45].
These applications of lysins as biocontrol agents against foodborne diseases have been recently
reviewed [46]. The first and more obvious approach in control strategy consists in the application of
purified endolysins to food products.
8
CHAPTER 1
INTRODUCTION AND BACKGROUND
Some studies have reported the staphylococcal phage endolysin LysH5 [47] rapidly showed great
lytic activity in pasteurized milk, reducing bacterial numbers below the detection level within 4 h. Also
streptococcal lysins B30 [48] and Ply700 [49] and the Clostridium butyricum phage ΦCTP1 [50]
lysin reported to be high lytic activity in milk and milk products. The three Listeria phage endolysins
Ply118, Ply511 and PlyP35 exhibit high thermoresistance which is a very important characteristic
for products that undergo heat treatment such as pasteurized milk products [51].
Another approach is the production and release of this endolysins in starter organisms in
fermentation processes. This alternative has been reported for derived Listeria and Clostridium phage
endolysins, although no studies of application in food has been yet demonstrated [52][53][54].
In conclusion, phage endolysins represent a good alternative for the control of foodborne pathogens.
However some tests are required to verify their stability on other food products and consumer safety.
Physiochemical conditions where these type of biocontrol agents act, must be first evaluated as well.
Furthermore, it has to be economically attractive possible to justify an investment of it application in
food industry [55].
3.1.
Different types of endolysins
The cell wall is responsible for maintaining the shape and physical integrity, protecting against
mechanical damage and osmotic rupture. Peptidoglycan is the main constituent and it is composed
of several chains of N-acetylmuramic acid and N-acetylglucosamine residues, linked together by β1,4-glycosidic bonds, connected to a short stem tetrapeptide side chains [40][55].
Adjacent tetrapeptides may be cross-linked by an interpeptide bond (in Gram-negative bacteria) or
by an interpeptide bridge (in Gram-positive bacteria) [40].
In Gram-negative bacteria the cell wall is relatively thin (10 nm) and is composed by single layer of
PG surrounded by an outer membrane. In these organisms, lactyl ether connects the glycan
backbone to a peptide side chain that contains mostly L- and D-amino acids [56].
In Gram-positive bacteria, the cell wall is thick (15-80 nanometers), consisting of several layers of
PG. Running perpendicular to the PG sheets is a group of molecules called teichoic acids which are
unique for these organisms. In this case the cell wall it is considerably more diverse in length and
composition coinciding with many different peptide arrangements among PG.
Peptidoglycans may vary the amino in position 3 of the tetrapeptide, defining two types of PGs: meso2,6-diaminopimelic acid type (mDAP-type) in Gram-negative and some Gram-positive species (i.e. L.
monocytogenes) and a l-Lysine type (Lys-Type) typical for Gram-positive species [55][57].
9
CHAPTER 1
INTRODUCTION AND BACKGROUND
Therefore, endolysins can be divided in five classes according to their enzymatic specificity.
Glycosidases (Fig.2, target 1) cleave the glycan component at the reducing end of Nacetylglucosamine (GlcNAc) [58] or at the reducing end of N-acetylmuramic acid (MurNAc) [59].
Muramidases/lysozymes (Fig. 2, target 2) share the same glycan target as the lytic transglycosidases
(Fig. 2, target 3), however both form different products. The 1,6-anhydro bond is formed instead of
the muramic acid residue, due to absence of water that is important for correct function of
transglycosidase activity [60]. N-acetylmuramoyl-L-alanine amidases (Fig. 2, target 4) cut the amide
bond between N-acetylmuramic acid residues and L-amino acid residues. These types of endolysins
are responsible for the strongest destabilization effect in the peptidoglycan layer. Endopeptidases
(Fig. 2, target 5, 6, 7 and 8) cleave the peptides moieties attacking LD- and DD-bonds.
Fig. 2 - Representation of peptidoglycan differences between Gram-positive (left) and Gram-negative (right) cells and
different type of endolysins mode of action. 1) Glycosidases; 2) Muramidases; 3) Transglycosidases; 4) Amidases; 5), 6),
7) e 8) Endopeptidases. Withdrawn from Oliveira et al., (2012) [55]
3.2.
Endolysin structure
Generally, the sizes of phage endolysins are between 25 and 45 kDa. The only exception is the 114
kDa streptococcal bacteriophage C1 endolysin, PlyC, as it is a multimeric lysin with globular structure
[61]. Endolysins can vary in their molecular structure, modular or globular, and in their domain
orientations.
10
CHAPTER 1
INTRODUCTION AND BACKGROUND
The typical feature for all Gram-positive phage endolysins is their two-domain structure also called
modular structure which is composed by an enzymatic catalytic domain (ECD) at the N-terminal and
the cell wall binding (CBD) domain at the C-terminal [39][41][44]. A few endolysins which have a
modular organization display an inverted structure, with the ECD at the C-terminal and CBD at the
N-terminal.
Gram-negative derived phage endolysins usually presents a globular structure with only ECD.
The evolutionary explanation for the occurrence of CBD domains only in Gram-positive endolysins is
based on previous studies by Fischetti et al., (2008) [41] and Loessner et al., (2002) [62] which say
that CBD domain binds irreversibly to the cell wall preventing the lysis of surrounded cells before the
new phage particles release. Thus it can be said that phages are induced to produce right amounts
of enzymes to induce the cell lysis. This phenomenon is not verified in Gram-negative bacteria
because the presence of the protective outer membrane inhibits the external lysin treatment.
The ECD function consists in the cleavage of the bacterial cell wall while the CBD is responsible for
the substrate recognition after cell binding. The main advantage of modular organization is that it
enables the specificity binding and the enzyme activity in an independent way, enabling the
substitution of either domain with other domain from another enzyme [63][64]. Furthermore, some
interesting studies have demonstrated that some endolysins acquired more than a single ECD, such
as endopeptidase/amidase lysin from the phage phi11 and endopeptidase/muramidase from
Streptococcus agalactiae bacteriophage B30 Hermoso (2003) [65] and Pritchard (2004) [59].
4. Strategies for endolysins improvement
Natural evolution results in a large number of enzyme variants which exhibit their specific function
and efficiency adjusted only to perform under physiological activities. Therefore, naturally occurring
enzymes often lack features necessary for biotechnology industry applications. In this field this study
pretends to accelerate the evolutionary process of a well-adapted endolysin to the most adversal
conditions in food industry more specifically at low temperatures and high salt and low pH conditions.
The strategies consists in phage adaptation at successively low temperatures, also known as
cryodrilling and one of the most used random mutagenesis technique, error-PCR. However some
other methods for directed evolution are presented in this section in order to individually compare
the advantages of each technical approach.
11
CHAPTER 1
INTRODUCTION AND BACKGROUND
4.1.
Phage adaptation – “Cryodrilling”
Interactions in many host-parasites are influenced by biology and environment conditions. The
pathogenic parasites impose selection for resistant hosts which in turn impose selection for infective
parasites resulting in rapid antagonist coevolution.
According to the Red Queen hypothesis these biotic interactions give rise to continual natural
selection for adaptation and counter-adaptation playing an important role in molecular evolution and
consequently in population dynamic [66].
There are two types of antagonistic coevolution: the “arms race” dynamics, leading to broader
resistance range in the host against a greater number of parasite genotypes and an increased
variability of host allowing the infection of most host genotypes; and the fluctuating selection
dynamics, favoring hosts that resists to the most common parasite phage genotypes, not contributing
for directional evolution of host range.
Coevolutionary dynamics between hosts and parasites is increasingly investigated using experimental
evolution. The most used model for antagonistic coevolutionary studies are bacteria and their lytic
phages.
Pseudomonas fluorescens SBW25 and its lytic phage ϕ2 is the most studied model of bacteriaphage evolution given deeper knowledge about this process and coevolution interactions. Although
it is important to diversify this coevolutionary studies to other host-parasite dynamics with particularly
importance in human health as they can be applied as biocontrol agents [67][68][69].
4.2
Directed evolution: site-directed mutagenesis Vs. random mutagenesis
Two contradictory tools can be used on a molecular level: rational protein design and directed
evolution. The first method requires extensive information about relationships between sequence
structures, mechanisms and function of the enzyme. Directed evolution concept was first introduced
in 1967 [70]. It is a laboratory in vitro process responsible for the generation of proteins, enzymes,
metabolic pathways and entire genomes with desired properties under different conditions, such as
extreme temperatures, pH and salinity [71]. Directed evolution implements an iterative Darwinian
optimization process, whereby the fittest variants are selected from an ensemble of random
mutations [72]. Despite the advances to date on the industrially enzymes, the most challenging part
of the directed evolution experiment consists in the development of generic screening or selection
tools, identifying novel enzymes activities more efficiently [73][74].
12
CHAPTER 1
INTRODUCTION AND BACKGROUND
Our understanding of protein function has been enhanced significantly since the early 1980s, due to
the advent of site-directed mutagenesis (SDM) and random mutagenesis (RM).
The use of SDM for the generation of mutations at specified sites within a known polynucleotide
sequence is an extremely common process nowadays, providing a very powerful tool for the
manipulation of sequences and structures.
However, there are certain limitations associated with this technique such as lack of sufficient
structural information or the need to know which sites within a molecule should be investigated in
detail.
At that point, RM has proved to be very useful to identify functional sites within a protein or nucleic
acid sequences. Moreover, RM can provide the opportunity to screen proteins, which has previously
been determined, for structurally important residues or sites, without introducing the selective bias
typical of directed approach. RM also allows the study of regulatory nature and structural features of
nucleic acid sequences, such as promoters, enhancers, ribosome binding sequences, transcription
termination sequences, structures and functions of transfer and ribosomal RNA, the processes
involved in viral assembly, in the primary transcript splicing and the initiation of nucleic acid
replication. When combining RM technique with later measurements large and useful amounts of
important information can be obtained that suggest targets in order that a site-specific or random
oligonucleotide approach can be posteriorly directed [75].
4.3
Site-directed mutagenesis
SDM has a variety of applications and is an important tool in molecular biology that has revolutionized
the study of gene regulation and protein structure-function relationship [76]. The SDM techniques
can be grouped into two major categories: polymerase chain reaction (PCR)-based or non-PCR-based
[77].
The first, also known as single-primer, uses an oligonucleotide complementary to part of single-strand
DNA. The primer contain an internal mismatch to promote the desired mutation. However, because
of the several limitations of this method, low and variable mutants were obtained, which forced the
use of suitable screening approaches to identify mutants [75].
The second strategy, denominated by “cassette mutagenesis” refers to the replacement of a region
of interest with a synthetic mutant fragment generated by annealing complementary oligonucleotides
[78] or by hybridization and ligation of a number of oligonucleotides [79]. The main disadvantages
of this method is that in most of the cases, it needs at least two rounds of primer-based mutagenesis
13
CHAPTER 1
INTRODUCTION AND BACKGROUND
to introduce suitable restriction enzyme sites into templates and it is not appropriate for routine
mutagenesis [80].
Several approaches of SDM technique have been published. However this method generally are labor
intensive or technically difficult. To overcome this difficulties QuickChange Lightning Site-Directed
Mutagenesis (Fig. 3) is a commercial Kit by Stratagene used that allows site-specific mutations. The
main advantage of its usage is that eliminates the need for subcloning and for single-stranded DNA
rescue. Furthermore, does not require specialized vectors, unique restriction sites, multiple
transformations or in vitro methylation treatment steps. Also a single kit allows rapid, efficient and
accurate mutagenesis of small and large plasmids.
Fig. 3 - Overview of the QuikChange Lightning site-directed mutagenesis method.
4.3.1 Domain swapping
Domains are the most important functional units in proteins and a significant proportion of proteinprotein interactions (PPI). Domain swapping is a mechanism for forming oligomeric assemblies. In
domain swapping, a secondary or tertiary element of a monomeric protein is replaced by the same
element of another protein. Domain swapping can range from secondary structure elements to whole
structural domains [81]. It also represents a model of evolution for functional adaptation by
oligomerisation of enzymes that have their active site at subunit interfaces [82].
14
CHAPTER 1
INTRODUCTION AND BACKGROUND
The modular architecture of phage lysins of Gram-positive background and the knowledge
accumulated in recent years from available crystal structures and bioinformatics allows the creation
of a protein with multiple modules of a single origin and also any desired amino acid sequence and
function [83][84][85].
4.4
Random Mutagenesis for in vitro directed enzyme evolution
Random Mutagenesis (RM) is a powerful tool for generating enzymes, proteins and entire metabolic
pathways or even entire genomes with improved properties. RM mechanisms can be divided into five
different categories: (i) transitions, involving substitution of a purine by another, or a pyrimidine by a
second pyrimidine, (ii) transversions, involving substitution of a purine nucleotide by a pyrimidine, or
vice versa, (iii) deletions, in which one or more nucleotides are deleted from a gene, (iv) insertions,
one or more extra nucleotides are incorporated into a gene, and (v) inversions, involving the 180º
rotation of a double-stranded DNA segment [86].
There are many methods by random mutagenesis that can generate genetic diversity such as treating
DNA or entire bacteria with chemical mutagens [87], passing cloned genes using mutator strains
[88], error-prone PCR (ep-PCR) [89], site-saturating mutagenesis (SSM) [90] and finally by using
rolling circle error-prone PCR (ep-RCA) [91].
4.4.1 Chemical mutagenesis
In vitro chemical mutagenesis is one of the most used techniques for the generation of random
mutagenesis in DNA and it does not involve the introduction of heterologous DNA or the manipulation
of interesting DNA by recombinant methods [86][87].
Despite of several chemicals have been tested, the majority of the compounds cannot be used due
to damage caused in the cell [87]. Consequently only five of the best-understood treatments are
currently widely employed in generating randomly distributed single-point mutations in vitro: nitrous
acid, sulfurous acid, hydroxylamine, hydrazine and mil-acid hydrolysis [75]. The main advantage of
chemical mutagenesis is associated with the simple usage and the low cost processing. On the other
hand, the main disadvantage is its inefficient control of the mutation rate and limitation to amino
acid substitutions [86].
15
CHAPTER 1
INTRODUCTION AND BACKGROUND
4.4.2 Mutator strains
Another useful random mutagenesis method is the bacterial mutator strain method that introduces
random point mutations into whole genes. The most popular mutator strain is Escherichia coli XL1Red which lacks the DNA repair pathways, MutS, MutD and MutT resulting in a ≈ 5000-fold random
mutation rate higher than the wild type strain [91]. Transformation of the mutator strain and recovery
of the mutant from the transformant are the two main steps for the using mutator strain protocol.
The main advantages of this method are its simplicity and absence of a ligation step, and it can
incorporate a wide variety of mutations such as substitutions, deletions and frame-shift mutations.
The several steps of the growth, plasmid isolation, transformation and re-growth, of this process
originates a progressively sickness of the mutator strain. Additionally this method generates a low
mutation frequency under standard conditions and requires a long cultivation period (longer than
24h) for introduce multiple mutations [86].
