Download Breakpoint cluster regions of the AML

Research Article
4583
Breakpoint cluster regions of the AML-1 and ETO
genes contain MAR elements and are preferentially
associated with the nuclear matrix in proliferating HEL
cells
Olga V. Iarovaia, Petr Shkumatov and Sergey V. Razin*
Laboratory of Structural and Functional Organization of Chromosomes, Institute of Gene Biology RAS, Vavilov Street 34/5, 119334, Moscow,
Russia
*Author for correspondence (e-mail: [email protected])
Accepted 27 May 2004
Journal of Cell Science 117, 4583-4590 Published by The Company of Biologists 2004
doi:10.1242/jcs.01332
Summary
The spatial organization in interphase nuclei of the
breakpoint cluster regions (BCRs) of the AML-1 and ETO
genes frequently participating in reciprocal t(8;21)
translocations was studied using cytological and
biochemical approaches. Both BCRs were found to be
localized preferentially, but not exclusively, to the nuclear
matrix, as shown by hybridization of specific probes with
nuclear halos. This association was not related to
transcription, because the transcribed regions of both
genes located far from BCRs were located preferentially in
loop DNA, as shown by in situ hybridization. The sites of
association with the nuclear matrix of the intensely
transcribed AML-1 gene were mapped also using the
biochemical PCR-based approach. Only the BCR was
found to be associated with the nuclear matrix, whereas the
other transcribed regions of this gene turned out to be
positioned randomly in respect to the nuclear matrix. The
data are discussed in the framework of the hypothesis
postulating that the nuclear matrix plays an important role
in determining the positions of recombination-prone areas.
Key words: Nuclear matrix, Topoisomerase II, Chromosomal
rearrangements, Translocations t(8;21), Nuclear halos, FISH
Introduction
Chromosomal rearrangements frequently occur in some
specific places (‘hot spots’) in the genome. These
recombination hot spots are usually separated by 20-100 kb
regions of DNA that are rarely involved in rearrangements
(Henglein et al., 1989; Geng et al., 1993). A correlation
between the above distances and the average size of DNA loops
fixed at the nuclear matrix seems to be quite likely. Recent
studies have demonstrated that DNA loop anchorage regions
can be fairly long and can harbor DNA recombination hot spots
(Svetlova and Razin, 2001). One of the major protein
components of the nuclear matrix is DNA topoisomerase II
(Topo II), which displays an intrinsic intermolecular DNA
ligation activity and can mediate illegitimate DNA
recombination in vitro (Gale and Osheroff, 1992). Exposure of
mammalian cells to Topo-II-specific drugs stimulates different
genomic rearrangements such as deletions, insertions and
translocations (Maraschin et al., 1990; Shibuya et al., 1994).
In agreement with this, chemotherapy of tumors with Topo IIspecific drugs (such as VP16 or m-AMSA) frequently causes
secondary leukemia originating as a result of chromosomal
rearrangements (Auxenfants et al., 1992; Super et al., 1993)
(for a review, see Rowley, 1993). On the basis of these data,
we proposed that illegitimate DNA recombination occurs
preferentially at sites of DNA contact with the nuclear matrix
(Razin, 1999). Consequently, illegitimate DNA recombination
was thought to result predominantly in the loss or repositioning
of entire DNA loops. Similar ideas are shared by others (Felix,
1998; Ahuja et al., 2000; Lovett et al., 2001; Whitmarsh et al.,
2003). The data of the above-cited authors clearly show the
role of Topo II in chromosomal rearrangements. It is, however,
less clear what determines the positions of recombination hot
spots. According to our view, the location of DNA in respect
to the nuclear matrix should be of primary importance.
Correspondingly, we argued that high-salt-insoluble Topo II of
the nuclear matrix is the main target for a range of Topo-IIspecific anticancer drugs (Gromova et al., 1995a; Iarovaia et
al., 1996) and that it is the inhibition of this enzyme that
stimulates chromosomal rearrangements (Razin, 1999). In
order to verify our point of view, we here report a study of the
association with the nuclear matrix of two breakpoint cluster
regions present in the AML-1 and ETO genes that are
frequently involved in reciprocal recombinations (Elsasser et
al., 2003; Zhang et al., 1994; Le et al., 1998; Davis et al., 2003;
Westendorf et al., 1998). Both genes contain relatively short
breakpoint regions where Topo-II cleavage sites and DNase-Ihypersensitive sites have been mapped (Zhang et al., 2002;
Bystritskiy and Razin, 2004). In the present study, we
investigate whether the AML-1 and ETO breakpoint cluster
regions are located at the nuclear matrix in cells where these
genes are not rearranged. Translocations t(8;21) resulting in the
fusion of AML-1 and ETO genes are among the most frequent
4584
Journal of Cell Science 117 (19)
chromosomal rearrangements observed in acute myeloid
leukaemia (Davis et al., 2003).
