Download emboj201056-sup

Supplementary information
Supplementary text
In addition to KDM2A protein, a smaller protein was expressed by the KDM2A gene
In typical patterns of histone methylation, H3K4me3 is enriched in the promoter
regions of active genes, H3K36me3 signals are elevated beyond the transcription start
sites, and H3K27me3 signals are reduced in the entire active gene (Barski et al, 2007;
Li et al, 2007). Recently, high-resolution maps of the genome-wide distribution of 20
histone lysine and arginine methylations as well as the distribution of RNA polymerase
II across the human genome were published (Barski et al, 2007). When the status of the
genome of KDM2A was checked on the website published in that paper, the peak of the
H3K4me3 signal was clearly detected half way into the transcribed region in addition
to the transcription-start site reported before (Figure S1A). This peak exists between
exons 12 and 13 of the KDM2A gene. Pol II has peaks similar to that of the H3K4me3
mark. H3K36me3 signals were elevated between exons 13 and 21, and H3K27me3
signals were not enriched in the KDM2A gene. These results suggest that transcription
is initiated in intron 12 as well as in the known transcription start site (exon 1) in the
KDM2A gene.
An EST clone, BX381770, contains a nucleotide sequence of part of intron 12 of
the KDM2A gene. Using primers consistent with a sequence found in both intron 12
and BX381770 and one in exon 21, the DNA fragment was amplified from total cDNA
of human cells by PCR protocol and sequenced. The sequencing results indicate that it
was a transcript of the KDM2A gene from part of intron 12 to exon 21. The sequence of
the cDNA was deposited in the DNA data base (GenBank Accession No. AB490246).
We designated the region of intron 12 that exists in the cDNA as exon 12’ (shown as a
red line in Figure S1A). There is one ATG that conforms to a Kozak consensus
sequence (Kozak, 1989) in exon 14. We re-cloned the cDNA that includes the ATG and
the stop codon into a mammalian expression vector, expressed it in human cells, and
analyzed it by Western blotting. The mobility of the protein on SDS-PAGE was
consistent with that of the higher mobility (Figure 1C). Therefore, the KDM2A gene
encodes an additional polypeptide that has a shorter amino acid sequence, and we
designated this protein SF-KDM2A (short form of KDM2A). The cDNA encodes a
protein of 620 amino acids with a predicted molecular mass of 70 kDa. SF-KDM2A
contains CXXC, PHD, and F-box domains but no JmjC domain (Figure 1A). The
full-length polypeptide of KDM2A contains the entire amino acid sequence of
1
SF-KDM2A.
Materials and methods
Plasmids for mammalian and E. coli vectors expressing KDM2A polypeptides and
other plasmids
For use in this study, the cDNA was recloned into a pCAGGS vector to express
Flag-tagged KDM2A (full-length KDM2A). Mutant KDM2A was produced by the
standard protocols. The H212A mutant has a point mutation, with His at 212 replaced
with Ala, which causes loss of histone demethylase activity (Tsukada et al, 2006).
cDNAs for KDM2A and the H212A KDM2A mutant were also cloned into pCAGGS
vectors carrying a puromycin-resistant gene (pCAG-IP) (Niwa et al, 2002). The
mammalian expression plasmid that expresses E. coli β-galactosidase targeted to the
nucleus was described previously (Tsuneoka and Mekada, 1992).
To investigate whether a transcript starting from exon 12’ is transcribed from the
human KDM2A gene, a DNA fragment was amplified from single-strand cDNA of
human T98G cells using primers KDM2A (5’Not1)
(5’-GCGGCCGCCATGTGCTCTGGGAGATTCCAG-3’) and KDM2A stop (3’Nhe)
(5’-GCTAGCTTAGCTGATCTTCTGTATCAGC-3’). The amplified DNA was
sequenced and found to have the nucleotide sequence for a KDM2A polypeptide
including a stop codon from exon 12’ to exon 21. The DNA fragment was also
amplified using primers KDM2AR2 (5’NotI-2n)
(5’-GCGGCCGCCATGAAACCAGCTCCACGG-3’) and KDM2A stop (3’Nhe)
(5’-GCTAGCTTAGCTGATCTTCTGTATCAGC-3’). This amplified DNA fragment in
the mammalian expression vector produced a polypeptide with the same molecular
weight as that of SF-KDM2A (short-form KDM2A, Figure 1).