4.4.3 Site-saturating mutagenesis
Site-saturation mutagenesis (SSM) is another powerful technique for protein optimization due to its
simplicity and efficiency in which a single amino acid can be substituted to any other 19 possible
substituents [92][93]. As a result, the mutagenesis product is a collection of clones, each having a
different codon in the targeted position, so it is called “saturated”. Whole plasmid single-round PCR
it is a technique that makes SSM method more efficient [90]. This method uses two complementary
primers containing a mutant codon with partial overlap in the 5’ region that improve the amplification
efficiency by decreasing formation primers dimers. This amplification method requires the parental
DNA which is then degraded by using methylation-dependent endonuclease digestion. As a result a
circular, nicked and containing mutated gene vector is produced that can be transformed directly in
E. coli cells [92].
The advantage of this procedure is that eliminates time-consuming subcloning, ligation and singlestranded DNA rescue. The main disadvantages refers to only two nucleotides can be replaced at a
time and it does not work well with large plasmids (>10 kB).
This method was already successfully applied to generate improved activity of proteins under study
[94][95][96].
16
CHAPTER 1
INTRODUCTION AND BACKGROUND
4.4.4 Error-prone PCR
Error-Prone PCR (ep-PCR) is the most used method to generate random mutagenesis into a defined
DNA sequence that is too long to be chemically synthesized. It consists in reducing the fidelity of the
DNA polymerase which can introduce random mutations during the PCR process [97]. In ep-PCR
process the fidelity of the DNA polymerase is modulated by alteration of the conditions of reaction
buffer, increasing the error rate. The conditions are the addition of Mn2+ for reducing base pair
specificity [98]; increase Mg2+ concentration for stabilizing no complementary base pairs [99];
unbalanced dNTP stoichiometry in order to achieve misincorporation; increase the concentration of
DNA polymerase and altering the extension time [100].
After PCR, three steps are required to clone the library of genes into a host strain: digestion of the
product with restriction enzymes, separation of the fragments by agarose gel electrophoresis and
ligation into a vector, which makes it a very time consuming method [101].
In addition, the success of this method depends of the mutational bias of DNA polymerase, because
most part of low-fidelity polymerases used nowadays show strong mutational preferences that can
favor the substitution of certain nucleotides instead of others, causing the reduction of library diversity
[86].
Studies by Vanherck et al., (2005) [102] combined to different low-fidelity DNA polymerases, Taq
polymerase and Mutazyme, which exhibit opposite mutational spectra. This strategy should permit
generating unbiased libraries or libraries with a specific degree of mutational bias by applying optimal
mutagenesis frequencies through ep-PCR and controlling the concentration of template in the
shuffling reaction while taking into account the GC content of the target gene.
Other studies by Asano et al., (2005) [103], Edmond et al., (2008) [104] and Maeda et al., (2008)
[105] have used the efficiency of ep-PCR method in the modification of enzymes with the aim to
increase their potential in industrial applications.
A variation of traditional ep-PCR is called error-prone rolling circle amplification (ep-RCA) and it is an
in vitro amplification DNA method which amplifies circular DNA by a rolling circle mechanism,
yielding linear DNA composed of tandem repeats of the circular DNA sequence [106]. This technique
does not require specific primers because random hexamers can be used as a universal primer for
any template and does not require a thermal-cycler because the amplification reaction proceeds at
a constant temperature. Furthermore, ep-RCA products can be used directly to transform a host
strain (Fig. 4).
17
CHAPTER 1
INTRODUCTION AND BACKGROUND
Ep-RCA consists of only one DNA amplification step followed by direct transformation of the host
strain and producing mutants with an adequate mutation frequency, about 3–4 mutations per
kilobase, for in vitro evolution experiments without using restriction enzymes, ligases, specific primers
or special equipment such as a thermal-cycler are required. This method will enable random
mutagenesis to become a more commonly used technique.
Fig. 4 - Diagram scheme comparing the most conventionally random mutagenesis procedures to ep-RCA evidencing the
complexity and time-consuming of each method.
5 Advances in molecular engineering of endolysins
Despite that some endolysins have been optimized by their natural evolution and selection processes,
in most of the cases there is still potential for improvement of their activity and stability, especially in
complex environments such as certain food matrices [107].
Therefore, protein engineering based on directed evolution approaches can alter some endolysins
properties for specific biotechnology applications.
In this section some studies and advances in molecular engineering of endolysins will be discussed
using site-directed and random mutagenesis approaches
18
CHAPTER 1
INTRODUCTION AND BACKGROUND
5.1.
Advances using site-directed mutagenesis
In this case, the enzymatic optimization is done through localized changes in amino acids and then
the effect on lytic activity is examined.
The alteration of conserved amino acids in the streptococcal B30 endolysin CHAP and lysozyme
domains resulted in a sequential loss of activity from each domain [59]. Afterward, Donovan et al.,
(2006) [48] analyzed this dual domain lysin on live bacteria and concluded that the B30 endolysin
CHAP domain was the primary source of activity when lysing “from-without”. Site-directed
mutagenesis and deletion analyses of the Bacillus anthracis phage lysin PlyG were essential in
defining the binding domain and active site residues. These observations provided new knowledge
about the mechanism of specific binding of lysin to B. anthracis and may be useful in establishing
new methods for detection of B. anthracis [108].
Nelson et al., (2006) [61] also examined the streptococcal bacteriophage C1 lysin PlyC, using point
mutations and concluded that subunit PlyCA is responsible for catalytic activity. The active-site
residues were confirmed too. Similarly, site-directed mutations altering histidine codons in the
staphylococcal glycyl-glycine PG hydrolase ALE-1 have been used to define essential amino acids in
the M23 endopeptidase domain [109].
Low et al., (2011) [110] demonstrated the influence of a positive net charge in the peptidoglycan
layer induced by site-directed mutagenesis. The increase of the positive net charge can be favorable
for ECD function independently of its CBD through amino acid replacement. This can be important
for fine-tuning enzyme activity, such as in cases where efficacy of an enzyme is limited by its size.
The already described knowledge of binding domains and active site residues of these endolysins is
very useful when constructing novel fusion constructs for the purpose of making a better antimicrobial
agent.
5.1.1. Advances using domain-swapping
The earliest approaches to alter regulatory properties were created by exchange of the CBDs of
pneumococcal autolysins (LytA) and phage endolysins Cpl-1 [111][112]. Studies by Lopes et al.,
(1997) [64] concluded that the fusion of lactococcal N-acetylmuramidase catalytic domains to
choline-binding domains from pneumococcal endolysin CBD resulted in choline dependence of the
chimeric enzyme. Croux et al., (1993) [113], made the reverse experiment by combining a clostridial
CBD with LytA, thereby rendering the chimera active against choline-containing pneumococcal cell
walls and abolishing its activity against clostridial cell walls.
19
CHAPTER 1
INTRODUCTION AND BACKGROUND
More recently, Donovan et al., (2006) [114], fused full-length and truncated versions of the
Streptococcus agalactiae phage B30 endolysin to mature lysostaphin, yielding enzymes that were
active against both streptococcal and staphylococcal cells.
Similar to the studies with protein chimeras of pneumococcal and clostridial origin, the exchange of
Listeria phage CBDs of different serovar specificity also yielded enzymes with swapped lytic
properties and enhanced activity, which constitute interesting antimicrobial candidates for control of
the pathogen. In the same study it was also possible to combine the binding specificities of different
single CBDs in heterologous tandem CBD constructs, which were then able to recognize the majority
of Listeria strains. Manoharadas et al., (2009) [115], created a fusion of the insoluble S. aureus
phage P68 endolysin with a minor coat protein of the same phage and demonstrated that in certain
cases, modular engineering of endolysins may also solve solubility problems ensuring efficient
production and purification of otherwise insoluble lytic proteins.
5.2.
Advances using random-mutagenesis
Random mutagenesis is another approach to improve lytic activity of phage endolysins. One of the
first studies consisted in mutate the gene coding for the S. agalactiae phage endolysin PlyGBS using
two DNA mutagenesis, E. coli mutator strain and ep-PCR. After repeated rounds of mutagenesis and
screening a mutant with 28-fold activity was obtained comparatively to the parental enzyme. It also
resulted in the incorporation of unpredicted sequences at the C-terminus of the generated mutant
endolysin. The screening method in this study selected enzyme mutants with high diffusion capability
such as the C-terminal truncation which is smaller than a molecule lacking a CBD. This methodology
can be applied for identification of endolysin mutants with improved activity under various pH and
salt conditions or certain food products [84]. However, the screening method has to be adapted for
every individual condition.
Studies by Heselpoth et al., [116] involved PlyC endolysin thermostability improvement. In this study,
the random mutagenesis approach was used to improve the thermal stability through the use of epPCR, followed by an optimized screening process. The results suggested the methodology generated
PlyC mutants that retain high activities when compared to wild-type after elevated temperature
treatment.
20
CHAPTER 1
INTRODUCTION AND BACKGROUND
6. Main goals of this work
In recent years, listeriosis has become more widespread due to the increasing consumption of
processed foods and extension of shelf-life food products.
The phage derived endolysins are appointed as the best alternative to antibiotic and phage usage as
biocontrol agents. Furthermore, endolysins have no effect on the original organoleptic and texture
properties on food acting as an innocuous substance for human consumption making these type of
enzymes a good candidate for control of foodborne pathogens such as L. monocytogenes.
However, naturally occurring enzymes often lack features necessary for biotechnology industry
applications. Beyond that, little is known about endolysin function in food storage and processing
conditions - low temperatures, low pH conditions and high salt concentrations. There is also a lack
of knowledge aiming the improvement of derived Listeria phage endolysins using random
mutagenesis techniques.
This study pretends to accelerate the evolutionary process, through the use of directed evolution
strategies, aiming to generate well-adapted endolysins to the most adverse conditions in food industry
such as low temperatures and also, high salt and low pH conditions.
Two different directed evolution strategies will be used in this work: error-PCR, the most used random
mutagenesis technique and cryodrilling which mainly consists in biotic interaction of phage-host
aiming its adaptation at successively low temperatures.
Therefore, this work will have two well-defined objectives:
The first objective is to improve endolysins activity at low temperatures, known as refrigerator
temperatures.
The second objective is to reduce the usage of phage and chemical compounds application in food
industry by using the improved endolysins.
21
Chapter 2
Materials and Methods
CHAPTER 1
INTRODUCTION AND BACKGROUND
1. Bacterial strains, endolysins and plasmids
Criovials of E. coli JM109 containing two different Listeria monocytogenes phage endolysins – pQE30-ply500 (accession nº Q37979) and pQE-30-ply511 (accession nº Q38653) – and pQE-30 plasmid
with CBD-P35 sequence were kindly provided by Doctor Mathias Schmelcher from Swiss Federal
Institute of Technology Zurich – Department of Health Sciences and Technology.
The pQE-30 plasmid, present in Figure 1 was used for every cloning step.
E. coli JM109 strain belonging to the Centre of Biological Engineering of University of Minho (CEB)
was used as the expression vector. Cultures of this strains, previously transformed with pQE-30, were
done using Lysogeny Broth (LB, Liofilchem) supplemented with 100 µg/mL ampicillin (AppliChem).
Overnight cultures E. coli BL21 (CEB collection) containing Lys68 sequence (plasmid PET28a68gpLys) growth in LB supplemented with tetracycline marker (30 µg/mL).
After growth overnight at 37°C and 120 rpm agitation (Environmental Shaker incubator ES- 20/60),
cultures were diluted 1:100 in fresh medium and incubated in the same conditions until reach
exponential growth phase.
The induction for protein expression was accomplished by adding Isopropyl β-D-1thiogalactopyranoside (IPTG) (Sigma-Aldrich).
For Listeria phage isolation twelve bacterial strains were used and are present in Table 1. All the
strains were grown overnight in static incubator at 37°C in Tryptic Soy Broth (TSB) (Sigma-Aldrich)
agar plates and incubated next day in TSB broth maintaining the growth conditions.
Fig. 1 - Representation scheme of pQE30 cloning vector used to clone the endolysins sequences of ply500 and ply511
25
CHAPTER 2
MATERIALS AND METHODS
2. Listeria phage isolation
2.1.
Non-lysogenic strains selection
In order to avoid the selection of temperate phages, lysogeny test was performed to verify if the
strains used for phage detection did not possess lysogenic activity – prophages – responsible for
bacterial lysis.
A double-layer agar (DLA) test was used to perform the lysogeny test [117]. This method consists in
two LB broth medium layers supplemented with different agar concentrations, 1.2% and 0.6% for
bottom layer and top agar respectively.
All bacteria, previously grown overnight, were resuspended in 100 µL of NaCl 0.1 mM and then
gently homogenized in 5 mL of top-agar and poured into bottom agar layer of petri plate previously
prepared. This procedure was done for all twelve L. monocytogenes strains listed in table 1. Ten µL
of each Listeria strain in every bacterial lawn was placed. Bacterial lawns plates were dried at room
temperature and incubated overnight.
Next day, by observing the plates, the strains that generate an inhibition halo should be discarded
from phage isolation methodology.
Table 1 - L. monocytogenes pathogen strains, references and serovars used for phage isolation.
Bacterial strain
Reference
Serotype
Listeria monocytogenes
CECT 5725
4c
CECT 5873
1/2a
CECT 911
1/2c
CECT 933
3a
CECT 934
4a
CECT 936
1/2b
CECT 937
3b
CECT 938
3c
CECT 4031
1a
923
4b
994
4ab
strain Scott A
4b
26
CHAPTER 2
MATERIALS AND METHODS
2.2.
Effluent samples and phage detection
For Listeria phage isolation four different effluent fonts were examined: two local sewage treatment
plan (Braga and Vila Verde); one effluent from local livestock industries and one water sample from
Rio Este (Braga). The samples were stored at 4°C until properly treatment and evaluation.
Throughout this procedure two times concentrated TSB medium was used. Depending of the amount
of large debris present in effluent, the sample was centrifuged between 10-30 min at 9000 g, 4°C.
The supernatant was then filtered through a 0.45 µm and 0.22 µm pore-size filters (VWR) preventing
the passage of remaining bacterial cells.
Each sample (20 mL) was then mixture with equal volume of sterile TSB broth and divided in three
batches (40 mL each). Forty µL of bacterial suspension previously grown overnight was added to
each batch wand incubated for 24 hours at the same temperature and agitation conditions. Each
one of the twelve L. monocytogenes strains were used to form confluent lawn over the surface of the
plate and 10 µL of treated sample was placed in each plate. The plates were dried and then inverted
and incubated overnight. Next day phage the formation of phage plaques and the plaque-forming
unit (PFU) were evaluated.
2.3.
