Download Full Paper - Biotechniques.org

Isolation and Identification of Hemolytic and Non-hemolytic Bacteria
on Avian Residents of the Louis Calder Center
Dawn Konkoly
Department of Biological Sciences, Fordham University
Bronx, New York, 10458
Abstract:
The spread of pathogenic bacteria, viruses, and parasites are of increasing public health
concern. Avian species serve as vectors for external and internal pathogens. To research
potential externally vectored pathogenic hemolytic bacteria, avian feathers were swabbed for
bacterial communities. Swabs were plated on blood agar plates to determine if hemolytic
bacteria were present. Genomic DNA for hemolytic and non-hemolytic bacterial colonies from
blood agar plates were amplified and sequenced.
Introduction:
The spread of pathogenic bacteria, viruses, and parasites are of increasing public health
concern. Current out breaks of avian influenza virus (H5N1) (Keawcharoen et al 2008) and
increased distribution of Borrelia burgdorferi, a bacterial species of spirochete which is the
causative agent of lyme disease (Ogden et al 2008), are attributed to avian vectors. Avian
vectors pose a new area of public health concern particularly due to the long distance migration
of many passerines (Poupon et al 2005).
Other than viruses and spirochetes, pathogenic bacteria are also of public health concern due
to their involvement in human illness, infection, disease, and mortality. Pathogenic bacteria
located internally on birds have been isolated from pharynxes and cloacae of avian species in
the wild and in captivity (Lombardo 1996, Bangert 1988). For these internal pathogens a host
must be competent that requires a host to acquire, maintain, and transmit an internal
pathogen (Richter 2000, Mather 1989). However, many external bacteria can be transferred
from animals to humans without competency requirements (Pell 1997). This lack of a
requirement of competency could allow bacteria present on the feathers of avian individuals to
be transmitted horizontally to humans. Bacterial communities living on the feathers of avian
populations remains relatively understudied. Only seventeen strains of unique bacteria were
isolated from four individual post breeding Eastern bluebirds in Lee County Alabama (Shawkey
et al 2005) providing a minimal estimate of the potential pathogenic bacteria that may be
vectored by avian individuals.
Public health concern has increased over hemolytic bacteria due to the increasing reports of
severe food poisoning associated with hemolytic properties (Drobniewski 1993). Hemolytic
bacteria induce hemolysis or the break down of red blood cells. Hemolytic bacteria have been
involved in food contamination leading to food poisoning outbreaks (Pell 1997), local infections
of the skin, eye infections, and abscesses (Drobniewski 1993). The spread of hemolytic bacteria
represents a public health concern. Avian vectors may play an important role in the
vectorization of pathogenic hemolytic bacteria to new areas. In this study we hypothesize that
avian individuals transport hemolytic bacteria.
Materials and Methods
Sampling was conducted at the Louis Calder Biological Field Station of Fordham University
(41.13022°N, 73.73358°W), located in Armonk, New York .Field work was conducted on April 4 th
and April 6th of 2013. Nets were placed around bird feeding stations to increase capture rates of
individuals. A total of 18 individuals were captured and swabbed for bacterial samples. Avian
individuals were gently rubbed through feathers of the throat and chest using Sterile Cotton
Tipped Applicators (Guilford, ME, USA) dipped in sterile phosphate buffer saline as described by
Shawkey et al 2003. After collection all swabs were than rubbed on Blood Agar plates (Fisher
Scientific, Pittsburg, PA, USA) within 6 hours of collection. Blood Agar plates were then
incubated for 24 hours at 37°C.
Twelve bacterial colony isolates of hemolytic and non-hemolytic colony morphology were
selected for DNA extraction. Bacteria colony isolates was first pretreated using Gram-positive
optimized procedures for the Qiagen DNeasy® Blood and Tissue Kit (Madhumita 2009). DNA
was then extracted using DNeasy® Blood and Tissue kit procedures as described by Qiagen
(Qiagen, Hilden, Germany). Purified genomic was quantified for each sample by measuring the
OD at 260 nm with a Life Science Spectrophotometer (Beckman Coulter ™, Gaithersburg, MD)
and adjusted to a final concentration of 5 ng/μl.
PCR was amplified using two primer sets for the 16SrDNA corresponding to Escherichia coli
16SrDNA gene sequence. The first set of primers consisted of 63F
(5'CAGGCCTAACACATGCAAGTC 3') and 1389R (5'ACGGGCGGTGTGTACAAG 3') (Shawkey 2003)
and the second set consisted of 522F (5’ CAGCCGCGGTAATAC 3’) and 1389R
(5'ACGGGCGGTGTGTACAAG 3') (Ghasemi 2012). PCR reaction volumes were 25µl and had an
initial 4 min denaturing step at 94°C, followed by 50 cycles. Cycles consisted of thirty seconds at
94°C for denaturing, thirty seconds at 57°C for annealing, and thirty seconds for elongation at
94°C. Final final elongation step of four minutes was conducted at 72°C.
