Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
HKU CS Bioinformatics Research Siu Ming Yiu Department of Computer Science The University of Hong Kong Other faculty members: Prof. Francis Chin Prof. TW Lam Dr HF Ting 1 Impact of bioinformatics Medical research Biological research Huge volume of data e.g. finding a cancercausing gene? Environmental study e.g. how to remove harmful bacteria e.g. can we make rice grow faster? e.g. human genome: 3G long; Medical study: 100 persons e.g. human gut contains 1000+ bacteria (data: 500G) obesity Biofuel e.g. how bacteria digest food to produce energy? 2 The de novo assembly problem (single genome) Given an unknown genome, Genome X NO existing technology is able to read out the DNA sequence (ACCG…..) of it as the sequence is too long (e.g. human = 3 billions long; even bacteria are about 10k – several millions). What we can do? High-throughput sequencing technology (next generation sequencing (NGS)): …………………. DNA sequencing machine [Inside the machine, the genomes are randomly cut into short fragments (reads), the machine can read out the DNA sequence of the reads.] Multiple copies of Genome X GTCG ACCG CTAG CAAG CTTG AACG CTCG GTCG GTTG GGAG 3 Bad news Multiple copies of Genome X (1) The reads are really short: 100-150 bp (c.f. genome of a bacterium – 10K to several millions). (2) They are mixing together (no idea where from the genome each read is from!!). (3) There are errors in the read. [AACCGTTC => AACGGTCC] The (de novo) assembly problem: Can we reconstruct the original genome from the reads? 4 Data volume: HUGE!! Take human genome as an example. The genome is of 3x109 (3 billion) long. Recall: multiple copies are cut (fragmented). At any position of the genome, multiple copies of reads may be obtained. The average number of copies of reads from each position of a genome is referred as ………………. the depth of the sequencing. Note that they are mixed together, no ordering information For depth = 30, # of reads: (3x109x30)/100 ≈ 109 5 Good news There are some clues inside the reads: The reads are overlapping! Unknown genome: AACCGGTTGCACGTTCCACTTGGCC……… CCGGTTGTC TGTCACGTT ACCGGTTGT AACCGGTTG GGTTGTCAC CGGTTGTCA TTGTCACGT GTTGTCACG Ideal case: every position has at least one read, no errors in the read, then…. [But the reality…. is a lot worse] 6 Unknown genome: AACCGGTTGCACGTTCCACTTGGCC……… CCGGTTGTC AACCGCTTG GGTTGTCAC TGTCACGTT CGGTTGTCA ACCGGTTTT TTGTCACGT GTTGTCACG The reality: (a) There are errors in the reads; not easy to locate the next read! (b) At some positions, we may have no reads. 7 Publications Bioinformatics (impact factor: 5.323) BMC genomics (impact factor: 4.4) PloS One (impact factor: 3.73) BMC bioinformatics (impact factor: 3.02) Journal of Computational Biology (impact factor: 1.56) IEEE/ACM TCBB (impact factor: 1.54) …… Top conferences: RECOMB, ISMB, ECCB Nature papers with our collaborators HKU-BGI research center: BGI (Shenzhen) is the largest genomic center in the world Other international collaborators: JGI, dept. of energy, US (biofuel); Sidekid hospital, Canada (diabetes); CAS-MPG PICB, Shanghai (C4 Rice project); UC San Francisco (Optical mapping data analysis); NUS, Singapore (RNA study); …. 8 How to solve the problem? A few general approaches String graph, de Bruijn graph, … Genome Idea: we still make use of the …. A C G T G T A C C T C……. overlapping parts in reads to connect them together. We do not need reads of every Read G T G T A C C T C (k = 4) position. -------------------------Graph: Vertex: k-mer (k consecutive GTGT TGTA GTAC TACC ACCT CCTC nucleotides in a read) Edge: two k-mers appear consecutively in a read 9 Genome: A A C G A C G T G T A C C T C A G T AACGACGTG ACGACGTGT CGACGTGTA GACGTGTAC ACGTGTACC CGTGTACCT GTGTACCTC TGTACCTCA GTACCTCAG TACCTCAGT Reads (len = 9) AACG ACGA CGAC Ideal case - No errors - Reads at every position - The graph can read out one single path, that will be the genome! GTGT ACGT GACG CAGT GTAC CGTG TGTA CCTC TCAG CTCA ACCT TACC 10 Genome: A A C G A C G T G T A C C T C A G T AACGACGTG ACGACGTGT CGACGTGTA GACGTGTAC ACGTGTACC CGTGTACCT GTGTACCTC TGTACCTCA GTACCTCAG TACCTCAGT Reads (len = 9) AACG ACGA CGAC Note: even a few reads are missing, we are still ok! Can anyone see that how many reads can be missed depends on the value of k (when constructing the graph!)? Q: to allow more missing reads, larger or smaller k is better? GTGT ACGT GACG CAGT GTAC CGTG TGTA CCTC TCAG CTCA ACCT TACC 11 Genome: A A C G A C G T G T A C G CTCAGT Reads (len = 9) AACGACGTG ACGACGTGT CGACGTGTA GACGTGTAC ACGTGTACC CGTGTACCT GTGTACCTC TGTACC GT C A GTACCTCAG TACCTCAGT ACGT CGTG CGTC Contigs: Maximal path without branches/paths contig CGAC GACG ACGT CGACGT Real case is more complicated: Even no error, in a genome, some patterns may repeat! In reality, we seldom can construct the whole genome in one piece, but stop at junctions, resulting with a set of contigs 12 A part of the de Bruijn graph for Ecoli (~4M long); you can imagine how complicated for human genome (3G long) 13 Conclusions Our team: Core Faculty members: Prof. Francis Chin, Prof. TW Lam, me 1 Research Assistant Professor (Henry Leung) 1 Postdoc (Jianyu Shi) about 8 PhD/master students + a team in HKU-BGI Lab Some collaborators: Beijing Genome Institute at Shenzhen (BGI) - HKU-BGI Laboratory HKU medical schools; life science departments Sickkids hospital, Canada JGI, DoE, US CAS-MPG PICB, Shanghai (C4 Rice project) UC San Francisco (Pui’s group) GIS (Genome Institute at Singapore) Universities: NUS, CUHK, U of Liverpool etc. <Thank you> 14