Phage isolation and propagation
When isolating phages in environmental samples it is important to realize that the phage populations
may consist of several phage strains, hence there is a need to obtain pure strains since a plaque
might contain more than one type of phage. In order to obtain pure phage strains, different phage
plaques were individually toothpicked to new individual plates with the same bacterial lawns from
which they were initially isolated. The phage was spread across the surface of a new second plate
with a sterile piece of paper and incubated overnight in the same optimal conditions of the host. After
add 4 mL of SM buffer (100 mM NaCl, 8 mM MgSO4, 50 mM Tris-HCl, pH 7.5) to suspend lysis
zones plates were incubated overnight at 4°C. Then the buffer and top agar were centrifuged at
9000 g for 10 min at 4°C and exposed to chloroform (4 volumes to 1 volume of sample) for bacterial
cells removal and suspension filtered with 0.22 µm pore diameter membrane. For phage
precipitation, 0.5 g of NaCl was added to 10 mL of sample and incubated at 4°C for 1 h and the
centrifuge step was repeated. The supernatant was recovered and mixed with polyethylene glycol
(PEG) (Sigma-Aldrich) (1 g for 10 mL of sample) and incubated overnight. After repeat the
centrifugation step, supernatant was discarded and the pellet resuspended in a low volume of SM
buffer (2-10 mL). Finally, 3 volumes of chloroform were added to 9 mL of sample, vortexed and
27
CHAPTER 2
MATERIALS AND METHODS
centrifuged at 3500 g for 15 minutes at 4°C. Supernatant was recovered and filtered using 0.22 µm
pore diameter membrane and stored at 4°C.
3. Protein production
3.1.
Large scale production
3.1.1. Culture and induction
Cultures of E. coli JM109 containing the wild-type endolysins genes were cultured as previously
described in section 1 with a final volume of 250 mL broth. Once reach the exponential phase
(OD600nm≈0.6) the culture was induced with 0.5 mM IPTG concentration and incubated (MIR-254-PE
cooled incubator) overnight at 16 °C with 200 rpm (Orbital Shakers MIR-S100-PE) agitation.
3.1.2. Lysis
After the incubation period cultures were centrifuged at 4 °C, 4500 g (SIGMA 3-16K Centrifuge),
during 30 min. The supernatant was discarded and the pellet was resuspended in 10 mL of cold
lysis buffer (20 mM NaH2PO4, 0.5 M NaCl/ NaOH, pH 7.4). After transfer the lysate to a new 50 mL
tube it was exposed to three freezing and thawing cycles by exposing the sample at -80 °C during
20 min and then thawed at room temperature. The sample was then submitted to ten sonication
cycles of 30 seconds of pulse (30 kHz) and 30 seconds of rest (Ultrasonic Processors from ColeParmer). Insoluble cell debris was removed by centrifugation at 4 °C, 4500 g for 30 min.
Supernatant was filtered and collected through two different filters of 0.45 µm and 0.22 µm,
sequentially.
3.1.3. Purification
Collected samples were purified through the use of gravitational His-Trap columns (GE Healthcare)
based on the affinity of immobilized nickel present in the column for the N-terminal poly-histidine tail
present in cloning vector.
To remove another possible proteins, columns were firstly washed using 10 mL of equilibration buffer
(lysis buffer with 25 mM imidazole), followed by the binding buffer (25 mM imidazole), and 10 mL
of wash buffer (lysis buffer with 25mM imidazole) to remove contaminant proteins. Finally the protein
was eluted using 2 mL of elution buffer (300 mM imidazole) and kept at 4 °C for further analysis.
The collected fractions in this procedure were analyzed by SDS-PAGE.
28
CHAPTER 2
MATERIALS AND METHODS
3.1.4. Polyacrylamide Gel Electrophoresis (SDS-PAGE)
Produced proteins fractions were visualized by using standard denaturation SDS-PAGE according to
Schagger and von Jagow conditions [118]. Gels with 0.75mm thickness, 3.75% of upper and a 12%
lower stacking and separating acrylamide (composition described in Anexe A, Table A1) were
assembled to perform the electrophoresis.
Samples of 10 µL were mixed with application buffer (x2) (125 mM Tris-HCl pH 6.8 (Biorad), 20%
glicerol (p/v) (Biorad), 1% β-mercaptoetanol (v/v) (Sigma), 0,01% bromofenol blue (p/v) (Biorad),
SDS 4% (p/v) (Biorad)) boiled at 95°C for 5 min and loaded onto the gels together with Protometrics
ladder (National Diagnostics).
Generally proteins were separated for 2 h at 90 V using TGS buffer 1x (25 mM Tris, pH 8,6, 192
mM glycine e 0.1% SDS) in MiniPROTEAN®Tetra system (Bio-Rad). Gels were stained using
Coomassie Blue R-250 solution (0,25% Coomassie Blue R-250 (p/v) (Biorad), 50% methanol (v/v)
(Fisher Scientific) and 10% acetic acid (v/v) (Fisher Scientific)) for 15 min. Background distaining
was done in several wash steps with distilled water in the same agitation conditions above described.
Gels were conserved in distilled water for further observation and analysis. Only eluted fractions with
intense bands of protein were posteriorly dialyzed in phosphate buffered (PBS) (137 mM NaCl, 10
mM phosphate, 2.7 mM KCl, pH 7.4) (1x) using Amicon Ultra 0.5 mL columns (Milipore).
3.1.5. Protein quantification
Total protein concentration was measured through of bicinchoninic acid methodology [119] using
BCA Protein Assay Kit (Thermo Scientific) and following the manufacturer instructions.
For better calculation of protein content, dilutions of 10, 30 and 50 times of protein sample were
initially done using PBS 1X. To measure protein concentration, 200 µL of BCA solution was done
and mixed with 25 µL of each diluted protein sample. The mix was incubated during 30 minutes at
37°C and OD580nm was measured in Synergy 2 Multi-Mode Microplate Reader (Biotek).
Calibration curve was performed using different Bovine Serum Albumin concentrations (0-2000
µg/mL) (Fig. C1 – Annexe C).
29
CHAPTER 2
MATERIALS AND METHODS
3.2.
Micro-scale protein production experiments
In order to determine optimal conditions, cultures of E. coli JM109 containing Ply500 endolysin gene
in pQE-30 vector, wild-type E. coli JM109 and E. coli BL21 containing plasmid PET28a-68gpLys were
done using the same conditions previously described in section 1.
Next day, beyond the dilution already described in section 1, a dilution of 1:10 was also done in each
well of the 96-wells plate with a final volume of 200 µL. Once reached exponential phase, cultures
were inducted with 1.5 mM IPTG and incubated ate 16 °C (MIR-254-PE cooled incubator) with 250
rpm (Orbital Shakers MIR-S100-PE) agitation for 24 and 48 h.
The decreasing of cellular growth in the first three hours after induction was measured by
spectrophotometry (OD620nm) evaluating the correct protein expression.
After incubation time, cultures present in the different wells of the original microplate were joined up
to 1 mL in new eppendorfs and centrifuged at 6000 g (VWR MicroStar 17R) for 10 min. The pellet
was resuspended in 500 µL of PBS and submitted to sonication as described in 3.1.2.
Also, 200 µL of each original tube culture were collected and placed in new different wells of a
second new plate. In this case microplates were firstly centrifuged at 2255 g (Thermo Scientific
CL31R) for 15 min and the supernatant was carefully decanted. Finally the pellet was exposed for
20 min to chloroform vapors lysing the cells. The pellet was then resuspended using 50 µL of PBS.
3.3.
Host preparation and antibacterial assays
After a culture of L. monocytogenes 5725 have grown respecting the conditions described in section
1, centrifugation was done at 4500 g during 15 min. The pellet was resuspended in Tris-HCl buffer
(10 mM Tris, 150 mM NaCl, pH 8.0) and the suspension adjusted to OD620nm ≈ 1.0. Twenty µL of
purified protein were mixed with 180 µL of bacterial suspension.
Endolysin activity against permeabilized of L. monocytogenes 5725 cells (previously submitted to 20°C for 1 h) were also tested following the instructions already described.
As positive control Lys68 endolysin was tested against P. aeruginosa PAO1 cells with exposed
peptidoglycan. This substrate was prepared, using chloroform to remove outer cell membrane,
following the instructions of Lavigne et al., (2004) [120].
30
CHAPTER 2
MATERIALS AND METHODS
Fig. 2 - 96-wells plate scheme of antibacterial assay against L. monocytogenes 5725 using Ply500 expressed in microscale conditions. Protein expression was tested for 24 and 48 h. Endolysin 68 was used as positive control against outer
membrane permeabilzed of P. aeruginosa cells. Negative controls are present in dashed lines wells. Blue wells represents
protein expression in 4mL tube; yellow wells the protein expression in micro-scale; green wells protein expression of
200 µL collected from 4 mL expression tube and pink wells represent the protein production in 1 mL collected from four
wells.
4. Bioinformatic tools
4.1.
In silico analysis of bacteriophage endolysins
In order to identify putative domains within the Ply500 and Ply511 endolysins deposited in GenBank
(http://www.ncbi.nlm.nih.gov/genbank), an in silico analysis of conducted using the HHpred
webserver (toolkit.tuebingen.mpg.de/hhpred) and Pfam as a database. Enzymatic catalytic domain
(ECD) and cell binding domain (CBD) found with an E-value higher than 1x10-5 with at least 80% of
query coverage were considered as significant.
31
CHAPTER 2
MATERIALS AND METHODS
Table 2 - Designed primers for endolysins sequences amplification. ply500 (primers 1 e 2) e ply511 (primers 3 e 4).
Underlined are shown the restriction sites for enzymes BamHI and SalI. Melting temperatures also are present in this
table.
Primers
Code
Sequence
Tm (˚C)
1
pHPL500Fw
5´AAAAAAGGATCCATGGCATTAACAGAG 3´
68.4 ˚C
2
pHPL500Rv
5´AAAAAAGTCGACTTATTTTAAGAAGTATTCTTGCTG 3´
67.8 ˚C
3
pHPL511Fw
5´ AAAAAAGGATCCATGGTAAAATATACCGTA 3’
66.4 ˚C
4
pHPL511Rv
5´AAAAAAGTCGACTTATTTTTTGATAACTGC 3´
65.2 ˚C
4.2.
Primers design
For the isolation and amplification of the endolysin sequences, primers in Table 2 were designed
according to the insertion site of the pQE-30 plasmid. Calculation of melting temperatures and GC
content were calculated using online software Tm Calculator from Thermo Scientific. Melting
temperatures were calculated based on thermodynamic [121] and the salt concentration [122].
The formation of secondary structures (primer dimers, hairpins, self-dimers, hetero-dimers) was
predicted using OligoAnalizer 3.1 (https://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/).
In order to avoid cutting of the ply500 and ply511 and obtain the correct cloning, the restriction map
of that sequences were generated using online software NEBcutter: a program to cleave DNA with
restriction enzymes [123] (http://tools.neb.com/NEBcutter2). BamHI and SalI were selected and
the restriction sites were incorporated in primers sequences generating the correct homology
regions.
5. Cloning
This method involves the use of bacterial plasmid pQE30 as cloning vector in order to obtain many
copies of genes of interest. The strategy consists in placing amplified endolysins genes by error-prone
PCR and insert into the cloning vector previously opened up with restriction enzymes (NEB) BamHI
and SalI. The same restriction enzymes are used to cleave the gene of interest generating stickyends that promote the ligation together on the plasmid using T4 DNA ligase enzyme (KAPA
Biosystems).
32
CHAPTER 2
MATERIALS AND METHODS
5.1.
Polymerase chain reaction (PCR) techniques
5.1.1. Error-prone PCR
T4 DNA polymerase and primers used to amplify Listeria endolysins were purchased from KAPA
Biosystems and Invitrogen, respectively.
The conditions of polymerase chain reaction (PCR) (Bio Rad Mycycler Thermal Cycler) were modified
in order to introduce random mutations into the endolysins sequences. The amplification of wild-type
endolysins sequences was done using the primers present in table 2 and the ep-PCR procedure
conditions are present in table 3. This conditions were modified following some instructions described
by Pritchard et al., (2005) [124].
Once obtained, the amplified products were purified using the DNA Clean & Concentrator Kit TM-5
(Zymo Research Corporation). The correct lengths were confirmed by agarose gel.
To promote the ligation between the generated sequences and the plasmid, restriction enzymes
BamHI and SalI were used to create sticky ends on ep-PCR products. The generated digested
sequences were newly purified and the concentrations calculated throughout spectrophotometric
parameters of Nanodrop (Thermo Scientific Nanodrop 1000).
5.1.2. Colony-PCR
This PCR-based technique is used to screen for plasmids containing a desired insert directly from
bacterial colonies without the need of culturing or plasmid purification steps. The insert-specific
primers, present in table 2, generate amplified and known length sequences which correspond to
the correct and wild-type sequences.
Colonies were picked from transformation plate, placed into 50 µL PCR tubes and resuspended in
10 µL sterile H2O. PCR reagents that compose the 50 µL reaction mixture, described in table 3, were
added. Individual transformants were harvested in the initial heating step of PCR and cause the
release of DNA plasmids and is used as template for amplification reaction. The correct amplified
genes were confirmed by running agarose gel.
33
CHAPTER 2
MATERIALS AND METHODS
Table 3 – PCR conditions for amplification of ply500 and ply511 endolysins sequences in ep-PCR and Colony-PCR. The
volumes were calculated for 50 µL of final reaction volume.
Error-Prone PCR
Colony PCR
ply500
ply511
Buffer A (x10)
5 µL
5 µL
5 µL
DNTP’s (10 mM)
1 µL
1 µL
10 µL
Primer FW (10 µM)
2 µL
2 µL
2 µL
Primer RV (10 µM)
2 µL
2 µL
2 µL
Template DNA
1 µL
2.5 µL
10 µL
MgCl (25 mM)
11 µL
11 µL
-
MnCl (25 mM)
1 µL
1 µL
-
DNA Kapa Taq
1 µL
1 µL
0.2 µL
H 0 Nuclease Free
26 µL
24.5 µL
29.8 µL
2
2
2
PCR conditions
5.2.
95°C – 3 min.
95°C – 3 min.
95°C – 30 s.
95°C – 1 min.
65°C – 30 s
25x
65°C – 1 min.
72°C – 2 min.
72°C – 3 min.
72°C – 2 min.
72°C – 2 min
30x
Plasmid extraction and digestion
Overnight culture of E. coli JM109 with CBD-P35 sequence present in pQE-30 vector was grown
conditions previously described. Cell culture was then centrifuged at 9000 g during 3-4 minutes and
medium decanted. Plasmid extraction was done using minipreps kit NucleoSpin Plasmid (MachereyNagel). Once extracted, plasmids were digested by using the two selected restriction enzymes
(BamHI and SalI) during 2 h at 37˚C, removing the CBD-P35 sequence. The plasmid digestion was
confirmed by running agarose gel and the correct band was then extracted by removing the
correspond portion of the gel under UV light with sterile scalpel.
In order to prevent the recirculation of cloning vector by removing the 5’-phosphate, Antarctic
Phosphatase (NEB) was used following the manufacturer instructions - during 15 min at rT; the
enzyme was inactivated by increasing temperature to 70°C for 5 min.
34
CHAPTER 2
MATERIALS AND METHODS
5.3.