The 16s rDNA PCR products were detected by gel electrophoresis in 1% agrose gels containing
ethidium bromide. Electrophoresis was run at for approximately 45 minutes at 160 V, and gels
were photographed under ultraviolet illumination using a Carestream Image Station (Rochester,
NY, USA).
PCR products were purified using a QIAquick® PCR Purification Kit (QIAGEN, Valencia, CA, USA).
Purified PCR products were quantified for each sample by measuring the OD at 260 nm with an
(Beckman Coulter ™, Gaithersburg, MD). The sent out for sequencing (Genewiz Inc., South
Plainfield, NJ, USA). Sequences were identified using NCBI’s BLAST (National Center for
Biotechnology Information, Bethesda, MD).
Results
Table 1: Bacterial species isolated and identified on four avian species at the Louis Calder
center.
Avian Species
House Finch
(Carpodacus
mexicanus)
Tufted Titmouse
(Baeolophus bicolor)
White-breasted
Nuthatch
(Sitta carolinensis)
Bacterial Culture
Morphology
Non-hemolytic
Hemolytic
Bacterial Species
Bacillus megaterium
Bacillus cereus
Species Specific
Colony Number
Colony 1
Colony 2
Non-hemolytic
Hemolytic
Bacillus licheniformis
Bacillus pumilus
Colony1
Colony 2
Non-hemolytic
Streptomyces sp.
Colony 1
Colony 2
Bacillus sp.
Hemolytic
White-throated
Sparrow
(Zonotrichia albicollis)
Non-hemolytic
Hemolytic
Bacillus pumilus
Bacillus sp.
Bacillus megaterium
Bacillus sp.
Colony 3
Colony 4
Bacillus cereus
Bacillus pumilus
Colony 3
Colony 4
Colony 1
Colony 2
All bacterial species identifications in BLAST had query covers > 99% and max identification >
98%. Eleven isolates were from the genus Bacillus and one isolate was from the genus
Streptomyces. Of the twelve bacterial colonies selected for identification eight colonies were
identified to species level. All identified hemolytic bacteria in this study had previously been
identified to have hemolytic properties.
As described in table 1 two species of non-hemolytic bacteria were identified to species level
and two bacterial colonies were identified to genus level. Through alignment the bacterial
isolate identified to genus level as Bacillus sp. was identified as a different isolate than the
other two Bacillus species identified. This represents four unique species of non-hemolytic
bacteria identified in this study . This represents the first report of B. megaterium and
Streptomycetes sp. on avian feathers.
As described in table 1 two species of hemolytic bacteria were identified to species level and
one bacterial colony was identified to genus level. Through alignment the bacterial isolate
identified to genus level as Bacillus sp. represents a different species as the other two bacterial
species identified.
Discussion
Species identified non-hemolytic bacteria include B. megaterium on two avian species, B.
licheniformis, and Streptomycetes sp. B. megaterium is a gram positive, aerobic spore forming
bacteria associated with a variety of habitats. B. megaterium strains are some of the largest
known bacteria and are currently used in biotechnology in protein recombination studies. B.
licheniformis have been recognized as keratin degrading bacteria and are now considered a
natural occurrence on the feathers of most avian individuals. Streptomycetes sp. are most
commonly found in decaying vegetation and soils, many Streptomycetes sp. are used in clinical
antibiotics. However some strains of Streptomycetes sp. are pathogenic to humans.
Species identified as hemolytic bacteria include B. cereus on one avian individual and B. pumilus
on three avian individuals. Public health concern has risen for B. cereus due to increasing
reports of food contamination by B. cereus leading to severe food poisoning (Oguntoyinbo &
Oni 2004) and infections ranging from local skin infections to severe abscesses (Drobniewski
1993). The first demonstrated cases of lesion causing hemolytic properties of B. pumilus strains
was identified in Spain (1996) and only recently published in 2007 by Tena et al. Toxic isolates
from B. pumilus strains have been investigated for roles in food poisoning outbreaks (Suominen
2001).
To the investigators current knowledge these are the first reports of isolation of Streptomycetes
sp. from the feathers of a white-breasted nuthatch and also the first reports of B. megaterium
from the feathers of a house finch and white-throated sparrow. B. pumilus . B. cereus, and B.
licheniformis were previously identified on the feathers of eastern bluebirds (Sialia sialis) by
Shawkey et al 2005. However, the study conducted by Shawkey et al did not investigate the
potential hemolytic properties of the strains of B. pumilus and B. cereus isolated. Therefore the
potential for avian species to vector pathogenic bacteria was not addressed.