To produce the recombinant partial polypeptides of KDM2A, human KDM2A
cDNA was amplified using primers KDM2A (BglII-U)
(5’-GGAAGATCTTCAGCATGGATTTGGAG-3’) and KDM2Astop (EcoRI-L)
(5’-GGAATTCTTACACTTGCCTGTCCTTTCG-3’) or pan-KDM2A (BamHI-U)
(5’-GAGGGATCCTGCGGCTGCAGGCCACAGAGC-3’) and pan-KDM2Astop
(EcoRI-L) (5’-GGAATTCTATCCCCCCAGCCCCTCCTCATC-3’). The resulting DNA
fragments encode the polypeptide from Ser 360 to Val 451 or from Leu 763 to Gly 855
of KDM2A (GenBank Accession No. NM_012308). The amplified 0.3-kb fragments
were cleaved with BamHI and EcoRI and ligated to the E. coli expression vector
2
pET32c (Novagen, Madison, WI, USA) or pGEX-3X (Amersham Biosciences) that had
been cleaved with BamHI and EcoRI. The resulting plasmids, pET/hKDM2A (360-451)
and pET/hKDM2A(763-855) or pGEX-hKDM2A(360-451) and pGEX-hKDM2A
(763-855), expressed the thioredoxin-hisx6-tagged KDM2A (360-451) and
thioredoxin-hisx6-tagged KDM2A (763-855), or the glutathione S-transferase fusion
KDM2A (360-451) and glutathione S-transferase fusion KDM2A (763-855),
respectively.
Antibodies for KDM2A
The polypeptides used for immunization were expressed using
pET/hKDM2A(360-451) and pET/hKDM2A (763-855) in E. coli AD494(DE3)pLysS
(Novagen), isolated by TALON His-tag purification resin (Takara Bio Inc., Ohtsu,
Japan) according to the manufacturer’s instructions, and further purified by SDS-PAGE.
Rabbits were immunized with the recombinant polypeptides. The first one was
designated the anti-KDM2A antibody because this antibody recognizes only the
full-length form of KDM2A (Figure 1A). The second one was designated the
anti-pan-KDM2A antibody because it recognizes both the full-length and short forms
of the proteins expressed by the KDM2A gene (Figure 1A).
The glutathione S-transferase fusion KDM2A (360-451 or 763-855) was
expressed using pGEX-hKDM2A (360-451 or 763-855) in E. coli DH5α and isolated
using a glutathione-Sepharose column (Amersham Bioscience). Polyclonal
anti-KDM2A antibodies were purified from rabbit serum using Sepharose 4B
conjugated with recombinant glutathione S-transferase fusion KDM2A polypeptides
(GST-KDM2A(360-451) or GST-KDM2A(763-855)) as described previously (Tsuneoka
et al, 2002).
DNA methylation assays
DNA was extracted and amplified using quantitative (q)PCR. To increase the
cutting-efficiency of the restriction enzymes, DNA was pretreated with the MboI
restriction enzyme, which does not have sites in the DNA fragment of the human rDNA
promoter amplified using H0 primers. To monitor CpG methylation, DNA was digested
with HpaII before PCR amplification. The relative resistance to HpaII digestion was
normalized to mock- and MspI-digested DNA. H0 primers were used to amplify the
human rDNA shown in Figure 2C.