Materials and Methods
Cell culture
Human erythroleukemia cells, HEL 92.1.7 (ATCC), were grown in
RPMI 1640 medium supplemented with 10% fetal bovine serum.
Preparation of nuclear halos
Cells were pelleted (700 g, 5 minutes), washed twice with RPMI 1640
medium and resuspended in permeabilization buffer [10 mM PIPES
(pH 7.8), 100 mM NaCl, 3 mM MgCl2, 0.5 mM phenylmethylsulfonyl
fluoride (PMSF), 0.1 mM CuSO4, 300 mM sucrose and 0.5% (v/v)
Triton X-100] to a final concentration of 2×106 cells ml–1. After 4
minutes of incubation on ice, the cells were pelleted onto silanecoated microscope slides using a Cytospin centrifuge. In some
experiments, the permeabilized cells were treated with RNase A [25
µg ml–1 in 10 mM PIPES (pH 6.8), 10 mM EDTA, 0.05 mM spermine,
0.125 mM spermidine, 0.1% (w/v) digitonin]. The cells on the slides
were then treated (4 minutes at 0°C) with high-salt solution [2 M
NaCl, 10 mM PIPES (pH 6.8), 10 mM EDTA, 0.05 mM spermine,
0.125 mM spermidine, 0.1% (w/v) digitonin]. After this treatment, the
slides were sequentially washed (1 minute for each wash) with 10×,
5×, 2× and 1× PBS, and then with 10%, 30%, 70% and 96% ethanol.
The air-dried slides were fixed in methanol/acetic-acid (3:1) mixture
and baked at 70°C for 1 hour.
Fluorescent in situ hybridization (FISH) and microscopy
Nuclear halos were treated sequentially with RNase A (100 µg ml–1
in 2× SSC) and pepsin (0.01% in 10 mM HCl), post-fixed with 1%
paraformaldehyde in 1× PBS and rinsed sequentially in 70%, 80% and
96% ethanol. To denature DNA, the slides were incubated in 70%
formamide, 2× SSC solution for 5 minutes at 74°C, dehydrated in cold
70%, 80% and 96% ethanol, and air dried.
Hybridization probes were labeled with biotin-16-dUTP using a
‘Biotin high-prime’ kit (Roche). The hybridization mixture contained
(in a final volume of 10 µl) 50% (v/v) formamide, 2× SSC, 10%
dextran sulfate, 0.1% Tween-20, 10 µg sonicated salmon-sperm DNA,
10 µg yeast tRNA and 25-50 ng of a labeled probe. Before
hybridization, the mixture was incubated for 10 minutes at 74°C to
denature DNA. Hybridization was carried out overnight at 40-45°C.
After hybridization, the samples were washed twice in 50%
formamide, 2× SSC at 43-48°C for 20 minutes.
The biotinylated probe was visualized using anti-biotin monoclonal
antibodies conjugated with Alexa 488 (Molecular Probes) with
subsequent signal amplification using an Alexa-488 signalamplification kit for mouse antibodies (Molecular Probes). In some
experiments, two additional layers of antibodies (chicken anti-goat
and goat anti-chicken), both conjugated with Alexa-488, were used.
In all cases, the DNA was counterstained with DAPI (4′,6-diamidino2-phenylindole). The results were examined under a fluorescence
Axioplan microscope (Opton) and recorded using a cooled chargecoupled-device AT200 camera (Photometrics, Tucson, Arizona).
In vitro binding of cloned DNA fragments to nuclear matrices
To isolate nuclear matrices, the cells were washed with cold TM
buffer [10 mM Tris-HCl (pH 7.4), 3 mM MgCl2, 1 mM PMSF]
supplemented with 0.2 mM CuSO4 and resuspended in the same
buffer. Then, 5% Nonidet P-40 was added up to a final concentration
of 0.1% and the suspension was incubated on ice for 10 minutes. This
was followed by two washes with TM buffer. Permeabilized nuclei
were then resuspended again in TM buffer and DNase I was added up
to 100 µg ml–1. After incubation for 30 minutes at 37°C, an equal
volume of ice-cold extraction buffer [4 M NaCl, 20 mM EDTA, 20
mM Tris-HCl (pH 7.4)] was added. After incubation for 20 minutes
at 0°C, the nuclear matrices were precipitated by centrifugation for
15 minites at 1000 g and 4°C. The pellet was washed once with 0.5×
extraction buffer and twice with TM buffer supplemented with 0.25
mM sucrose. The matrices were stored at –20°C in TM buffer
supplemented with 0.25 mM sucrose and 50% glycerol. The matrixattachment region (MAR) assay was carried out exactly as described
by Cockerill and Garrard (Cockerill and Garrard, 1986). The matrixbound DNA was purified by a conventional procedure and analysed
using electrophoresis in 1% or 1.5% agarose gels. Digestion of cloned
DNA by restriction enzymes and labeling of the DNA fragments were
carried out as described previously (Maniatis, 1982).