Ligation
For the ligation step KAPA T4 ligase (KAPA Biosystems) was used to catalyze the ligation of errorprone PCR products with linearized cloning vector (section 5.2) with formation of a phosphodiester
bond between 5’ phosphate and 3’ hydroxyl termini in duplex DNA. The required volumes of cloning
vector for this step were calculated based on this equation below:
𝑛𝑔 𝑖𝑛𝑠𝑒𝑟𝑡 =
𝑖𝑛𝑠𝑒𝑟𝑡 (𝑘𝑏)
× 50 𝑛𝑔 𝑣𝑒𝑐𝑡𝑜𝑟 × 5
𝑐𝑙𝑜𝑛𝑖𝑛𝑔 𝑣𝑒𝑐𝑡𝑜𝑟 (𝑘𝑏)
According with the equation above, the volume of used amplified products depends on the lengths
and on the ratio (1:5) between the two later, for 50 ng of vector used.
5.4.
Agarose gel electrophoresis
To confirm the correct lengths of amplified products 0.7% agarose gel were done achieving a better
band separation and promote the correct band excision from the gel. Generally 1% agarose was used
for the evaluation of correct ligation between amplified products and cloning vector. The agarose gels
were prepared with Tris-Acetato-EDTA (TAE) (Biorad) 1x buffer and the electrophoresis performed at
90 V during 45 min. Samples were loaded with gel loading dye blue 6x (NEB) and 1kb (NEB) was
used as ladder. SYBR Safe (Invitrogen) was used as DNA stain for visualization of DNA in agarose
gel in ChemiDoc XRS (BioRad).
6. Transformation
Transformation is a process in which foreign DNA is introduced into a cell. In some bacterial strains
transformation occurs naturally, however most of them require artificial procedures to be in state of
competence and accept exogenous DNA for a time limited response. In this work E. coli JM109 cells
were used and adapted to be in state of competence – chemical and electro competent cells – and
accept recombinant DNA plasmids through heat shock transformation and electroporation,
respectively. All this procedures were based on described protocols in Current Protocols in Molecular
Biology (2007) [125].
35
CHAPTER 2
MATERIALS AND METHODS
6.1.
Competent cells
6.1.1. Chemio-competent cells
E. coli JM109 chemo competent cells were prepared based on previous described protocols. The
first bacterial inoculum in LB medium, supplemented with 100 µg/mL of ampicillin, grew overnight
at 37°C with 120 rpm agitation (Environmental Shaker incubator ES- 20/60), the next day, a 1:100
dilution of the first inoculum was done into fresh LB medium until the bacterial growth reach
exponential phase (OD620nm≈0.3) maintaining the same conditions. The culture should be centrifuged
at 3300 g, 4°C (Sigma 3-16k) during 10 min and decant the supernatant.
The pellet was resuspended with ice-cold 0.1 M CaCl2 solution in half of the volume used in the
dilution step and store in ice during 30 minutes and then centrifuged following the same conditions
described in first centrifugation step. In this step, competent pellet is much cloudier and there is a
hole in the pellet which indicates already good competent cells. Resuspend the pellet again with the
same ice-cold CaCl2 solution in the 1/10 of the volume used in dilution step. Then, another
centrifugation step is needed in the same conditions above. The final pellet is resuspended in aliquots
of 1mL of ice-cold 0.1M CaCl2 and stored at -80°C.
6.1.2. Electrocompetent cells
To produce electrocompetent cells a inoculum of one colony from a fresh plate of the strain E. coli
JM109 was done in LB broth and incubate at 37°C, 120 rpm, overnight. Dilution of 1/100 from
initial culture in fresh LB medium and incubate at the same conditions above described until the
culture reach OD600nm≈0.5. The culture was then kept on ice for 15 min before the centrifugation step
at 5000 g at 4°C (Sigma 3-16k) during 10 min and the pellet was resuspended in ice-cold and sterile
glycerol 10% solution. This step was repeated three times with decreasing volumes of glycerol 10%
solution. All the procedure was done in ice to prevent thermal shock and increase the efficiency of
competent cells. The final aliquots (100-200 µL of final volume) were stored at -80°C.
6.2.
Transformation and plasmid replication
6.2.1. Heat-shock transformation
In this transformation method 100 µL aliquots of chemi-competent cells were withdrawn from -80°C,
after thaw the cells were mixed with 50 ng of DNA and incubated on ice for 30 min. The heat shock
was done during 40 seconds using a 42°C water bath. After heat shock the cells were placed in ice
for 2 min, then resuspended in 300 µL of SOC broth and incubated at 37°C with 120 rpm agitation
36
CHAPTER 2
MATERIALS AND METHODS
about 1 h for recovery and cellular growth. Cells were then plated (100 µL and pellet after
centrifugation) in LB plates with ampicillin (100 µg/mL) and incubated overnight at 37°C.
6.2.2. Electroporation
Electroporation was performed using Gene Pulser XcellTM (Bio-Rad) with 0.1cm ice-cold cuvettes at
1.8kV. 50 µL of chemi-competent cells and 0.5 to 2 µL of DNA were mix into the cuvettes. After
electric pulse the cuvette were removed, supplemented with 1 mL of super optimal broth (SOC) and
incubated at 37°C with 120 rpm agitation for 1 hour for recovery and cellular growth. The cells were
plated (100 µL and pellet after centrifugation) using LB plates with ampicillin.
7. Direct evolution screening assay
This methodology allows one to utilize directed evolution to increase the bacteriolytic activity of
translated endolysins at low temperatures and in the presence at high salt conditions. Random
mutations introduced through the use of an error-prone DNA polymerase generate mutant libraries
that are submitted to an extensive screening procedure used to identify possible best bacteriolytic
mutants compared to wild-type molecules in the same conditions. This procedure must be performed
until the desired properties are obtained.
7.1.
Mutant libraries
The first step consists in the generation of the mutant libraries throughout the incorporation of
random mutations in wild-type endolysins sequences using error-prone PCR technique which was
previously described in section 5.1.1. The modified endolysins sequences generated were cloned
and transformed as previously described in sections 5 and 6. Additionally, original sequences
followed the same protocol and used as positive controls of transformation step and during the
screening tests.
7.2.
Screening tests
The second step, called screening, selects the best adapted colonies in very specific conditions.
Two conditions were tested in this step, low temperatures and high salt concentrations.
37
CHAPTER 2
MATERIALS AND METHODS
For protein production the plated colonies were carefully selected from agar plates with sterilized
toothpick and inoculated in the designated well of the 96-wells. The protein production and cell lysis
were carried in the same conditions as described in section 3.2 using 24 h for protein expression.
Original plate, containing toothpicked mutant colonies, was conserved at -20°C in order to recover
potential candidates and repeat the mutation step until desire properties were obtained.
AmpR
AmpR
AmpR
AmpR
Fig. 3 – Directed evolution assay. Wild-type ply500 and ply511 endolysins sequences are used for error-prone PCR (1)
generating library mutants containing random nucleotide mutations. Mutated gene sequences are cloned into expression
vector pQE-30 and transformed into E. coli JM109 competent cells (2). Individual colonies are inoculated into their own
specific well of a 96-wells plate. Through an extensive screening process the constructs, individual mutants that are
catalytically active after incubation at low temperatures and at high salt conditions are selected and classified as mutants
with enhanced kinetic stability (3). This process must be repeated until desired properties are obtained (4).
7.2.1. Low temperature tests
In this test L. monocytogenes 5725 cells were prepared according to 3.3 section by transferring 180
µL of bacterial suspension, previously adjusted to OD620nm ≈ 1.0 with PBS to each well previously filled
with 20 µL of protein. The microplate was immediately placed in the microplate spectrophotometer
previously refrigerated at 4°C and the enzyme kinetics were monitored by measuring the OD620nm every
5 minutes for 30 minutes.
38
CHAPTER 2
MATERIALS AND METHODS
7.2.2. High salt conditions
This screening test only differs in the preparation of the Listeria strain compared to the previous by
resuspending the pellets in 10 mM Tris, 150 mM NaCl, pH 8.0 buffer the bacterial and adjust
OD620nm ≈1.
8. Cryodrilling
An alternative strategy to increase endolysin enzymatic activity is by using phages as a mutagenesis
promoter. This strategy is based on phage adaptability to different environmental conditions. The
assay called Cryodrilling consists in the propagation of the phage to successive lower temperatures
(two degrees below the previous temperature). The hypothesis is that by adapting phage to lower
temperatures the endolysin encoded in its genome will also be modified, and be consequently more
active. Listeria phage P100 and L. monocytogenes 5725 host were used in this new evolution
strategy.
Table 4 – Used primers for amplification of the PlyP100 endolysins derived from phage adapted assays. This primers
were already available in the group primers collection. Underlined are shown the restriction sites for enzymes NcoI and
BamHI, respectively.
Primers
Code
Sequence
Tm (˚C)
1
plyP100_Fw
5' TATATACCATGGTAAAATATACCGTAGAGAACA 3'
56.9 ˚C
2
plyP100_Rv
5' TATATACCTAGGTTATTTTTTGATAACTGCTCCTG 3'
58.6 ˚C
This assay was divided in two different approaches: in the first approach, called evolution, only the
Listeria phage P100 was allowed to evolve and the bacterial genotype was held constant; on the
second approach, called co-evolution, both phage and host were allowed to evolve.
Initial L. monocytogenes 5725 culture growth in 10 mL of fresh TSB medium until reach the
OD620nm≈0.3. The host culture was then infected with 107 Listeria phage P100 particles. Cultures were
propagated by serial transfers every 48 h in a static incubator. Each culture transfer was done
decreasing the initial temperature (25°C) two degrees until reach the final temperature of 7°C.
Transfers of the evolving populations involved isolating phage particles by centrifuging at 9000 g for
10 minutes and filter (0.22 µm pore membrane). Transferring 1 mL of phage suspension into fresh
wild-type grown previously. In co-evolved populations the transfer was done by inoculating 10% of
volume of each previous suspension in fresh TSB broth.
39
CHAPTER 2
MATERIALS AND METHODS
To confirm the phage presence in every two transfers, phage population was estimated by plating
dilutions of each phage population on to TSB agar plates with a semi-solid overlay bacterial lawn.
At 7 °C, different phage plaques were found in evolved and co-evolved populations and isolated. The
new adapted phage production was done as described in section 2.3.
Table 5 – PCR conditions for amplification of plyP100 from phage adapted endolysins. The volumes were calculated for
30 µL of final reaction volume. The initialization step at 95°C during 10 minutes was used in order to promote the
release of phage DNA.
PCR plyP100
Buffer A (x10)
5 µL
dNTPs (10 mM)
0.75 µL
DNA template
2 µL
KAPA Taq Pol. HF
0.5 µL
Primer Fw (10 µM)
0.75 µL
Primer Rv (10 µM)
0.75 µL
H 0 nuclease free
15.15 µL
2
95°C – 10 min.
95°C – 3 min.
PCR conditions
65°C – 1 min.
30x
72°C – 3 min.
72°C – 2 min.
Before sequencing the plyP100 of adapted phages was amplified by PCR using specific primers
(Table 4) and following the conditions present in Table 5. Correct amplification was confirmed by
agarose gel and PCR- products were then purified. Thereafter the amplified sequences, containing
separately each primer, were submitted for sequencing
40
Chapter 3
Results and Discussion
CHAPTER 3
RESULTS AND DISCUSSION
1. Background
Listeriosis is a foodborne disease that has become widespread in recent years. In order to avoid the
inappropriate usage of antibiotics which can lead to an increase antibiotic resistance bacteria and
due to the limitations of phage usage, phage endolysins are appointed as a good alternative as
biocontrol agents [37]. However, little is known about the enzymatic activity under food processing
and storage conditions, such as refrigeration temperatures, high salts and low pH conditions. In
order to that it becomes important to verify endolysins stability in food matrices as well as in
consumer safety.
The basis of this study was to improve structural stability and lytic properties of endolysins by using
specific directed evolution techniques such as ep-PCR. Directed evolution is defined as a method to
harness natural selection in order to engineer proteins to acquire particular properties that are not
associated with the protein in nature. The main advantage of using directed evolution instead of more
rational-based approaches for molecular engineering relates to the volume and diversity of variants
that can be screened [116].
The first approach consisted in some attempts to isolation of derived listerial phage endolysins for
further characterization and subsequent lytic improvements.
Based on the non-successful phage isolation approach, a second strategy was followed using two
well-known derived L. monocytogenes phage endolysins, Ply500 and Ply511. Some attempts to
improve lytic properties of this two proteins were performed namely by the introduction of random
mutations through the use of ep-PCR.
At the same time an alternatively strategy based on biotic interactions between phage and host was
developed in order to promote the phage adaptation at low refrigeration temperatures and generating
improved lysins. According to the Red Queen hypothesis the adaptation of the host generates counter
adaptation in phages, increasing the population fitness and lead to an evolution of phage particles.
2. Listeria phage isolation
Despite they have a conserved biological function, phage endolysins are greatly enzymatically and
architecturally diverse comprehending 89 different types of organizational architecture and are able
to infect 64 different bacterial genera [126]. However, the tremendously variety and complexity of
PG composition with more than 100 chemotypes has led to an evolutionary pressure which has
forced phages to refine their lytic activity over host cell wall. As a result, phages have acquired a
45
CHAPTER 3
RESULTS AND DISCUSSION
huge diversity of PG hydrolases which may vary in type, number and organization of binding and
catalytic domains [126].
In order to obtain listerial phages and consequently isolate and characterize their derived endolysins,
various isolation attempts were performed using four different effluents from different livestock
industries.
Although no phages were isolated from any effluent sample, the presence of prophage activity during
non-lysogenic strains selection was verified by formation of inhibition halos of L. monocytogenes
strain Scott A against L. monocytogenes CECT 934 lawn.
It is known that L. monocytogenes strain Scott A has been extensively used in as a reference strain
in for efficacy testing of food processing and preservation techniques [127]. Also this strain encodes
temperate phage PSA that can justify the presence of inhibition halos in bacterial lawn [128][28].
This listeriophage integrates in the 3' end of an arginine tRNA gene and when isolated using UVinduction it is characterized by exclusively infect L. monocytogenes serovar 4b strains [129].
3. In silico analysis of bacteriophage endolysins
Since no phages were isolated it was needed to use two well-known endolysins. Ply500 and Ply511
possess modular structure with cell binding (N-terminal) and catalytic (C-terminal) domains. To
identify putative domains of this endolysins with sequences deposited in NCBI, an in silico analysis
was performed using Pfam database with an E-value higher than 1x10-5 with at least 80% of query
coverage. The results for putative domains for each endolysin are showed in table 1.
The most similar enzymatic catalytic domain for the derived Listeria phage A500 endolysin Ply500
is VANY (Table 1). This domain is described in Pfam database as a carboxypeptidase, responsible
for cleavage of C-terminal residues of D-alanyl-D-alanine in PG possibly due to antibiotic resistance
provided by VanY protein on some Enterococcus strains. VANY domain was identified in endolysins
derived from Gram-positive or Gram-negative phages mainly in Listeria, Bacillus and Escherichia
cells. However, in contradiction with Pfam, Listeria phage endolysin Ply500 is classified as a
carboxypeptidase, cleaving L-alanyl-D-glutamate endopeptidases [25].