Methylation assay for KDM2A-binding rDNA
3
After the chromatin immunoprecipitation procedure described in Materials and
Methods was performed, DNA was extracted and applied to monitor CpG methylation
using HpaII digestion.
Legends for supplemental figures
Figure S1
Short polypeptide expressed by the KDM2A gene. (A) The chromatin status of the
human KDM2A gene. The genomic organization of the human KDM2A gene is shown
in the upper bar. Exons are shown as longitudinal bars. The longer longitudinal bars
mark the open reading frame encoding the protein. The direction of transcription is
from left to right. In addition to exon 1, the transcription also starts from exon 12’,
which is in intron 12 (shown as a red line). The signals for H3K4me3, RNA
polymerase II (pol II), H3K27me3, and H3K36me3 marks are shown as striped bars in
the lower four lines, respectively (the data were obtained from the web site
http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/hgtcell.aspx). Darker colors mean
stronger signals. (B) HeLa cells were transfected with short hairpin RNA
(shRNA)-expressing vectors (KDM2A#1, KDM2A#2); the control was an empty
vector. These vectors were obtained from OriGene Technologies, Inc. (Rockville, MD,
USA). KDM2A#2 and KDM2A#1 express shRNA corresponding to partial nucleotide
sequences for only KDM2A (CTTCGCTGCCTTGTAGATAAGTTGGAGTC) and for
both KDM2A and SF-KDM2A (TCTCAGACTTGTCCATCAACAGCCTCTAC),
respectively. Cell lysates were subjected to Western blotting using the
anti-pan-KDM2A antibody. While KDM2A#2 reduced the intensity of only the band
with the lower mobility, KDM2A#1 reduced the intensity of bands with both higher
and lower mobilities. The positions of KDM2A and SF-KDM2A are indicated by an
arrowhead and arrow, respectively. The positions of the molecular weight markers are
indicated on the right side of the figure.
Figure S2
SF-KDM2A did not demethylate H3K36me2. The expression vectors encoding
KDM2A, the H212A mutant, and SF-KDM2A were transfected into HeLa cells, and
the demethylation of dimethylated Lys36 of histone H3 (H3K36me2) was measured in
vivo. All proteins were Flag-tagged. The cells were analyzed by indirect
immunofluorescence technique with anti-Flag (green) and anti-H3K36m2 (red)
4
antibodies. One cell with positive signals for the exogenous proteins in one filed is
indicated by an arrowhead.
Figure S3
MCF-7 cells were transfected with control or KDM2A siRNA and analyzed by
chromatin immunoprecipitation (ChIP) assays using anti-H3, anti-KDM2A and control
antibodies. The collected DNA fragments were analyzed using primer sets for rDNA
(Figure 2C) and the TATA-binding protein (TBP) gene. The primers used for the TBP
promoter were 5’-GACCT1ATGCTCACACTTCTCATGG-3’ and
5’-GAACCTGCCCGACCTCACTGAA-3’
(Zhong et al, 2007); for exon 5, 5’-GACCATTGTAGCGGTTTGCT-3’ and
5’-GGCTACCTCTTGGCTCCTGT-3’ were used. To detect the specific binding, the
values simultaneously obtained by using control antibody were subtracted from those
using specific antibodies. The values of specific binding were divided by total input,
and expressed as a % of specific binding/input. The experiments were performed three
times, and mean values with standard deviations are indicated. (A) The binding of
histone H3 to the regions of rDNA and the TBP gene was investigated. The results
indicate that histone H3 was distributed almost evenly to the all regions of rDNA and
the region of exon 5 in the TBP gene, with a lower level for the promoter region of the
TBP gene. The KDM2A knockdown hardly affected the distribution of H3 to the
regions. (B) H3 values were used to normalize the specific binding. The values
recovered by the anti-KDM2A antibody were expressed as a % of specific binding/input
normalized by H3. KDM2A bound to the rDNA promoter region, and the KDM2A
siRNA abolished the binding. The binding of KDM2A to the TBP gene was below
detectable levels in these experimental conditions. In the promoter region of the TBP
gene, the values for H3 used for normalization were lower than in the other regions,
indicating that the specific binding of KDM2A/input there was lower than that indicated
in the figure.