Analysis of the transcriptional status of AML-1 and ETO genes
using RT-PCR
Total RNA (1 µg) treated with DNase I [polymerase-chain-reaction
(PCR) grade] (Gibco/Life Technologies) was reverse transcribed into
cDNA [using non-specific short primers and M-MuLV reverse transcriptase (MBI)]. The test fragments of the AML-1 and ETO genes
were PCR amplified with Taq DNA polymerase using the above
cDNA as a template and the following primers: AML-1, TGAGGGTTAAAGGCAGTGGA and AGATGATCAGACCAAGCCCG
(product length, 156 bp); ETO, AGTGCAACTGGGTCTGGGTT and
CTGCATAATGGACATGGTAG (product length, 192 bp). As a
positive control, the same primers were used to amplify the corresponding test fragments on a total genomic DNA template.
Identification of matrix-bound DNA fragments using a
semiquantitative PCR-based approach
A modification of the previously described experimental protocol
(Maya-Mendoza and Aranda-Anzaldo, 2003) was used. Briefly, cells
prelabeled with 3H-thymidine were lysed in buffer A [10 mM Pipes
pH (7.8), 100 mM NaCl, 3 mM MgCl2, 0.1 mM CuSO4, 0.5 mM
PMSF, 300 mM sucrose, 0.5% Triton X-100] for 20 minutes at 4°C.
After two washes in buffer B [50 mM Tris-HCl (pH 8.0), 3 mM
CaCl2], the nuclei were resuspended in 1 ml of the same buffer (106
nuclei ml–1) and then treated with micrococcal nuclease (Fermentas;
7.5 units ml–1). Digestion was carried out at 37°C for 30 minutes.
After digestion, a 2 ml volume of cold 1.5× extraction buffer (3 M
NaCl, 30 mM EDTA) was added and the mixture was incubated for
20 minutes at 4°C. The nuclear matrices were precipitated and washed
twice with cold extraction buffer. Then, matrix-bound DNA was
isolated and the size distribution of the DNA fragments was analysed
by agarose-gel electrophoresis. Total nuclear DNA (used as a control
template for PCR amplifications) was digested to fragments with the
same average size as matrix DNA fragments. The same amounts of
total and nuclear matrix DNA were used as templates in parallel PCR
amplifications of the test fragments. The primers used to carry out
PCR amplifications are shown in Table 1. The amplified DNA
fragments were separated by electrophoresis and the gels were
scanned to estimate the relative quantity of DNA in each band. In
preliminary experiments, the optimal PCR conditions permitting an
accurate estimation of the differences in the quantities of template
DNA over a 1× to 10× range were determined (usually 20 PCR
cycles).
Results
Analysis of spatial positions of BCRs present in AML-1
and ETO genes by in situ hybridization of BCR probes
with nuclear halos
Visualization of specific DNA sequences on nuclear halos
by hybridization opens the possibility of studying their
BCRs are attached to the nuclear matrix
4585
Table 1. PCR primers used to amplify test fragments 1-4
Fragment
Primer pairs
Length (bp)
AML-BCR3 (test 4)
Test 3
Test 2
Test 1
ACTGGAGCCCAGAGGTAGCT, GGCTACCTCCCTACCTTGGA
GGTTTGGGTGTTAATCCAGC, ATCGCTTTCAAGGTACTGGC
ACAAGGACATTCATACGTTT, TAAAATTGTTGCTCACCTAG
TGTTAAGCCAGGGGAGCCAG, GGGAAGACCAGGCTCTGATC
294
399
301
313
partitioning between matrix-bound and looped-out DNA
fractions (Balajee et al., 1996; Gerdes et al., 1994; Ratsch et
al., 2002). In our recent experiments, this method was
successfully used to study the partitioning of the human
dystrophin gene into loop domains (Iarovaia et al., 2004).
Importantly, a good correlation was observed between results
of biochemical mapping experiments and in situ hybridization
experiments. Thus, DNA fragments mapped as loops by TopoII-mediated DNA loop excision (Razin et al., 1993; Razin et
al., 1991) were indeed looped out on nuclear halos, and DNA
fragments mapped by the above protocol as DNA-loop
anchorage regions were present almost exclusively on the
nuclear matrix when hybridized to nuclear halos (Iarovaia et
al., 2004).
In the present study, hybridization in situ with nuclear halos
was used to characterize the spatial positions of AML-1 and
ETO BCRs. There are several BCRs in AML-1 involved in
reciprocal recombinations with different partners (Zhang et al.,
2002). All BCRs participating in recombinations with ETO-1
are located in intron 5 (Zhang et al., 2002), in which three
subclusters can be recognized. For our studies, we have
selected BCR3, which is the closest to exon 6. We PCR
amplified a 3009 bp DNA fragment mapped to position 8817291180 of the genomic AML-1/RUNX-1 sequence (GenBank
accession no. AP001721). This fragment (here termed AMLBCR3), which does not contain any repetitive sequences, was
used as a probe for fluorescent in situ hybridization (FISH)
with nuclear halos (prepared from HEL cells as described in
Materials and Methods).