Despite that the probability percentages in Table 1 for the putative binding domains of Ply500 are
lower than initially defined query coverage value, it is known that family domain SH3 is commonly
found in phage endolysins and SH3_3 is referred as one of the most common domain type. Pfam
database refers to the SH3 family domain as the responsible for peptide binding that can be found
in proteins that interact with other proteins. Other SH3 related domains are appointed as very
46
CHAPTER 3
RESULTS AND DISCUSSION
commonly found in Listeria phage A500 derived endolysins [1]. This binding domain has been
identified for the recognition of pentaglycine cross bridge in PG which is present in Gram-positive
bacteria.
Table 1 – Putative binding and catalytic domains for Ply500 and Ply511 endolysins.
Ply500 endolysin putative domains
Catalytic domain
Conserved domains
HHpred Probability (%)
HHpred E-value
VANY
PF02557
99.9
2.3E-22
Peptidase_M15_4
PF13539
99.5
2.8E-15
Peptidase_M15
PF01427
99.5
1.6E-14
Peptidase_M15_3
PF08291
98.0
1.2E-05
Peptidase_M15_2
PF05951
98.0
2E-05
SH3_4
PF06347
72.8
1
SH3_3
PF08239
69.7
1.4
Binding domain
Ply511 endolysin putative domains
Amidase_2
PF01510
99.9
3.4E-24
PF12200
81.6
0.43
Binding domain
DUF3597
For the Ply511 endolysin, the most putative catalytic domain after in silico analysis is the Amidase_2
with 99.9% of probability and 3.4E-24 of E-value. This domain is characterized by Pfam database as
an amidase responsible for the cleavage reaction of the bond between N-acetylmuramoyl residues
and L-amino acid residues in bacterial cell walls. Amidase_2 is usually located as the central domain
[25].
The most putative binding domain for this protein is the Domain of Unknown Function (DUF) 597
with 81.6% query coverage and 0.43 E-value. Although this domain has no characterized function it
is located at C-terminal and it is supposed to play an important rule as cell binding domain. It is also
known that most listerial phage endolysins, including Ply511, do not directly require wall teichoic
acid as the binding ligand [130]. In this aspect it was found out that the removal of C-terminal CBD
does not affect the attachment of Ply511 endolysin to L. monocytogenes cells PG [131]. Therefore,
a modular architecture (i.e. the presence of CBD) is not always necessary for enzyme activity.
47
CHAPTER 3
RESULTS AND DISCUSSION
4. Protein expression preliminary test
4.1.
Large-scale protein production
The ply511 and ply500 sequences encodes two different proteins with distinct molecular weight –
36.48 kDa and 33.43 kDa, respectively. In order to evaluate the correct expression of this two
proteins, culture of 250 mL of E. coli JM109 cells, containing cloned plasmid with wild-type protein
sequences, were done and induced as described in section 3.1 of Materials and Methods. The final
soluble protein concentrations of 315 µM and 106 µM respectively, are in agreement with figures
1A and 1B. The same Figures shows a protein overexpression and also that the majority of interesting
proteins are present in elution of fraction 2 (F2). A residual concentration of unspecified soluble
proteins is visible too and still present in a lower concentration. These results indicate that the
expression system was working correctly and producing folded proteins. The use of L.
monocytogenes 5725 was considered after preliminary antibacterial assays (results not showed) as
described in section 3.3 of Materials and Methods. The lytic activity of the two produced proteins
were tested against five different L. monocytogenes strains – 5725, 934, 936, 911, 923, 5875 –
with the last four belonging to furthermost common serovars reported in the most human listeriosis
cases, 1/2b, 1/2c, 4b and 1/2a, respectively [132].
Fig. 1 – SDS- PAGE electrophoresis gel 12%, stained with Coomassie Blue, for Ply511 (A) and Ply500 (B) proteins. M,
Protein Ladder (10-250 kDa) from NEB; F1, 2, 3, and 4, fractions 1, 2, 3 and 4 of eluted proteins; W, wash; FT, flow
through. The proteins were eluted with elution buffer containing 250 mM imidazole concentration.
4.2.
Micro-scale protein expression and preliminary tests
The use of ep-PCR as the method of directed evolution generates a higher number of protein variants
or potentially mutants that can be screened. Therefore an optimized process is needed in order to
48
CHAPTER 3
RESULTS AND DISCUSSION
select the best candidates. Thus, the use of a 96-wells plate becomes absolutely necessary for the
realization of this procedure wherein each well will contain individually different candidates. As result,
a lower volume (200 µL broth) for cell culture is required – here called micro-scale protein
0,8
0,8
0,7
0,7
0,6
0,6
0,5
0,5
OD (620nm)
OD (620nm)
expression.
0,4
0,3
0,4
0,3
0,2
0,2
0,1
0,1
A
0,00 0,08 0,17 0,25 0,33 0,42 0,50
0,00 0,08 0,17 0,25 0,33 0,42 0,50
Control
24h frozen
48h frozen
Time (h)
B
0
0
Control
24h frozen
48h frozen
24h Normal
48h Normal
0,8
TIme (h)
24h Normal
48h Normal
0,8
0,7
0,7
0,6
OD (620nm)
0,6
OD (620nm)
0,5
0,5
0,4
0,4
0,3
0,3
0,2
0,2
0,1
C
0
0,1
D
0
0,00 0,08 0,17 0,25 0,33 0,42 0,50
0,00
0,08
0,17
Time (h)
0,33
0,42
0,50
Time (h)
Control
24h Normal
24h frozen
48h Normal
48h frozen
0,25
Control
24h frozen
48h frozen
24h Normal
48h Normal
Fig. 2 - Antibacterial assays of Ply500 endolysin against normal and permeabilized L. monocytogenes 5725 cells. The
endolysins were expressed in 4 mL broth and cell lysis was done by sonication (A). Protein expression was done in 5
wells (200 µL each well) then joined (1 mL) and sonicated (B). Endolysins were expressed in 200 µL of a 96-wells plate
(C). Also protein expression was induced in 4 mL broth (D). Next 200 µL were transferred to 96-wells. Cell lysis was
done by chloroform vapors. In all the cases the expression conditions were 16°C during 24 h or 48 h with 1.5 mM IPTG
concentration. E. coli JM109 wild-type was used as negative control.
As already shown in section 3.1, the protein is overexpressed in large-scale conditions. In a first
approach, the same conditions of protein production (0.5 mM IPTG, 200 rpm agitation, overnight)
were maintained for micro-scale protein expression as well as the use of repeated frozen-thawing
49
CHAPTER 3
RESULTS AND DISCUSSION
cycles for cell lysis. However, after performing antibacterial assays against L. monocytogenes 5725
no enzymatic activity was detected suggesting that the protein would not be produced in considerable
concentrations.
The lower volumes in each filled well generates a higher friction which may negatively influence the
agitation conditions as well as IPTG concentration and consequently the incubation time. Efficiency
of the repeated frozen-thawing cycles as cell lysis method was also identified as the one of the most
possible sources for the lack of antibacterial reduction. Besides, the absence of lytic activity may be
related to the difficult attachment of proteins in PG layer. As result, the main objective of this very
important preliminary test mainly consisted in evaluate the sources for the lack of lytic activity and
improve those conditions before proceeding to generate mutant library and screening steps.
To improve protein expression in micro-scale a higher agitation (250 rpm) and inducer concentration
(1.5 mM IPTG) were tested. Two different lysis methods (sonication and chloroform vapors),
incubation times (24 and 48 h) and lytic activity of proteins against normal and permeabilized
(previously frozen at -20°C for 1 h) Listeria cells were also evaluated.
The most immediate conclusion of the results present in Figure 2 is the more effectiveness lytic
activity of Ply500 in permeabilized Listeria cells, 24 h after the addiction of IPTG. Once permeabilized,
endolysins can easily bind to its specific sites of PG causing a better cell lysis. These results contrasts
with the lower lytic activity observed in normal listerial cells.
In 4 mL protein expression (Fig. 2A) a better lytic activity is visible, however, turns out to be normal
since that a higher protein concentration is produced too, especially when comparing to the other
conditions.
Another conclusion is that using 250 rpm agitation instead the initially used (200 rpm) the problem
between broth volume and agitation conditions was solved which can be confirmed by lytic activity
in micro-scale expression which is considerably significant (Fig. 2C). No enzyme activity was detected
in Figure 2D suggesting problems during cell growth or protein production.
The bacterial reduction in the all conditions presented in Figure 2B is very similar to those observed
in Figures 2A and 2C. The slight difference observed may be due to the possible variations in cell
growth and efficiency of cell lysis.
Although the efficiency of cell lysis methods is very similar, the chloroform vapor method seems to
be more adapted for this work once that promotes cell lysis equally in all wells of 96-wells plate which
is corroborated by the significantly lytic activity showed in Figure 2C.
50
CHAPTER 3
RESULTS AND DISCUSSION
4.3.
Lytic activity – Low temperatures vs. Room temperatures
Despite the fact that these endolysins reveal good stability and lytic activity in a wide range of higher
temperatures, they have not yet been well characterized at low temperatures [133]. Once determined
the optimal protein expression conditions in micro-scale, the enzymatic activity of wild type endolysins
at food storage temperatures (≈4°C) and at room temperatures (≈25°C) was compared by
performing antibacterial assays against L. monocytogenes 5725. The importance of this test was to
prove the lower lytic activity of natural Ply500 and Ply511 and the need to improve its properties in
food storage conditions.
The reduction of antibacterial activity present in Figure 3 suggests a very similar enzymatic behavior
in the two different conditions. Nevertheless, Ply500 shows better lytic activity in both cases with a
two log reduction in thirty minutes whereas the Ply511 did not show significant activity in either
1
0,9
0,8
0,7
0,6
0,5
0,4
0,3
0,2
0,1
0
1
0,9
0,8
0,7
0,6
0,5
0,4
0,3
0,2
0,1
0
OD (620nm)
OD (620nm)
conditions.
A
B
0,00 0,08 0,17 0,25 0,33 0,42 0,50
0,00 0,08 0,17 0,25 0,33 0,42 0,50
Time (h)
Time (h)
ply500
ply511
Control
ply500
ply511
Control
Fig. 3– Kinetics of antibacterial assays of Listeria phage endolysins Ply500 and Ply511 at refrigeration temperatures (A)
and room temperatures (B). Negative control was done using 180 µL bacterial suspension mixed with 20 µL of PBS.
The connection factor with these results could be related to the L. monocytogenes 5725 strain which
belongs to serovar 4c. This serovar is included into the non-most common listerial strains detected
in foods and is rarely reported to be implicated in human listeriosis cases [134]. However, Ply500
and Ply511 CBDs are referred to promote a very strong and weak binding for the PG, respectively,
to this listerial serovar, which can suggest the difference of lytic activity [135].
Despite the difference of lytic activity between the two endolysins, these results are not considered
relevant since a high bacterial concentration is still present. As a result the improvement of the
51
CHAPTER 3
RESULTS AND DISCUSSION
catalytic activity in specific food storage conditions is required in order to be liable applied in food
processing industry. The optimization mainly consists using two different approaches of directed
evolution – random mutagenesis by ep-PCR and phage-based adaptation mechanisms.
5. Cloning
5.1.
Gene amplification
For the improvement of lytic activity of Ply500 and Ply511 endolysins a PCR-based technique, epPCR, was used as first approach. Besides, this technique promotes the insertion of random point
mutations in unknown sequences by imposing imperfect and mutagenic reaction conditions. The
mutated sequences can generate modified proteins with improved lytic properties at specific
conditions of food storage.
Before proceeding to the gene amplification an initial PCR optimization was done in order to
determine the annealing temperatures of designed primers.
Fig. 4. – PCR of amplified protein genes using temperature gradient between 55-65°C. Gradient temperatures used for
endolysins sequences amplification – from left to right: 55°C, 57°C, 60°C, 62°C, 65°C. Agarose gel 1% concentration,
stained with Sybr Safe and run at 90 V. Legend: M – DNA 1 kb ladder.
Due to the use of KAPA Taq DNA polymerase the annealing temperatures of designed primers are
about 5°C lower than the initially calculated melting temperatures. A temperature gradient between
55-65°C was used to perform a traditional PCR to determine and optimize the annealing
temperatures of primers.
Genes were amplified over the entire temperature gradient (Fig. 4) and the annealing temperature
chosen was 65°C.
52
CHAPTER 3
RESULTS AND DISCUSSION
The ep-PCR was performed amplifying the sequences using the conditions and the primers described
in 5.1.1 and 4.2 sections of Materials and Methods. The generated products are present in Figure
4.2 which shows a good amplification step. The visualized bands correspond to the expected lengths
with a 1020 bp for plyP500 and 1176 bp for plyP511. The generated products were purified for
further utilization in ligation step.
M
Fig. 5 – Amplified endolysins sequences by ep-PCR. The generated products possess 1020 bp (plyP500) and 1176 bp
(plyP511) and were then double digested by using selected restriction enzymes and purified. Agarose gel 1%
concentration, stained with Sybr Safe and run at 90 V. Legend: M – 1 kb ladder.
Some optimizations were done in ep-PCR experiments. These alterations mainly consisted in altering
some steps. Addiction of fresh KAPA Taq DNA polymerase after fifteenth amplification cycles for
better amplification of the sequences. Also increasing and decreasing the number of cycles and
variation of the initial template concentration between 3-50 ng/µL were done in order to increase
the error rate [136][137].
According to the mostly used conditions in this experiments (20 cycles and 50 ng/µL of template
DNA), 11 to 21 mutations rate were expected for each template lenght. Furthermore, the increase
of multiple mutations leads to a high number of different enzymes that can be screened. However
when the mutation rate required is too high, the resulting proteins will carry multiple amino acid
changes and could therefore be inactive [136].
53
CHAPTER 3
RESULTS AND DISCUSSION
5.2.
Plasmid linearization and ligation
Before ligation step, cloning vector pQE-30 was digested using BamHI and SalI restriction enzymes,
according to the section 5.2 of Materials and Methods. The digestion resulted linearized plasmid
(3461 bps) and other bands that may corresponds to CBD-P35 sequence with 1187 bp length (Fig.
6)
M
Fig. 6 – Double digestion of pQE-30 cloning vector in agarose gel 0.7% concentration in order to promote better separation
of digested plasmid The gel was stained with Sybr Safe and run at 90 V. Legend: M – DNA 1 kb ladder.
After linearization the plasmid was extracted from agarose gel, purified and the recirculation
prevented by using Antarctic Phosphatase. The resulting ep-PCR amplified genes (Fig. 5) were cloned
using T4 DNA ligase following the instructions described in section 5.3 of Materials and Methods.
The lengths of generated cloned fragments are 4039 bps for ply500 gene (Fig. 7A) and 4465 bps
for ply511 gene (Fig. 7B).
5.3.
Transformation
After ligation step, the cloned vectors were initially transformed by chemical transformation
(described in section 6.2.1 of Materials and Methods) on NZY5α E. coli competent cells (nzytech)
and later on E. coli JM109 chemo-competent (preparation described in section 6.2.2 of Materials
and Methods).