Figure S4
MCF-7 cells were cultured with or without starvation and in the presence or absence of
50 mM DMS for 9 hours. (A) Cells lysates were analyzed by Western blotting using
anti-KDM2A and anti-β-actin antibodies. The results suggest that these treatments did
not significantly change the amount of KDM2A protein. The positions of the molecular
weight markers are indicated on the right side of the figure. (B) The effects of
starvation and DMS on H3K36 methylation levels were investigated in the regions of
5
the promoter and exon 5 in the TBP gene. The results were expressed as a % of specific
binding/input normalized by H3. The experiments were performed three times, and
mean values with standard deviations are indicated.
Figure S5
MCF-7 cells were cultured as described in Figure S4, and the effects of starvation and
DMS on H3K36 methylation levels were investigated in the all regions of the rDNA
indicated in Figure 2C. The results were expressed as a % of specific binding/input
normalized by H3. The experiments were performed at least three times, and mean
values with standard deviations are indicated. *P<0.05;**P<0.01; #P>0.1 (no
significant difference).
Figure S6
(A) MCF-7 cells were transfected with the control or second KDM2A siRNA
(KDM2A-w, 5’-CCGUUCCCACCUAACUAAGGAAUUU-3’, siRNA reducing
KDM2A but not SF-KDM2A expression). Forty-eight hours after transfection, cells
were further cultured 9 hours with or without starvation. The amounts of pre-rRNA and
KDM2A mRNA were measured by qRT-PCR as described in Figure 3A. The results are
expressed as amounts relative to the values of cells treated with control siRNA and
without starvation. The experiment was performed three times, and mean values with
standard deviations are indicated. The introduction of KDM2A-w siRNA resulted in a
significant increase of the rDNA transcription with starvation (*P<0.05), but without
starvation it weakly increased the rDNA transcription without statistical significance
(#P>0.1).
(B) MCF-7 cells were transfected with control siRNA, KDM2A siRNA, or KDM2A-w
siRNA. Forty-eight hours after transfection, cell lysates were analyzed by Western
blotting using anti-KDM2A antibody and anti-β-actin antibody (loading control). The
positions of the molecular weight markers are indicated on the right side of the figure.
KDM2A-w siRNA did not reduce the amount of KDM2A protein as much as KDM2A
siRNA did. These results are consistent with the weaker elevation of the rDNA
transcription by KDM2A-w siRNA than by KDM2A siRNA.
Figure S7
A model of the mechanism by which KDM2A controls rDNA transcription. KDM2A is
activated by starvation and inactivated by succinate.
6
Figure S8
Levels of rDNA methylation with and without starvation. MCF7 cells were cultured for
9 hours with or without starvation. DNA was extracted and either mock-digested or
digested with HpaII. The DNA fragments were amplified by PCR using H0 primers
(Figure 2C). The results are expressed as a % of HpaII resistance.
Figure S9
Presence of KDM2A on active and silencing rDNA chromatin. Crosslinked chromatin
from MCF7 cells was precipitated with the anti-KDM2A antibody, and the precipitated
DNA was either mock-digested or digested with HpaII. The levels of the
HpaII-resistant and the total rDNA promoter fragment were determined by qPCR using
H0 primers indicated in Figure 2C. The value for the HpaII-resistant rDNA promoter
fragment (methylated) was subtracted from that for the total rDNA promoter fragment
to obtain the value for the HpaII-sensitive rDNA promoter fragment (unmethylated).
The results are shown as a % against total amount of the rDNA promoter fragment
recovered by the anti-KDM2A antibody.
Figure S10
Succinate functions through KDM2A to up-regulate the amount of mature ribosome.