It should be mentioned that, although HEL cells originate
from a human erythroleukaemia, they do not bear t(8;21)
translocations that affect AML-1 or ETO (Erickson et al.,
1996). The results of hybridization are shown in Fig. 1A and
Table 2. One can see that the AML-BCR3 probe hybridized
preferentially, but not exclusively, within the nuclear matrix
region. 77% of identified signals were present on the nuclear
matrix and 23% on the DNA-loop halo. The borders of the
nuclear matrix were determined by immunostaining of lamins
A and B (Fig. 2A). The much more intensive staining by DAPI
of the nuclear matrix compared with the crown of DNA loops
does not reflect the real DNA distribution between the nuclear
matrix and the loop halo (perhaps because of a non-specific
adsorption of the stain on nuclear proteins). To characterize
more accurately the distribution of DNA in nuclear halos, we
have carried out hybridization in situ with an abundant
interspersed repetitive sequence (the Alu repeat). The results of
this experiment (Fig. 2B) show that hybridization signals are
not preferentially concentrated within the nuclear matrix area.
To a first approximation, the distribution of hybridization
signals between the nuclear matrix and the crown of DNA
loops was random [i.e. the proportions of Alu repeats present
in the nuclear matrix and in the loop halo roughly reflected
their areas (25-30% and 70-75%, correspondingly)]. Hence,
the observed proportion of the AML-BCR3 signals on the
nuclear matrix is ~2.5 times higher than expected in case of a
random distribution of signals between the nuclear matrix and
the loop halo. Interestingly, a significant proportion of the
observed signal was close to the nuclear periphery (Table 2).
Fig. 1. Fluorescent in situ hybridization of
AML-BCR3 (A,A′) and ETO-BCR2 (B,B′)
probes with nuclear halos immobilized on
microscopic slides. (A′,B′) The nuclei were
pretreated with RNase A before high-salt
extraction. Hybridization signals are presented
as black spots (arrows) superimposed on the
nuclear halos stained with DAPI.
4586
Journal of Cell Science 117 (19)
Table 2. Proportions of AML-BCR3 and ETO-BCR2
present on the nuclear matrix and DNA-loop halos
Probe
AML-BCR3
ETO-BCR2
AML-control
ETO-control
Cells
analysed
Nuclear
matrix
signal (%)
Peripheral
layer
signal (%)*
DNA-loop
halo
signal (%)
99
52
84
97
77
89
23
26
28
–
–
–
23
11
77
74
*The signal present at the periphery of the nuclear matrix. This figure is
also included in the total count of signal present within the nuclear matrix.
In the ETO gene, three BCRs were found between exons 1a
and 1b (Zhang et al., 2002). We have chosen for further studies
the BCR2 located in the middle of intron 1b. A corresponding
DNA fragment (here termed ETO-BCR2) 2.75 kb in length
with the coordinates 108459-111173 on the NT_034899
sequence (region 136363-251951) was PCR amplified and
cloned. After labeling of the insertion with biotin, in situ
hybridization was carried out with nuclear halos from HEL
cells (Fig. 1B, Table 1). It is evident that ETO-BCR2 is
localized for the most part to the nuclear matrix.
Importantly, in no case was the distribution of observed
hybridization signals affected by pretreatment of nuclear
matrices with RNase A (Fig. 1A′,B′). Thus, the observed
localization of BCRs on the nuclear matrix was not due to
artificial coprecipitation with nascent transcripts (see below).
AML-1 and ETO genes are transcribed in HEL cells
Previous studies have demonstrated that transcribed genes
interact transiently with the nuclear matrix. Thus, it was
important to know whether the ETO and AML-1 genes are
transcribed in the HEL cells used in our experiments. In order
to answer the question, the reverse-transcription PCR (RTPCR) approach was used. A reverse-transcription reaction was
Fig. 2. (A-A′′) Identification of the nuclear matrix borders by
immunostaining of lamins on nuclear halos immobilized on
microscopic slides. (A) Nuclear halo stained with DAPI.
(A′) Nuclear halo immunostained using antibodies against lamins A
and B. (A′′) Superimposition of (A,A′). (B-B′′) Hybridization in situ
of Alu repeat to a nuclear halo. (B) Nuclear halo stained with DAPI.
(B′) Results of hybridization (immunostaining of biotinylated probe).
(B′′) Superimposition of (A,A′).
carried out on total cellular RNA using random primers and
then the test fragments from the ETO and AML-1 genes were
PCR amplified. In both cases, clear bands of the expected sizes
were observed (Fig. 3). Hence, both genes are transcribed in
HEL cells.