54
CHAPTER 3
RESULTS AND DISCUSSION
Fig. 7 – Representative illustration pQE-30 vector cloned with ply500 (A) and ply511 (B) using Vector NTI software. The
ligation generates two plasmids with different lengths – 4039 bps and 4465 bps, respectively. Both genes are cloned
between BamHI and SalI restriction sites.
In spite of the lower yield of generated colonies, the efficiency of transformation was evaluated by
colony-PCR (section 5.1.2. of Materials and Methods).
The transformation efficiency using NZY5α E.coli chemiocompetent cells was low with only two
successful colonies transformed with pQE-30-plyP500 in contrast with no transformed colonies in
case of cloned plyP511 (Fig. 8).
Successful directed evolution experiments are the integrated results of efficient library construction
followed by a robust high-through-put screening [138]. The lower rate of successful transformed
colonies obtained discarded the chemical transformation procedure.
In order to increase the yield of transformed colonies, electroporation (Materials and Methods,
section 6.2.2) was done as it is described as an extremely high efficiency procedure for E. coli
transformation [139]. However, NZY5α E. coli cells are only chemically competent preventing its
usage for transformation by electroporation.
Therefore, the use of E. coli JM109 electrocompetent cells (Materials and Methods, section 6.1.2)
for electroporation was required.
Despite being considered a highly efficient transformation method no colonies were obtained.
Severall attempts have been made to overcome this problem. The plasmid extraction, ligation and
cloning steps were newly performed as well as newly electrocompetent cells were done however with
no practical results.
55
CHAPTER 3
RESULTS AND DISCUSSION
Fig. 8 – Colony-PCR results after “heat-shock” transformation using NZY5α E. coli competent cells. Only pQE-30 +
ply500 ligation were assembled by competent cells. Agarose gel 1% concentration, stained with Sybr Safe run 90 V.
Legend: M – DNA 1 kb ladder.
It is known that high salt concentration influences the electric conductivity, causing loss of cells
viability. In order that different volumes of ligation were also tested however the problem persisted.
The absence of colonies can also be related to the residual presence of manganese ions. This ions,
resulted from ep-PCR, can negatively affect the enzymatic digestion of amplified products and the
activity of T4 DNA ligase during ligation step [138].
Original pQE-30 vector containing original sequences of ply500 and ply511 and pUC19 cloning
vector were unsuccessfully tested as positive control, by transformation into E. coli JM109
electrocompetent cells.
Wherefore the extensive reutilization of electroporation cuvettes may lead to the accumulation of
aluminum oxide that can change the electric parameters of electroporator and negatively influence
the efficiency of transformation.
6. Cryodrilling
Another strategy to improve lytic properties of endolysins is based on biotic interactions influenced
by environment conditions. This interactions between hosts and parasites, such as phages-host
interaction, impose adaptation and counter-adaptation that results in rapid antagonistic coevolution
and population dynamics [67].
A different approach for the improvement of endolysin enzymatic activity is by adapting phage to
successive lower temperatures which acts as mutagenesis promoter. The hypothesis is that by
56
CHAPTER 3
RESULTS AND DISCUSSION
adapting phage to lower temperatures the endolysin encoded in its genome will also be modified,
and be consequently more active at lower temperatures.
The well characterized Listeria phage P100, known to be able to infect and kill a broad host range
of L. monocytogenes strains, and L. monocytogenes 5725 host cells was used in this new evolution
strategy [140].
This assay was divided in two different strategies. The first approach, called evolution, only the
Listeria phage P100 was allowed to evolve and the bacterial genotype was held constant. The second
approach, called co-evolution, both phage and host were allowed to evolve.
Fig. 9 – PCR of amplified endolysins sequences derived from co-evolved (wells 1-5) and evolved (wells 6-10) adapted
phages. Amplified products were visualized by 1% agarose gel, stained with Syber Safe, at 90 V. The marker (M) is 1 kb
ladder.
Culture transfers were done decreasing the initial temperature (25°C) two degrees until reach the
final temperature of 7°C (section 8 of Materials and Methods).
Due to the biotic interactions between phage and host under decreasing temperatures it was
expected that different adapted phages were generated. Therefore, at 7 °C, 5 phage plaques with
presumable different evolutionary adaptations were found in evolved and co-evolved populations and
then isolated. The specific primers for plyP100, already available in primers group collection, were
used for amplification of the endolysins sequences of newly adapted phages (Fig. 9) which were then
purified. Once amplified and purified, the plyP100 from isolated co-evolutionary and evolutionary
phage plaques were sequenced, aligned and compared to the original plyP100.
57
CHAPTER 3
RESULTS AND DISCUSSION
Table 3 – Sequencing results of amplified plyP100 sequences of the 5 different phage plaques isolated from Co-Evolution
(CE) and Evolution (E) populations. Amplified sequences were aligned and compared to the original plyP100. Point
mutations are observable at specific positions of the amplified sequences lenghts. Legend: A – adenine, T – thymine, G
– guanine, C – cytosine, * – absence of nucleotide.
Sequence position (kb)
CE1
Original
Fw
Rv
CE2
Original
Fw
Rv
CE3
Original
Fw
Rv
CE4
Original
Fw
Rv
CE5
Original
Fw
Rv
E1
Original
Fw
Rv
E32
Original
Fw
Rv
E3
Original
Fw
Rv
E4
Original
Fw
Rv
E5
Original
Fw
Rv
58
882
A
G
A
52
A
C
A
846
A
C
A
846
A
C
A
95
*
A
*
112
*
T
*
42
A
C
A
65
G
*
99
C
T
C
111
*
T
*
65
*
G
*
998
C
C
G
941
A
*
A
96
*
G
*
981
A
C
A
44
C
T
C
73
*
T
*
846
A
C
A
955
A
A
*
956
*
*
A
109
*
T
*
961
*
*
C
117
*
G
*
970
*
*
C
994
*
*
A
72
*
T
*
73
*
T
*
81
*
T
*
846
A
C
A
941
A
*
A
956
*
*
A
925
A
A
*
933
A
*
A
944
A
*
A
958
A
A
*
CHAPTER 3
RESULTS AND DISCUSSION
Sequencing results, compiled and presented in Table 3, show at first sight, some point mutations in
the plyP100 sequences derived from co-evolved and evolved phage populations.
However, the high length of plyP100 turns it difficult to sequence and the available primers were
used for sequencing of mutated endolysins sequences from adapted phages. Besides, it is known
that the optimal length for sequencing is about 700 bp which decreases the reliability of the point
mutations present.
The forward primer provides reliable sequencing results in the first 700 bps which contrasts with the
remaining sequence generating undefined peaks and denoting sequencing errors. Nevertheless, this
sequencing errors can be quickly detected once using the same theory applied to reverse primer.
The same but reverse argument may also be applied.
Fig. 10 – Example of sequencing chromatogram of adapted plyP100 endolysin derived from co-evolutionary adapted
phage. The putative mutations are highlighted. PlyP100CE1_Fw and PlyP100CE_Rv are the primers used for gene
sequencing.
The non-conclusive sequencing results are showed in the chromatogram example of Figure 5.2.
Despite the highlighted putative mutations are present in amplified sequences using plyP100CE_Rv
primer compared to the original sequence, the chromatogram shows undefined peaks for each
mutation. These observations contrasts with no mutations for the sequence amplified using the
plyP100_Fw primer which presents well defined peaks.
For future better amplification and sequencing, the primers must be redesigned and optimized in
order to pair with homology zone in phage genome instead of pairing with plyP100 gene as was the
case.
59
Chapter 4
Conclusions and
future perspectives
CHAPTER 4
CONCLUSIONS AND FUTURE PERSPECTIVES
1. Conclusions and future perspectives
The main goal of this work was to improve lytic properties of phage derived endolysins against
foodborne pathogen L. monocytogenes in specific food storage and processing conditions. Due to
the lack of knowledge of endolysins sequences and which type of mutation can improve its lytic
activity represented the most scientific challenge of this study. As result two different approaches of
directed evolution were performed to overcome this problem – ep-PCR and cryodrilling.

Concerning the first stage of this study – phage isolation – no listerial phage was identified
in all used effluents and only the presence of one prophage was detected. This prophage is
within L. monocytogenes strain scott A genome and when excised it is known to act on other
listerial strains with 4b serovar. Future experiments can be focused on its excision and
consequently improvement of lytic properties.

In silico analysis of the Ply500 and Ply511 endolysins revealed a modular structure for both
proteins. However, as can be observed in Ply511 endolysin which possess a central catalytic
domain, the modular structure (i.e. the presence of CBD) is not always necessary for the
lytic activity of the protein. As the function of CBD domain of Ply511 is not known, interesting
future approaches may involve whether its presence or not influences potential
improvements of lytic properties of lysins against a wide range of listerial serovars. Another
possible approach may be related to the modification of endolysin binding domain. Through
the use of specifically designed primers, the proteins sequences would successively be
shortened and an increase or decrease of catalytic properties can be evaluated.

Preliminary antimicrobial assays using wild-type proteins revealed lower catalytic activity at
storage (refrigeration) temperatures emphasizing the need to improve those properties.
Moreover, several limitations (absence of refrigerated spectrophometer) to keep these
temperatures constant were shown, decreasing the reproducibility of these antibacterial
assays. Consequently, further screenings at low temperatures has yet to be extensively
optimized.

The first approach for endolysins lytic improvement – ep-PCR – revealed several limitations
during cloning and transformation steps which did not allowed the fulfillment of the screening
stage. Furthermore, this was a very time-consuming methodology with several interrelated
steps. Future experiments to generate improved catalytic properties of this protein should
use alternative techniques. Site-saturating mutagenesis (SSM) technique is more efficient
and eliminates time-consuming subcloning ligation.
63
CHAPTER 4
CONCLUSIONS AND FUTURE PERSPECTIVES

Regarding the second approach for endolysins improvements – cryodrilling – a few point
mutations in PlyP100 sequence of coevolutionary and evolutionary phage populations were
achieved. Moreover this strategy was less problematical than the first approach. However,
there is no confirmation that mutations improve lytic activity of phage derived endolysins and
therefore no conclusion can be retrieved about efficiency between coevolutionary and
evolutionary phage populations. Further improvements for future works related to phage
adaptation mainly involves the increasing of adaptation time at refrigeration temperatures in
order to promote higher genetic diversity and consequently increasing the probabilities of
isolation of well adapted endolysins. Also new primers design should be done once those
that were used in this study pair within protein sequence
64
Bibliography
1. Vázquez-Boland J a, Kuhn M, Berche P, Chakraborty T, Domínguez-Bernal G, Goebel W,
González-Zorn B, Wehland J, Kreft J: Listeria pathogenesis and molecular virulence determinants.
Clin Microbiol Rev 2001, 14:584–640.
2. Mcauliffe O, Jordan KN: Biotechnological Approaches for Control of Listeria monocytogenes in
Foods. 2012:267–280.
3. Mclauchlin J, Division T, Reagents M: Human listeriosis in Britain , 1967-85 , a summary of 722
cases. 1990:181–189.
4. Doganay M: Listeriosis: clinical presentation. FEMS Immunol Med Microbiol 2003, 35:173–175.
5. Safdar A, Armstrong D: Listeriosis in Patients at a Comprehensive Cancer Center , 1955 –
1997. 2003, 4095:359–364.
6. Chan YC, Wiedmann M: Physiology and genetics of Listeria monocytogenes survival and growth
at cold temperatures. Crit Rev Food Sci Nutr 2009, 49:237–53.
7. Directorate F, Canada W: Listeria monocytogenes, a Food-Borne Pathogen. Microbiol Rev 1991,
55:752.
8. Denny J, Agency HP, Kingdom U: S u r v e i ll a n c e a n d o u t b r e a k r e p o r t s H u man L
i ste r ia m o n o cy to g e n e s i n f e cti o n s i n E u rope - an opportu n ity for i m prove d E u
ropean s u r v e i ll a n c e. 2006, 2006:1–5.
9. Buchrieser C: Biodiversity of the species Listeria monocytogenes and the genus Listeria.
Microbes Infect 2007, 9:1147–1155.
10. Gandhi M, Chikindas ML: Listeria: A foodborne pathogen that knows how to survive. Int J Food
Microbiol 2007, 113:1–15.
11. Beales N: Adaptation of microorganisms to cold temperatures, weak acid preservatives, low
pH, and osmotic stress: a review. Compr Rev Food Sci Food … 2004, 3:1–20.
12. Thieringer H, Jones P, Inouye M: Cold shock and adaptation. Bioessays 1998:49–57.
13. Angelidis AS, Smith GM: Role of the Glycine Betaine and Carnitine Transporters in Adaptation
of Listeria monocytogenes to Chill Stress in Defined Medium. Appl Environ Microbiol 2003,
69:7492–7498.
14. Wemekamp-Kamphuis H: Molecular and physiological analysis of the role of osmolyte
transporters BetL, Gbu, and OpuC in growth of Listeria monocytogenes at low temperatures. Appl
… 2004, 70:2912–2918.
63
15. Phan-Thanh L, Mahouin F: A proteomic approach to study the acid response in Listeria
monocytogenes. Electrophoresis 1999, 20:2214–2224.
16. Small, P.L.C., Waterman SR: Acid stress, anaerobiosis and gadCB lessons from Lactococcus
lactis and Escherichia coli. Trends Microbiol 1998, 6:214–216.
17. Arenas NE, Gutiérrez A, Sánchez-gómez M, Salazar LM, Montaño ER: Structural features of the
two-component system LisR / LisK suggests multiple responses for the adaptation and survival of
Listeria monocytogenes. J Fac Sci Pontif Univ Javeriana 2013, 18:189–202.
18. Morvan a, Moubareck C, Leclercq a, Hervé-Bazin M, Bremont S, Lecuit M, Courvalin P, Le
Monnier a: Antimicrobial resistance of Listeria monocytogenes strains isolated from humans in
France. Antimicrob Agents Chemother 2010, 54:2728–31.
19. Conter M, Paludi D, Zanardi E, Ghidini S, Vergara A, Ianieri A: Characterization of antimicrobial
resistance of foodborne Listeria monocytogenes. Int J Food Microbiol 2009, 128:497–500.
20. Aureli P, Ferrini AM, Mannoni V, Hodzic S, Wedell-Weergaard C, Oliva B: Susceptibility of
Listeria monocytogenes isolated from food in Italy to antibiotics. Int J Food Microbiol 2003,
83:325–330.
21. Srinivasan V, Nam HM, Nguyen LT, Tamilselvam B, Murinda SE, Oliver SP: Prevalence of
antimicrobial resistance genes in Listeria monocytogenes isolated from dairy farms. Foodborne
Pathog Dis 2005, 2:201–211.
22. Mahony J, McAuliffe O, Ross RP, van Sinderen D: Bacteriophages as biocontrol agents of food
pathogens. Curr Opin Biotechnol 2011, 22:157–63.