Bacterial colonies of hemolytic properties were isolated from all four avian species sampled and
previous literature has identified these hemolytic bacteria to be of public health concern. This
supports the hypothesis that avian individuals are potentially vectoring pathogenic hemolytic
bacteria. In twelve bacterial colony isolates the investigator was able to identify two previously
unreported bacterial strains on bird feathers. This supports previous claims that bacterial
communities in general as well as pathogenic bacteria species are underestimated on the
feathers of avian individuals. This hopes to increase interest and public awareness into the
potential roles avian individuals play in vectoring pathogenic bacteria.
References
Drobniewski, F. 1993. Bacillus cereus and related species. Clinical microbiology reviews 6:324-338.
Folarin Anthony Oguntoyinbo and O. M. Oni. 2004. Incidence and Characterization of Bacillus cereus
isolated from traditional fermented meals in Migeria. Journal of Food Protection 67:2805-2808.
Irmgard Suominen, Maria A. Andersson, Magnus C. Andersson, Anna-Maija Hallaksela, Peter Kampfer,
Frederick A. Rainey, and M. Salkinoja-Salonen. 2001. Toxic Bacillus pumilus from indoor air,
Recycled Paper Pulp, Norway Spruce, Food poisoning outbreaks and clinical samples. Systematic
and applied microbiology 24:267-276.
Keawcharoen, J., D. van Riel, G. van Amerongen, T. Bestebroer, W. Beyer, R. van Lavieren, A. Osterhaus,
R. Fouchier, and T. Kuiken. 2008. Wild ducks as long-distance vectors of highly pathogenic avian
influenza virus (H5N1). Emerging infectious diseases 14:600-607.
Lombardo, M. P., P. A. Thorpe, R. Cichewicz, M. Henshaw, C. Millard, C. Steen, and T. Zeller. 1996.
Communities of cloacal bacteria in tree swallow families. The Condor 98:167-172.
Marie-Angèle, P., E. Lommano, P.-F. Humair, V. Douet, O. Rais, M. Schaad, L. Jenni, and L. Gern. 2006.
Prevalence of Borrelia burgdorferi sensu lato in ticks collected from migratory birds in
Switzerland. Applied and environmental microbiology 72:976-985.
Mather, T., S. Telford, A. MacLachlan, and A. Spielman. 1989. Incompetence of catbirds as reservoirs for
the Lyme disease spirochete (Borrelia burgdorferi). The Journal of parasitology 75:66-69.
Ogden, N., L. Lindsay, K. Hanincová, I. Barker, M. Bigras-Poulin, D. Charron, A. Heagy, C. Francis, C.
O'Callaghan, I. Schwartz, and R. Thompson. 2008. Role of migratory birds in introduction and
range expansion of Ixodes scapularis ticks and of Borrelia burgdorferi and Anaplasma
phagocytophilum in Canada. Applied and environmental microbiology 74:1780-1790.
Pell, A. 1997. Manure and microbes: public and animal health problem? Journal of Dairy Science
80:2673-2681.
R. L. Bangert, B. R. Cho, P. R. Widders, E. H. Stauber, and A. C. S. Ward. 1988. A survey of aerobic
bacteria and fungi in the feces of healthy Psittacine birds. Avian Diseases 32:46-52.
Richter, D., A. Spielman, N. Komar, and F. Matuschka. 2000. Competence of American robins as reservoir
hosts for Lyme disease spirochetes. Emerging infectious diseases 6:133-141.
Shawkey, M., K. Mills, C. Dale, and G. Hill. 2005. Microbial diversity of wild bird feathers revealed
through culture-based and culture-independent techniques. Microbial ecology 50:40-47.
Shawkey, M. D., S. R. Pillai, and G. E. Hill. 2003. Chemical warfare? Effects of uropygial oil on featherdegrading bacteria. Journal of Avian Biology 34:345-349.
Tena, D., J. Martinez-Torres, M. Perez-Pomata, J. Sáez-Nieto, V. Rubio, and J. Bisquert. 2007. Cutaneous
infection due to Bacillus pumilus: report of 3 cases. Clinical infectious diseases : an official
publication of the Infectious Diseases Society of America 44:e40-42.
Younes Ghasemi, Maryam Shabazi, Sara Rasoul-Amini, Mohammad Kargar, Azam Safari, Aboozar
Kazemi, and N. Montazeri-Najafabady. 2012. Identification and characterization of featherdegrading bacteria from keratin-rich wastes. Annals of microbiology 62:737-744.