Transcribed regions of AML-1 and ETO genes located
far from BCRs are present preferentially in loop DNA
One trivial explanation of the results of in situ hybridization
with nuclear halos (Figs 1, 2) is that both genes, including
BCRs, are attached to the nuclear matrix solely because they
are transcribed. Indeed, the association of transcribed DNA
sequences was reported by many researchers (for a review, see
Razin, 1987). In order to find out whether the whole AML-1
and ETO genes (i.e. not only their BCRs) are attached to the
nuclear matrix, unique regions located at a distance of about
65 kb from BCRs were selected in both genes – a DNA
fragment 3.46 kb in length (here termed ETO-control) with the
coordinates 26553-29991 on the NT_034899 sequence (region
136363-251951) and a DNA fragment 1.6 kb in length (here
termed AML-control) with coordinates 117400-119009 on the
genomic AML-1/RUNX-1 sequence (GenBank accession no.
AP001721). These DNA fragments were PCR amplified and
cloned. Hybridization of these two probes to nuclear halos
demonstrated their preferential localization to the crowns of
DNA loops (Fig. 4A,B, Table 2). In both cases about 75% of
signals were detected in loops, a figure similar to that observed
previously when probes from dystrophin loops were hybridized
to nuclear halos (Iarovaia et al., 2004).
Although hybridization in situ with nuclear halos of probes
located far from BCRs but within transcribed regions of both
genes did not favor the above possibility, an additional
experiment was done in order to clarify the situation. We used
a biochemical PCR-based approach (Maya-Mendoza and
Aranda-Anzaldo, 2003) to study the relative representation of
Fig. 3. Analysis of the transcriptional status of ETO and AML-1
genes in HEL cells using RT-PCR. Each pair of primers was first
tested on total DNA to provide a positive control (‘DNA’) and then
used to amplify the test fragments on the template synthesized by
reverse transcription (starting from non-specific primers) of total
RNA from HEL cells (‘RNA RT+’). The lanes designated ‘RNA
RT–’ represent a negative control loaded with amplification products
synthesized without a cDNA template. All reactions were set up as in
the previous case, but the reverse transcription enzyme was omitted
from the first-strand synthesis mixture. Molecular sizes of the marker
bands are shown at the right side of the lane loaded with the marker
(M).
BCRs are attached to the nuclear matrix
4587
The same amounts of total DNA and nuclear matrix DNA were
used for PCR amplification of the test fragments scattered
along the AML-1 gene (Fig. 5). The results of amplifications
are shown in Fig. 5 below the scheme. It is evident that only
the test fragment derived from BCR3 is enriched in nuclear
matrix DNA (at least seven times enrichment compared with
total DNA, according to the results of scanning of the bands).
Other test fragments were distributed almost equally in total
DNA and matrix DNA. This result clearly demonstrates that
the attachment of this BCR to the nuclear matrix is not a result
of AML-1 gene transcription, as the other studied regions are
equally transcribed but are not over-represented in nuclear
matrix DNA.
Fig. 4. Fluorescent in situ hybridization of AML-control (A) and
ETO-control (B) probes with nuclear halos immobilized on
microscopic slides. Hybridization signals are presented as black
spots (arrows) superimposed on the nuclear halos stained with DAPI.
different regions of the AML-1 gene (including BCR3 and
distant transcribed parts of this gene) in total DNA and in
nuclear matrix DNA. The AML-1 gene was chosen for this
analysis because, according to the RT-PCR analysis (see above;
Fig. 5) in HEL cells, it is transcribed much more intensively
than the ETO gene. Nuclear matrices were obtained by a
modification of the sequential extraction procedure (Berezney
and Coffey, 1977) using limited treatment of nuclei with
staphylococcal nuclease (Razin et al., 1979) The average size
of the nuclear matrix DNA fragments was about 1 kb, and
about 2% of total DNA was recovered in the nuclear matrix.
Fig. 5. Amplification of different AML-1 gene regions using total
DNA and nuclear matrix DNA as templates. At the top is a map of
the gene showing the positions of three BCRs and four test regions
(vertical bars). The results of PCR amplifications of each test region
on the total DNA template (T) and the nuclear matrix DNA template
(M) are presented below the map. The figures below the images of
the amplified fragments show the amount of DNA in the test
fragments amplified on the nuclear matrix DNA template relative to
the amount of DNA in the test fragments amplified on the total DNA
template. The figures represent the average of the results obtained in
three independent experiments.
Mapping MARs within cloned AML-BCR3 and ETOBCR2 fragments
MARs are eukaryotic DNA sequences that bind in a specific
fashion to the nuclear matrix in the presence of a vast excess
of competitor prokaryotic DNA (Cockerill and Garrard, 1986).
MARs are likely to participate in DNA-loop anchorage to the
nuclear matrix, although most of them represent potential
attachment sites (Iarovaia et al., 1996; Razin, 2001). In order
to find out whether the BCRs studied here contain MARs, a
standard in vitro binding assay (Cockerill and Garrard, 1986)
was used. The bona fide MAR from the Drosophila histone
gene cluster (Cockerill and Garrard, 1986; Mirkovitch et al.,
1984) was used as a positive control. The results of the
experiments are presented in Fig. 6. The 2.7 kb ETO-BCR2
fragment was cut into two subfragments of 1.8 kb and 0.9 kb.