23. Sharp R: Bacteriophages: biology and history. J Chem Technol Biotechnol 2001, 76:667–672.
24. Sulakvelidze A, Alavidze Z, Morris JG: Bacteriophage therapy. Antimicrob Agents Chemother
2001:649–659.
25. Oliveira H, Melo L, Santos S: Molecular aspects and comparative genomics of bacteriophage
endolysins. J … 2013(February):1–44.
26. Ackermann H: Bacteriophages. 2009, 501:127–140. [Methods in Molecular Biology]
27. CAMPBELL A, DELCAMPILLO-CAMPBELL A: MUTANT OF LAMBDA BACTERIOPHAGE
PRODUCING A THERMOLABILE ENDOLYSIN. J Bacteriol 1963, 85:1202–1207.
28. Klumpp J, Loessner MJ: Genomes , evolution , and application Listeria phages. Bacteriophage
2013, 3(September):1–8.
29. Klumpp J, Lavigne R, Loessner MJ, Ackermann H-W: The SPO1-related bacteriophages. Arch
Virol 2010, 155:1547–61.
64
30. Hagens S, Loessner M: Application of bacteriophages for detection and control of foodborne
pathogens. Appl Microbiol Biotechnol 2007, 76:513–519.
31. Soni KA, Nannapaneni R: Removal of Listeria monocytogenes biofilms with bacteriophage
P100. J Food Prot 2010, 73:1519–24.
32. Soni K, Nannapaneni R: Bacteriophage significantly reduces Listeria monocytogenes on raw
salmon fillet tissue. J Food Prot 2010, 73:32–38.
33. Holck A, Berg J: Inhibition of Listeria monocytogenes in cooked ham by virulent bacteriophages
and protective cultures. Appl Environ Microbiol 2009, 75:6944–6946.
34. Leverentz B: Optimizing concentration and timing of a phage spray application to reduce
Listeria monocytogenes on honeydew melon tissue. J Food … 2004, 67:1682–1686.
35. Guenther S, Huwyler D, Richard S, Loessner MJ: Virulent bacteriophage for efficient biocontrol
of listeria monocytogenes in ready-to-eat foods. Appl Environ Microbiol 2009, 75:93–100.
36. Jagow C von, Teufer T: Which path to go - On how to find a Passage for Innovations through
the Jungle of EU-Food Law – discussed by the Example of Bacteriophages. Eur Food Feed L Rev
2007:136–145.
37. Callewaert L, Walmagh M, Michiels CW, Lavigne R: Food applications of bacterial cell wall
hydrolases. Curr Opin Biotechnol 2011:164–171.
38. Jacob F, Fuerst CR: The mechanism of lysis by phage studied with defective lysogenic bacteria.
J Gen Microbiol 1958, 18:518–26.
39. Loessner MJ: Bacteriophage endolysins--current state of research and applications. Curr Opin
Microbiol 2005, 8:480–7.
40. Borysowski J, Weber-dabrowska B: Experimental Biology and Medicine Bacteriophage
Endolysins as a Novel Class of Antibacterial Agents. Exp Biol Med (Maywood) 2008, 231:366–377.
41. Fischetti V a: Bacteriophage endolysins: a novel anti-infective to control Gram-positive
pathogens. Int J Med Microbiol 2010, 300:357–62.
42. Wang IN, Smith DL, Young R: Holins: the protein clocks of bacteriophage infections. Annu Rev
Microbiol 2000, 54:799–825.
43. Wang I-N, Deaton J, Young R: Sizing the Holin Lesion with an Endolysin- -Galactosidase Fusion.
J Bacteriol 2003:779–787.
44. Fischetti V a: Using phage lytic enzymes to control pathogenic bacteria. BMC Oral Health
2006, 6 Suppl 1:S16.
45. Schmelcher M, Donovan DM, Loessner MJ: Bacteriophage endolysins as novel antimicrobials.
Future Microbiol 2012, 7:1147–71.
65
46. Callewaert L, Walmagh M, Michiels CW, Lavigne R: Food applications of bacterial cell wall
hydrolases. Curr Opin Biotechnol 2011, 22:164–71.
47. Obeso JM, Martínez B, Rodríguez A, García P: Lytic activity of the recombinant staphylococcal
bacteriophage ΦH5 endolysin active against Staphylococcus aureus in milk. Int J Food Microbiol
2008, 128:212–218.
48. Donovan D, Dong S: Peptidoglycan hydrolase fusions maintain their parental specificities. Appl
… 2006, 72:2988–2996.
49. Celia LK, Nelson D, Kerr DE: Characterization of a bacteriophage lysin (Ply700) from
Streptococcus uberis. Vet Microbiol 2008, 130:107–117.
50. Mayer MJ, Narbad A, Gasson MJ: Molecular characterization of a Clostridium difficile
bacteriophage and its cloned biologically active endolysin. J Bacteriol 2008, 190:6734–6740.
51. Schmelcher M, Waldherr F, Loessner M: Listeria bacteriophage peptidoglycan hydrolases
feature high thermoresistance and reveal increased activity after divalent metal cation substitution.
Appl Microbiol … 2012:633–643.
52. Turner MS, Waldherr F, Loessner MJ, Giffard PM: Antimicrobial activity of lysostaphin and a
Listeria monocytogenes bacteriophage endolysin produced and secreted by lactic acid bacteria.
Syst Appl Microbiol 2007, 30:58–67.
53. Stentz R, Bongaerts RJ, Gunning AP, Gasson M, Shearman C: Controlled release of protein
from viable lactococcus lactis cells. Appl Environ Microbiol 2010, 76:3026–3031.
54. Mayer MJ, Payne J, Gasson MJ, Narbad A: Genomic sequence and characterization of the
virulent bacteriophage ??CTP1 from Clostridium tyrobutyricum and heterologous expression of its
endolysin. Appl Environ Microbiol 2010, 76:5415–5422.
55. Oliveira H, Azeredo J, Lavigne R, Kluskens LD: Bacteriophage endolysins as a response to
emerging foodborne pathogens. Trends Food Sci Technol 2012, 28:103–115.
56. Todar’s Online Textbook of Bacteriology [http://textbookofbacteriology.net/structure_5.html]
57. Schleifer KH, Kandler O: Peptidoglycan types of bacterial cell walls and their taxonomic
implications. Bacteriol Rev 1972, 36:407–77.
58. Pritchard DG, Dong S, Kirk MC, Cartee RT, Baker JR: LambdaSa1 and LambdaSa2 prophage
lysins of Streptococcus agalactiae. Appl Environ Microbiol 2007, 73:7150–4.
59. Pritchard DG, Dong S, Baker JR, Engler J a: The bifunctional peptidoglycan lysin of
Streptococcus agalactiae bacteriophage B30. Microbiology 2004, 150(Pt 7):2079–87.
60. Vollmer W, Joris B, Charlier P, Foster S: Bacterial peptidoglycan (murein) hydrolases. FEMS
Microbiol Rev 2008, 32:259–86.
66
61. Nelson D, Schuch R, Chahales P, Zhu S, Fischetti V a: PlyC: a multimeric bacteriophage lysin.
Proc Natl Acad Sci U S A 2006, 103:10765–70.
62. Loessner M, Kramer K: C‐terminal domains of Listeria monocytogenes bacteriophage murein
hydrolases determine specific recognition and high‐affinity binding to bacterial cell wall. Mol …
2002, 44:335–349.
63. Sheehan MM, García JL, López R, García P: Analysis of the catalytic domain of the lysin of the
lactococcal bacteriophage Tuc2009 by chimeric gene assembling. FEMS Microbiol Lett 1996,
140:23–8.
64. López R, García E, García P, García JL: The pneumococcal cell wall degrading enzymes: a
modular design to create new lysins?. Microb Drug Resist 1997, 3:199–211.
65. Hermoso JA, Monterroso B, Albert A, Galán B, Ahrazem O, García P, Martínez-Ripoll M, García
JL, Menéndez M: Structural basis for selective recognition of pneumococcal cell wall by modular
endolysin from phage Cp-1. Structure 2003, 11:1239–1249.
66. Paterson S, Vogwill T, Buckling A, Benmayor R, Spiers AJ, Thomson NR, Quail M, Smith F,
Walker D, Libberton B, Fenton A, Hall N, Brockhurst MA: Antagonistic coevolution accelerates
molecular evolution. Nature 2010, 464:275–278.
67. Paterson S, Vogwill T, Buckling A, Benmayor R, Spiers AJ, Thomson NR, Quail M, Smith F,
Walker D, Libberton B, Fenton A, Hall N, Brockhurst M a: Antagonistic coevolution accelerates
molecular evolution. Nature 2010, 464:275–8.
68. Betts a., Kaltz O, Hochberg ME: Contrasted coevolutionary dynamics between a bacterial
pathogen and its bacteriophages. Proc Natl Acad Sci 2014, 111.
69. Buckling A, Rainey PB: Antagonistic coevolution between a bacterium and a bacteriophage.
Proc Biol Sci 2002, 269:931–6.
70. Mills DR, Peterson RL, Spiegelman S: An extracellular Darwinian experiment with a selfduplicating nucleic acid molecule. Proc Natl Acad Sci U S A 1967, 58:217–24.
71. Sen S, Venkata Dasu V, Mandal B: Developments in Directed Evolution for Improving Enzyme
Functions. Appl Biochem Biotechnol 2007, 143:212–223.
72. Roodveldt C, Aharoni A, Tawfik DS: Directed evolution of proteins for heterologous expression
and stability. Curr Opin Struct Biol 2005, 15:50–6.
73. Arnold FH, Volkov a a: Directed evolution of biocatalysts. Curr Opin Chem Biol 1999, 3:54–9.
74. Hibbert EG, Dalby P a: Directed evolution strategies for improved enzymatic performance.
Microb Cell Fact 2005, 4:29.
75. M. J. McPherson: Directed Mutagenesis: A Pratical Approach (the Pratical Approach Series).
1st edition. Oxford University Press, USA; 1991:282.
67
76. Carter P: Site-directed mutagenesis. Biochem J 1986, 237:1–7.
77. Zhang B, Zhang X, An X, Ran D, Zhou Y, Lu J, Tong Y: An easy-to-use site-directed mutagenesis
method with a designed restriction site for convenient and reliable mutant screening. J Zhejiang
Univ Sci B 2009, 10:479–82.
78. Wells JA, Vasser M, Powers DB: Cassette mutagenesis: an efficient method for generation of
multiple mutations at defined sites. Gene 1985, 34:315–323.
79. Engels JW, Uhlmann E: Gene Synthesis[New Synthetic Methods(77)]. Angew Chemie Int Ed
English 1989, 28:716–734.
80. Wan H, Li Y, Fan Y, Meng F, Chen C, Zhou Q: A site-directed mutagenesis method particularly
useful for creating otherwise difficult-to-make mutants and alanine scanning. Anal Biochem 2012,
420:163–70.
81. Bennett MJ, Schlunegger MP, Eisenberg D: 3D domain swapping: a mechanism for oligomer
assembly. Protein Sci 1995, 4:2455–2468.
82. Heringa J, Taylor WR: Three-dimensional domain duplication, swapping and stealing. Curr Opin
Struct Biol 1997, 7:416–421.
83. Ostermeier M, Benkovic SJ: Evolution of protein function by domain swapping. Adv Protein
Chem 2000, 55:29–77.
84. Schmelcher M, Donovan D, Loessner M: Bacteriophage endolysins as novel antimicrobials.
Future Microbiol 2012, 7:1147–1171.
85. De Souza SJ: Domain shuffling and the increasing complexity of biological networks. Bioessays
2012, 34:655–7.
86. Labrou NE: Random mutagenesis methods for in vitro directed enzyme evolution. Curr Protein
Pept Sci 2010, 11:91–100.
87. Kadonaga JT, Knowles JR: Nucleic Acids Research. 1985, V:1733–1745.
88. Greener A, Callahan M, Jerpseth B: An Efficient Random Mutagenesis Technique Using an E .
coli Mutator Strain. 1997.
89. Stemmer WP: DNA shuffling by random fragmentation and reassembly: in vitro recombination
for molecular evolution. Proc Natl Acad Sci U S A 1994, 91(October):10747–10751.
90. Parikh MR, Matsumura I: Site-saturation mutagenesis is more efficient than DNA shuffling for
the directed evolution of beta-fucosidase from beta-galactosidase. J Mol Biol 2005, 352:621–8.
91. Fujii R, Kitaoka M, Hayashi K: One-step random mutagenesis by error-prone rolling circle
amplification. Nucleic Acids Res 2004, 32:e145.
68
92. Siloto RMP, Weselake RJ: Site saturation mutagenesis: Methods and applications in protein
engineering. Biocatal Agric Biotechnol 2012, 1:181–189.
93. Tang L, Gao H, Zhu X, Wang X, Zhou M, Jiang R: Construction of “small-intelligent” focused
mutagenesis libraries using well-designed combinatorial degenerate primers. Biotechniques 2012,
52:149–58.
94. Li HM, Mei LH, Urlacher VB, Schmid RD: Cytochrome P450 BM-3 evolved by random and
saturation mutagenesis as an effective indole-hydroxylating catalyst. Appl Biochem Biotechnol
2008, 144:27–36.
95. Ang EL, Obbard JP, Zhao H: Directed evolution of aniline dioxygenase for enhanced
bioremediation of aromatic amines. Appl Microbiol Biotechnol 2009, 81:1063–1070.
96. Kotzia GA, Labrou NE: Engineering thermal stability of l-asparaginase by in vitro directed
evolution. FEBS J 2009, 276:1750–1761.
97. Wilson DS, Keefe AD: Random mutagenesis by PCR. Curr Protoc Mol Biol 2001, Chapter
8:Unit8.3.
98. Beckman RA, Mildvan AS, Loeb LA: On the fidelity of DNA replication: manganese mutagenesis
in vitro. Biochemistry 1985, 24:5810–5817.
99. Eckert K a, Kunkel T a: DNA polymerase fidelity and the polymerase chain reaction. Genome
Res 1991, 1:17–24.
100. Cadwell RC, Joyce GF: Randomization of genes by PCR mutagenesis. Genome Res 1992,
2:28–33.
101. Fujii R, Kitaoka M, Hayashi K: One-step random mutagenesis by error-prone rolling circle
amplification. Nucleic Acids Res 2004, 32:e145.
102. Vanhercke T, Ampe C, Tirry L, Denolf P: Reducing mutational bias in random protein libraries.
Anal Biochem 2005, 339:9–14.
103. Asano Y, Kira I, Yokozeki K: Alteration of substrate specificity of aspartase by directed
evolution. Biomol Eng 2005, 22:95–101.
104. Emond S, Mondon P, Pizzut-Serin S, Douchy L, Crozet F, Bouayadi K, Kharrat H, PotockiVéronèse G, Monsan P, Remaud-Simeon M: A novel random mutagenesis approach using human
mutagenic DNA polymerases to generate enzyme variant libraries. Protein Eng Des Sel 2008,
21:267–274.
105. Maeda T, Sanchez-Torres V, Wood TK: Protein engineering of hydrogenase 3 to enhance
hydrogen production. Appl Microbiol Biotechnol 2008, 79:77–86.