MCF7 cells were transfected with control or KDM2A siRNA. Forty-eight hours after
transfection, cells were cultured 9 more hours with starvation in the presence or absence
of 50 mM DMS. The amount of 28S RNA was measured by qRT-PCR. The changes in
the amount of 28S RNA due to DMS were expressed against the values without DMS in
each case (with control or KDM2A siRNA). The elevation of mature 28SRNA by DMS
was reduced by KDM2A knockdown. The experiments were performed three times, and
mean values with standard deviations are indicated. *P<0.05.
Figure S11
MCF-7 cells were transfected with control or KDM2A siRNA, and analyzed by ChIP
assays using anti-H3, and anti-H3K36me2 (cat# 07-274; Millipore Corp., Billerica,
MA,USA, Mp), and anti-H3K36me2 (Cell signaling, Cs) antibodies. The
anti-H3K36me2 (Mp) was shown to work in ChIP assays by the manufacturer. The
DNA fragments collected were analyzed for the rDNA promoter (using H0 primer,
described in Figure 2C). The values are expressed as a fold change against the values of
the control antibody.
(A) The anti-H3K36me2 antibody (Mp) gave the specific signal for the binding of
7
H3K36me2 (white bar indicated by Mp K36me2) because the antibody produced a
higher value than the control antibody (white bar indicated by IgG). This value was
increased when the knockdown of H3K36me2 demethylase KDM2A was performed
(black bar indicated by Mp K36me2), supporting the specific detection of the
H3K36me2 mark.
(B) The reduction of KDM2A binding to the rDNA promoter by the KDM2A
knockdown was confirmed (compare the white and black bars indicated by KDM2A).
When the Cs anti-H3K36me2antibody (Cell signaling) was used instead of the Mp
anti-H3K36me2 antibody (Millipore), stronger signals were detected both in the
presence and absence of KDM2A siRNA treatment.
Table S1
Effect of KDM2A overexpression on cell proliferation
Empty vector
KDM2A
Experiment1
149
3
Experiment2
204
3
Experiment3
62
3
MCF-7 cells were transfected with a KDM2A-expressing vector or an empty
vector carrying a puromycin-resistant gene (pCAG-IP) using Fugene 6 transfection
reagent. Three days later, cells were replated, cultured in the presence of 1 μg/ml
puromycin for 2-3 weeks, and stained by Giemsa staining solution. The number of
colonies was counted.
References
Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z, Wei G, Chepelev I, Zhao
K (2007) High-resolution profiling of histone methylations in the human
genome. Cell 129: 823-837
Kozak M (1989) The scanning model for translation: an update. J Cell Biol 108:
229-241
Li B, Carey M, Workman JL (2007) The role of chromatin during transcription. Cell
128: 707-719
Niwa H, Masui S, Chambers I, Smith AG, Miyazaki J (2002) Phenotypic
complementation establishes requirements for specific POU domain and generic
transactivation function of Oct-3/4 in embryonic stem cells. Mol Cell Biol 22:
1526-1536
8
Tsukada Y, Fang J, Erdjument-Bromage H, Warren ME, Borchers CH, Tempst P, Zhang
Y (2006) Histone demethylation by a family of JmjC domain-containing
proteins. Nature 439: 811-816
Tsuneoka M, Koda Y, Soejima M, Teye K, Kimura H (2002) A novel myc target gene,
mina53, that is involved in cell proliferation. J Biol Chem 277: 35450-35459
Tsuneoka M, Mekada E (1992) Degradation of a nuclear-localized protein in
mammalian COS cells, using Escherichia coli beta-galactosidase as a model
protein. J Biol Chem 267: 9107-9111
Zhong S, Fromm J, Johnson DL (2007) TBP is differentially regulated by c-Jun
N-terminal kinase 1 (JNK1) and JNK2 through Elk-1, controlling c-Jun
expression and cell proliferation. Mol Cell Biol 27: 54-64
9