The largest of these two fragments (1.8 kb) was not bound by
the nuclear matrix (the binding was competed by the same
amount of competitor DNA as the binding of the linearized
pUC vector). By contrast, the 0.9 kb fragment was bound by
the nuclear matrix to the same extent as the bona fide MAR
Fig. 6. Mapping of MAR elements in AML-BCR3 and ETO-BCR2.
Different fragments present in the input mixture are shown by arrows
at the left-hand side of the lane with input DNA. The other four lanes
in each experiment represent the fragments obtained from the nuclear
matrix incubated with the input fragments in the presence of
increasing amounts (50 µg ml–1, 100 µg ml–1, 200 µg ml–1 and 500
µg ml–1) of cold, non-specific competitor DNA (sheared Escherichia
coli DNA), whereas the amount of labeled input DNA was constant
(1 µg ml–1) in all cases. Notice that the 900 bp subfragment of ETOBCR2 and the 1200 bp subfragment of AML-BCR3 are retained by
nuclear matrices to the same extent as bona fide MARs from the
Drosophila histone gene cluster (‘Hist-MAR’), whereas the other
subfragments of the BCRs and the pUC DNA are washed out at high
concentrations of non-specific competitor DNA.
4588
Journal of Cell Science 117 (19)
from the Drosophila histone gene domain. Hence, this
fragment contained a strong MAR. The 3 kb AML-BCR3
fragment was cut into 1.8 kb and 1.2 kb subfragments (Fig. 6).
Again, these fragments were mixed with 2.8 kb pUC18 DNA
(negative control) and a cloned 1.7 kb MAR from the
Drosophila histone gene cluster (positive control) and a
standard matrix-binding assay was carried out. It is evident
(Fig. 3B) that the 1.8 kb fragment has the same affinity to the
nuclear matrix as the MAR from the Drosophila histone gene
cluster. By contrast, the 1.2 kb fragment was not at all bound
by the nuclear matrix. Summarizing, we conclude that both
ETO-BCR2 and AML-BCR3 contain MARs.
Discussion
The mechanisms of illegitimate recombination resulting in
chromosomal translocations are not yet fully understood. Even
less is known about the reasons for non-random distribution of
recombination sites along chromosomes. We proposed that the
nuclear architecture might play a certain role in determining
the positions of recombination hot spots (Razin, 1999). In
particular, it was proposed that these hot spots might be
localized within matrix attachment regions (Razin, 1999). This
idea was corroborated by some indirect evidence. Namely, it
was found that Topo II of the nuclear matrix, which seems to
be in contact with DNA in the MARs, is a principal target for
different anticancer drugs (Fernandes and Catapano, 1995;
Gromova et al., 1995a; Lambert and Fernandes, 2000).
Inhibition of Topo II activity induces double-strand breaks in
DNA. Mistakes in the course of repair of these breaks might
cause illegitimate recombination. It is also worth mentioning
that nuclear MARs constitute weak points in chromosomes
where DNA cleavage by different agents frequently occurs
(Gromova et al., 1995b). Being far from each other on the DNA
chain (and even in different chromosomes), the MARs might
reside close to each other at the nuclear matrix (i.e. in physical
space) and this will enhance the probability of illegitimate
recombination between distal chromosomal regions as well as
between different chromosomes. In a previous study, we
demonstrated that, in the Chinese hamster genome, the
recombination hot spot located close to the GNA3 gene resided
within the matrix attachment area (Svetlova et al., 2001). Here,
we have demonstrated that the BCRs of the AML-1 and ETO
genes are preferentially (and, in the case of the ETO gene,
almost exclusively) located at the nuclear matrix. It is
important that the association of these BCRs with the nuclear
matrix is not a consequence of transcription. First, probes
located far from BCRs but within the transcribed parts of both
genes hybridized preferentially to the loop halos (in contrast to
BCR probes, which hybridized preferentially within the
nuclear cores). Second, using a semiquantitative PCR-based
approach (Maya-Mendoza and Aranda-Anzaldo, 2003), we
have demonstrated that, in contrast to BCRs, other transcribed
regions of the AML-1 gene are not enriched in nuclear matrix
DNA. These results are in apparent contradiction to some
earlier observations showing that transcribed DNA sequences
are over-represented in nuclear matrix DNA (Ciejek et al.,
1983; Robinson et al., 1983). However, in these previous
studies, hybridization methods were used that integrated the
signal from long DNA fragments. Furthermore, the loop DNA
was cut from the nuclear matrix by restriction nucleases, and
thus the nuclear matrix DNA was composed of relatively long
DNA fragments. If, indeed, transcribed DNA sequences
became temporarily associated with the nuclear matrix via
matrix-bound transcription complexes (Jackson and Cook,
1985; Razin, 1987), the intensity of a signal observed upon