69
106. Ding X, Snyder AK, Shaw R, Farmerie WG, Song W-Y: Direct retransformation of yeast with
plasmid DNA isolated from single yeast colonies using rolling circle amplification. Biotechniques
2003, 35:774–6, 778–9.
107. Schmelcher M, Tchang VS, Loessner MJ: Domain shuffling and module engineering of
Listeria phage endolysins for enhanced lytic activity and binding affinity. Microb Biotechnol 2011,
4:651–62.
108. Kikkawa H, Fujinami Y, Suzuki S, Yasuda J: Identification of the amino acid residues critical
for specific binding of the bacteriolytic enzyme of gamma-phage, PlyG, to Bacillus anthracis.
Biochem Biophys Res Commun 2007, 363:531–5.
109. Ale- E, Fujiwara T, Aoki S, Komatsuzawa H, Nishida T, Ohara M, Suginaka H, Sugai M:
Mutation Analysis of the Histidine Residues in the Glycylglycine. 2005, 187:480–487.
110. Low LY, Yang C, Perego M, Osterman A, Liddington R: Role of net charge on catalytic domain
and influence of cell wall binding domain on bactericidal activity, specificity, and host range of
phage lysins. J Biol Chem 2011, 286:34391–403.
111. Díaz E, López R, García JL: Chimeric phage-bacterial enzymes: a clue to the modular
evolution of genes. Proc Natl Acad Sci U S A 1990, 87:8125–9.
112. Diaz E, López R, Garcia JL: Chimeric pneumococcal cell wall lytic enzymes reveal important
physiological and evolutionary traits. J Biol Chem 1991, 266:5464–71.
113. Croux C, Ronda C, López R, García JL: Interchange of functional domains switches enzyme
specificity: construction of a chimeric pneumococcal-clostridial cell wall lytic enzyme. Mol Microbiol
1993, 9:1019–25.
114. Donovan DM, Foster-Frey J, Dong S, Rousseau GM, Moineau S, Pritchard DG: The cell lysis
activity of the Streptococcus agalactiae bacteriophage B30 endolysin relies on the cysteine,
histidine-dependent amidohydrolase/peptidase domain. Appl Environ Microbiol 2006, 72:5108–
12.
115. Manoharadas S, Witte A, Bläsi U: Antimicrobial activity of a chimeric enzybiotic towards
Staphylococcus aureus. J Biotechnol 2009, 139:118–23.
116. Heselpoth RD, Nelson DC: A new screening method for the directed evolution of thermostable
bacteriolytic enzymes. J Vis Exp 2012:1–9.
117. Santos SB, Carvalho CM, Sillankorva S, Nicolau A, Ferreira EC, Azeredo J: The use of
antibiotics to improve phage detection and enumeration by the double-layer agar technique. BMC
Microbiol 2009, 9:148.
118. Schägger H, von Jagow G: Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis
for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem 1987, 166:368–79.
70
119. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK,
Goeke NM, Olson BJ, Klenk DC: Measurement of protein using bicinchoninic acid. Anal Biochem
1985, 150:76–85.
120. Lavigne R, Briers Y, Hertveldt K, Robben J, Volckaert G: Identification and characterization of
a highly thermostable bacteriophage lysozyme. Cell Mol Life Sci 2004, 61:2753–9.
121. SantaLucia J: A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor
thermodynamics. Proc Natl Acad Sci U S A 1998, 95:1460–5.
122. Owczarzy R, You Y, Moreira BG, Manthey J a, Huang L, Behlke M a, Walder J a: Effects of
sodium ions on DNA duplex oligomers: improved predictions of melting temperatures.
Biochemistry 2004, 43:3537–54.
123. Vincze T: NEBcutter: a program to cleave DNA with restriction enzymes. Nucleic Acids Res
2003, 31:3688–3691.
124. Pritchard L, Corne D, Kell D, Rowland J, Winson M: A general model of error-prone PCR. J
Theor Biol 2005, 234:497–509.
125. Seidman CE, Struhl K: Introduction of plasmid DNA into cells. Curr Protoc Protein Sci 2001,
Appendix 4:4D.
126. Oliveira H, Melo LDR, Santos SB, Nóbrega FL, Ferreira EC, Cerca N, Azeredo J, Kluskens LD:
Molecular aspects and comparative genomics of bacteriophage endolysins. J Virol 2013, 87:4558–
70.
127. Briers Y, Klumpp J, Schuppler M, Loessner MJ: Genome sequence of Listeria monocytogenes
Scott A, a clinical isolate from a food-borne listeriosis outbreak. J Bacteriol 2011, 193:4284–5.
128. Zimmer M, Sattelberger E, Inman RB, Calendar R, Loessner MJ: Genome and proteome of
Listeria monocytogenes phage PSA: an unusual case for programmed + 1 translational
frameshifting in structural protein synthesis. Mol Microbiol 2003, 50:303–317.
129. Lauer P, Yin M, Chow N, Loessner MJ, Portnoy A, Calendar R, Portnoy DA: Construction,
characterization, and use of two Listeria monocytogenes site-specific phage integration vectors. J …
2002, 184:4177–4186.
130. Tišáková L, Godány A, Lenka R: Bacteriophage endolysins and their use in biotechnological
processes. J Microbiol Biotech Food Sci 2014, 3:164–170.
131. Eugster MR, Loessner MJ: Wall teichoic acids restrict access of bacteriophage endolysin
Ply118, Ply511, and PlyP40 cell wall binding domains to the Listeria monocytogenes
peptidoglycan. J Bacteriol 2012, 194:6498–506.
132. Pontello M, Guaita A, Sala G, Cipolla M, Gattuso A, Sonnessa M, Gianfranceschi MV: Listeria
monocytogenes serotypes in human infections (Italy, 2000-2010). Ann Ist Super Sanita 2012,
48:146–150.
71
133. Schmelcher M, Waldherr F, Loessner MJ: Listeria bacteriophage peptidoglycan hydrolases
feature high thermoresistance and reveal increased activity after divalent metal cation substitution.
Appl Microbiol Biotechnol 2012, 93:633–43.
134. Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P: Differentiation of the Major Listeria
monocytogenes Serovars by Multiplex PCR. J Clin Microbiol 2004, 42:3819–3822.
135. Schmelcher M, Shabarova T, Eugster MR, Eichenseher F, Tchang VS, Banz M, Loessner MJ:
Rapid multiplex detection and differentiation of Listeria cells by use of fluorescent phage endolysin
cell wall binding domains. Appl Environ Microbiol 2010, 76:5745–5756.
136. Wilson D, Keefe A: Random mutagenesis by PCR. Curr Protoc Mol Biol 2001:1–9.
137. Cirino P, Mayer K, Umeno D: Generating mutant libraries using error-prone PCR. Dir Evol Libr
Creat 2003, 231:3–9.
138. Wang T-W, Zhu H, Ma X-Y, Zhang T, Ma Y-S, Wei D-Z: Mutant library construction in directed
molecular evolution: casting a wider net. Mol Biotechnol 2006, 34:55–68.
139. Dower WJ, Miller JF, Ragsdale CW: High efficiency transformation of E. coli by high voltage
electroporation. Nucleic Acids Res 1988, 16:6127–45.
140. Carlton RM, Noordman WH, Biswas B, de Meester ED, Loessner MJ: Bacteriophage P100 for
control of Listeria monocytogenes in foods: genome sequence, bioinformatic analyses, oral toxicity
study, and application. Regul Toxicol Pharmacol 2005, 43:301–12.
72
Anexe A – SDS-PAGE gel composition
Table A1 - Components and volumes used for SDS-PAGE gels preparation. The present volumes were used for
preparation of four gels.
Stacking Gel
Separating Gel
3,75%
12%
2 mL
10mL
Tris-HCl 0,5M pH 6,8
4 mL
-
Tris-HCl 1,5M pH 8,8
-
3 mL
9 mL
9,6 mL
SDS 10%
160 µL
240 µL
TEMED
12 µL
12 µL
PSA 10%
800 µL
1,2 mL
Acrylamide-Bisacrylamide
(30%/0.8% p/v)
H2O ultra-pure
73
Anexe B – Endolysins genes
ply500
ATGGCATTAACAGAGGCATGGCTAATTGAAAAAGCAAATCGCAAATTGAATGCTGGGGGA
ATGTATAAAATTACATCGGATAAAACACGAAATGTAATTAAAAAAATGGCAAAAGAAGGT
ATTTATCTTTGTGTTGCGCAAGGTTACCGCTCAACAGCGGAACAAAATGCGCTATATGCA
CAAGGGAGAACCAAACCTGGAGCAATTGTTACTAATGCCAAGGGCGGGCAATCTAATCAC
AACTACGGGGTAGCTGTTGACTTGTGCTTGTATACAAATGACGGAAAAGATGTTATTTGG
GAGTCAACAACTTCCCGGTGGAAAAAGGTTGTTGCTGCTATGAAAGCAGAAGGGTTTAAA
TGGGGCGGAGACTGGAAAAGTTTTAAAGACTATCCGCATTTTGAACTATGTGATGCTGTA
AGTGGTGAGAAAATCCCTGCTGCAACACAAAACACTAATACAAATTCAAATCGTTACGAG
GGTAAAGTCATGATAGCGCACCACTGCTACCGAAAATGGACTTTAAATCATCACCATTCC
GCATGTATAAGGTAGGAACTGAGTTCTTAGTATATGATCATAATCAATATTGGTACAAG
ACATACATTGATGACAAACTTTACTACATGTATAAAAGCTTTTGCGATGTTGTAGCTAAA
AAAGACGCAAAAGGTCGCATCAAAGTTCGAATTAAAAGCGCGAAAGACTTGCGTATTCCA
GTCTGGAATAACATAAAATTGAATTCTGGGAAAATTAAATGGTATGCACCCAATGTAAAA
CTAGCGTGGTACAACTATCGAAGAGGATATTTAGAGCTATGGTATCCGAACGACGGCTGG
TATTACACAGCAGAATACTTCTTAAAATAA
Fig. B1– Endolysin Ply500 sequence derived from Listeria phage A500.
ply511
ATGGTAAAATATACCGTAGAGAACAAAATTATTGCAGGATTACCTAAAGGTAAACTAAAA
GGGGCTAACTTTGTTATTGCTCATGAAACTGCAAATAGCAAGTCTACTATTGACAATGAA
GTAAGCTACATGACTAGGAACTGGAAGAACGCATTTGTAACTCACTTTGTAGGTGGCGGA
GGTAGAGTCGTTCAGGTTGCTAATGTAAACTATGTTTCTTGGGGAGCAGGTCAGTATGCT
AACTCTTATTCCTATGCGCAGGTAGAGTTGTGCCGTACAAGTAATGCAACTACATTTAAG
AAAGACTATGAAGTGTACTGTCAATTACTAGTAGACCTAGCTAAAAAAGCAGGTATCCCT
ATTACACTTGACTCTGGTAGTAAAACTAGTGATAAAGGTATTAAATCCCATAAATGGGTT
GCTGATAAGCTAGGAGGAACAACACACCAAGACCCATATGCTTACTTAAGCTCATGGGGT
ATTAGTAAAGCACAATTTGCTAGTGACTTGGCTAAAGTATCTGGCGGAGGAAACACAGGA
ACAGCGCCAGCTAAACCAAGCACACCAGCACCTAAACCAAGCACACCATCTACTAACCTA
GACAAACTTGGCTTAGTAGACTACATGAACGCTAAGAAAATGGACTCTAGCTACAGTAAC
AGAGATAAGTTAGCTAAACAGTATGGTATTGCTAACTATTCAGGAACAGCTAGCCAGAAC
ACTACACTCCTTAGTAAAATTAAAGGAGGAGCACCTAAACCAAGCACACCAGCACCTAAA
CCTAGTACATCTACAGCTAAGAAAATTTATTTCCCACCAAATAAAGGAAACTGGTCTGTG
TATCCAACAAATAAAGCACCCGTTAAGGCTAATGCTATTGGTGCTATTAACCCTACTAAA
TTCGGAGGATTGACTTACACTATCCAAAAAGATAGAGGAAACGGTGTATACGAAATCCAA
ACAGACCAATTCGGCAGAGTTCAAGTCTATGGTGCACCTAGTACAGGAGCAGTTATCAAA
AAATAA
Fig. B2– Endolysin Ply511 sequence derived from Listeria phage A511.
74
plyP100
ATGGTAAAATATACCGTAGAGAACAAAATTATTGCAGGATTACCTAAAGGTAAACTAAAA
GGGGCTAACTTTGTTATTGCTCATGAAACTGCAAATAGCAAGTCTACTATTGACAATGAA
GTAAGCTACATGACTAGGAACTGGAAGAACGCATTTGTAACTCACTTTGTAGGTGGCGGA
GGTAGAGTCGTTCAGGTTGCTAATGTAAACTATGTTTCTTGGGGAGCAGGTCAGTATGCT
AACTCTTATTCCTATGCGCAGGTAGAGTTGTGCCGTACAAGTAATGCAACTACATTTAAG
AAAGACTATGAAGTGTACTGTCAATTACTAGTAGACCTAGCTAAAAAAGCAGGTATCCCT
ATTACACTTGACTCTGGTAGTAAAACTAGTGATAAAGGTATTAAATCCCATAAATGGGTT
GCTGATAAGCTAGGAGGAACAACACACCAAGACCCATATGCTTACTTAAGCTCATGGGGT
ATTAGTAAAGCACAATTTGCTAGTGACTTGGCTAAAGTATCTGGCGGAGGAAACACAGGA
ACAGCGCCAGCTAAACCAAGCACACCAGCACCTAAACCAAGCACACCATCTACTAACCTA
GACAAACTTGGCTTAGTAGACTACATGAACGCTAAGAAAATGGACTCTAGCTACAGTAAC
AGAGCTAAGTTAGCTAAACAGTATGGTATTGCTAACTATTCAGGAACAGCTAGCCAGAAC
ACTACACTCCTTAGTAAAATTAAAGGAGGAGCACCTAAACCAAGCACACCAGCACCTAAA
CCTAGTACATCTACAGCTAAGAAAATTTATTTCCCACCAAATAAAGGAAACTGGTCTGTG
TATCCAACAAATAAAGCACCCGTTAAGGCTAATGCTATTGGTGCTATTAACCCTACTAAA
TTCGGAGGATTGACTTACACTATCCAAAAAGATAGAGGAAACGGTGTATACGAAATCCAA
ACAGACCAATTCGGCAGAGTTCAAGTCTATGGTGCACCTAGTACAGGAGCAGTTATCAAA
AAATAA
Fig. B3– Endolysin PlyP100 sequence derived from Listeria phage P100.
75
Anexe C – Protein quantification
2500
y = 1049,3x - 173,85
R² = 0,9964
Protein conc. (ug/ml)
2000
1500
1000
500
0
0,00
0,50
1,00
1,50
2,00
2,50
OD (580 nm)
Series1
Linear (Series1)
Linear (Series1)
Fig. C4– Calibration curve of BSA protein used in BCA assay for protein quantification.
76