Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Protein Synthesis Practice - A 1. Transcribe the following DNA strands (write the mRNA strand): a. GGCATTCGCGATCAT b. CGTTAGCATCCTTCA 2. Translate the amino acid sequence for the given mRNA strand: a. AUG CAC UGU CCU UUC GCU GAC b. AUG GUC GAU AGC UAU CAU GCA 3. Transcribe the following DNA strand. Then translate the mRNA strand you wrote. TACGTCGACTGGCTGACCGTAACT Protein Synthesis Practice - B 4. Transcribe the following DNA strands (write the mRNA strand): a. CCGAGATATCCGGTA b. GTACCATACGTTAAA 5. Translate the amino acid sequence for the given mRNA strand: a. AUG GGA UUA CCC GCA UAU CCA b. AUG CAU GGG CUU AUU CCG CGA 6. Transcribe the following DNA strand. Then translate the mRNA strand you wrote. TACGGGCTAGCGTAACATAAAATT Protein Synthesis Practice - C 7. Transcribe the following DNA strands (write the mRNA strand): a. ATTCGAATACCCGAT b. AAACGGGATTCATTT 8. Translate the amino acid sequence for the given mRNA strand: a. AUG GGA AGA CCU CAU GCA ACA b. AUG CGA UUU CGA GCC UAU AGA 9. Transcribe the following DNA strand. Then translate the mRNA strand you wrote. TACCCTACTGGATAAGTACCCATC