hybridization of a corresponding DNA probe with the nuclear
matrix DNA would depend on the length of the nuclear matrix
DNA fragments and on the intensity of transcription. Thus,
long DNA fragments with several elongating RNA polymerase
II complexes would behave as though they were bound to the
nuclear matrix. By contrast, the PCR-based approach used in
the present study permits the spatial positions of short DNA
fragments to be analysed. 300 bp test fragments would be overrepresented in nuclear matrix DNA only if they were attached
to the nuclear matrix in most cells in the population. Thus, the
association of BCRs with the nuclear matrix is likely to be
permanent and not transient. In agreement with this conclusion,
we have demonstrated that both BCRs studied in this work
contain MARs that participate in the anchorage of DNA loops
to the nuclear matrix (Iarovaia et al., 1996). The MARs are
characterized by the presence of different simple motives and
imperfect repeats (Boulikas, 1995) and thus present perfect
targets for illegitimate recombination carried out by both nonhomologous and homologous end-joining systems. According
to recent studies, in untransformed human cells, each
interphase chromosome occupies a specific radial position
within the nuclear space (Boyle et al., 2001). Spatial proximity
of translocation-prone loci might increase the probability of
reciprocal recombination between them (Roix et al., 2003;
Parada et al., 2002). Thus, chromosomes with similar radial
positions in the nuclei are more frequently involved in
reciprocal recombinations than are chromosomes with
different radial positions. It is interesting that chromosome 8
(harboring the ETO gene) is characterized by a relatively distal
radial position in normal nuclei, whereas chromosome 21
(harboring the AML-1 gene) is characterized by one of the most
central radial positions (Boyle et al., 2001). Hence, the
expected frequency of reciprocal recombinations between
these chromosomes should be rather low. The preferred
location of a significant portion of AML-BCR3 on the
peripheral layer of the nuclear matrix might explain the
apparent contradiction. The chromosomal territories are rather
amorphous, dynamic structures and the location of a particular
gene outside the main body of a territory was observed by
several authors (Mahy et al., 2002; Ragoczy et al., 2003). It is
natural that, being fixed (even temporarily) at the nuclear
periphery, AML-BCR3 has a much better chance to meet the
ETO-BCRs than any chromosomal region located close to the
center of the nucleus.
We are grateful to R. Hancock for critical reading of the manuscript
and helpful discussion. This work was supported by a grant of the
MCB program of the Presidium of the Russian Academy of Sciences
and by RFFI grants 02-04-48369 and 03-04-48627.
References
Ahuja, H. G., Felix, C. A. and Aplan, P. D. (2000). Potential role for DNA
topoisomerase II poisons in the generation of t(11;20)(p15;q11)
translocations. Genes Chromosomes Cancer 29, 96-105.
Auxenfants, E., Morel, P., Lai, J. L., Sartiaux, C., Detourmignies, L.,
Bauters, F. and Fenaux, P. (1992). Secondary acute lymphoblastic
BCRs are attached to the nuclear matrix
leukemia with t (4;11): report on two cases and review of the literature. Ann.
Hematol. 65, 143-146.
Balajee, A. S., Dominguez, I., Bohr, V. A. and Natarajan, A. T. (1996).
Immunofluorescent analysis of the organization of telomeric DNA
sequences and their involvement in chromosomal aberrations in hamster
cells. Mut. Res. 372, 163-172.
Berezney, R. and Coffey, D. S. (1977). Nuclear matrix: isolation and
characterization of a framework structure from rat liver nuclei. J. Cell Biol.
73, 616-637.
Boulikas, T. (1995). Chromatin domains and prediction of MAR sequences.
Int. Rev. Cytol. 162A, 279-388.
Boyle, S., Gilchrist, S., Bridger, J. M., Mahy, N. L., Ellis, J. A. and
Bickmore, W. A. (2001). The spatial organization of human chromosomes
within the nuclei of normal and emerin-mutant cells. Hum. Mol. Genet. 10,
211-219.
Bystritskiy, A. and Razin, S. V. (2004). Breakpoint clusters: reason or
consequence. Crit. Rev. Eukar. Gene Expr. 14, 65-78.
Ciejek, E. M., Tsai, M.-J. and O’Malley, B. W. (1983). Actively transcribed
genes are associated with the nuclear matrix. Nature 306, 607-609.
Cockerill, P. N. and Garrard, W. T. (1986). Chromosomal loop anchorage
of the kappa immunoglobulin gene occurs next to the nenhancer in a region
containing topoisomerase II sites. Cell 44, 273-282.
Davis, J. N., McGhee, L. and Meyers, S. (2003). The ETO (MTG8) gene
family. Gene 303, 1-10.
Elsasser, A., Franzen, M., Kohlmann, A., Weisser, M., Schnittger, S.,
Schoch, C., Reddy, V. A., Burel, S., Zhang, D. E., Ueffing, M. et al.
(2003). The fusion protein AML1-ETO in acute myeloid leukemia with
translocation t(8;21) induces c-Jun protein expression via the proximal AP1 site of the c-Jun promoter in an indirect, JNK-dependent manner.
Oncogene 22, 5646-5657.
Erickson, P. F., Dessev, G., Lasher, R. S., Philips, G., Robinson, M. and
Drabkin, H. A. (1996). ETO and AML1 phosphoproteins are expressed in
CD34+ hematopoietic progenitors: implications for t(8;21) leukemogenesis
and monitoring residual disease. Blood 88, 1813-1823.
Felix, C. A. (1998). Secondary leukemias induced by topoisomerase-targeted
drugs. Biochim. Biophys. Acta 1400, 233-255.
Fernandes, D. J. and Catapano, C. V. (1995). The nuclear matrix as a site
of anticancer drug action. Int. Rev. Cytol. 162, 539-576.
Gale, K. C. and Osheroff, N. (1992). Intrinsic intermolecular DNA ligation
activity of eukaryotic topoisomerase II. Potential roles in recombination. J.
Biol. Chem. 267, 12090-12097.
Geng, J. P., Tong, J. H., Dong, S., Wang, Z. Y., Chen, S. J., Chen, Z., Zelent,
A., Berger, R. and Larsen, C. J. (1993). Localization of the chromosome
15 breakpoints and expression of multiple PML-RAR alpha transcripts in
acute promielocytic leukemia: a study of 28 Chinese patients. Leukemia 7,
20-26.
Gerdes, M. G., Carter, K. C., Moen, P. T. J. and Lawrence, J. B. (1994).
Dynamic changes in the higher-level chromatin organization of specific
sequences revealed by in situ hybridization to nuclear halos. J. Cell Biol.
126, 289-304.
Gromova, I. I., Thomsen, B. and Razin, S. V. (1995a). Different
topoisomerase II antitumor drugs direct similar specific long-range
fragmentation of an amplified c-MYC gene locus in living cells and in highsalt-extracted nuclei. Proc. Natl. Acad. Sci. USA 92, 102-106.
Gromova, I. I., Nielsen, O. F. and Razin, S. V. (1995b). Long-range
fragmentation of the eukaryotic genome by exogenous and endogenous
nucleases proceeds in a specific fashion via preferential DNA cleavage at
matrix attachment sites. J. Biol. Chem. 270, 18685-18690.
Henglein, B., Synovzik, H., Groitl, P., Bornkamm, G. W., Hartl, P. and
Lipp, M. (1989). Three breakpoints of variant t(2;8) translocations in
Burkett’s lymphoma cells fall within a region 140 kilobases distal from cmyc. Mol. Cell. Biol. 9, 2105-2113.
Iarovaia, O., Hancock, R., Lagarkova, M., Miassod, R. and Razin, S. V.
(1996). Mapping of genomic DNA loop organization in a 500-kilobase
region of the Drosophila X chromosome by the topoisomerase II-mediated
DNA loop excision protocol. Mol. Cell. Biol. 16, 302-308.
Iarovaia, O. V., Bystritskiy, A., Ravcheev, D., Hancock, R. and Razin, S.
V. (2004). Visualization of individual DNA loops and a map of loopdomains in the human dystrophin gene. Nucleic Acids Res. 32, 2079-2086.
Jackson, D. A. and Cook, P. R. (1985). Transcription occurs at a
nucleoskeleton. EMBO J. 4, 919-925.
Lambert, J. M. and Fernandes, D. J. (2000). Topoisomerase II cleavable
complex formation within DNA loop domains. Biochem. Pharmacol. 60,
101-109.
4589
Le, X. F., Claxton, D., Kornblau, S., Fan, Y. H., Mu, Z. M. and Chang, K.
S. (1998). Characterization of the ETO and AML1-ETO proteins involved
in 8;21 translocation in acute myelogenous leukemia. Eur. J. Haematol. 60,
217-225.
Lovett, B. D., Lo Nigro, L., Rappaport, E. F., Blair, I. A., Osheroff, N.,
Zheng, N., Megonigal, M. D., Williams, W. R., Nowell, P. C. and Felix,
C. A. (2001). Near-precise interchromosomal recombination and functional
DNA topoisomerase II cleavage sites at MLL and AF-4 genomic
breakpoints in treatment-related acute lymphoblastic leukemia with t(4;11)
translocation. Proc. Natl. Acad. Sci. USA 98, 9802-9807.
Mahy, N. L., Perry, P. E. and Bickmore, W. A. (2002). Gene density and
transcription influence the localization of chromatin outside of chromosome
territories detectable by FISH. J. Cell Biol. 159, 753-763.
Maniatis, T., Fritsch, E. F. and Sambrook, J. (1982). Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Maraschin, J., Dutrillaux, B. and Aurias, A. (1990). Chromosome
aberrations induced by etoposide (VP-16) are not random. Int. J. Cancer.
46, 808-812.
Maya-Mendoza, A. and Aranda-Anzaldo, A. (2003). Positional mapping of
specific DNA sequences relative to the nuclear substructure by direct
polymerase chain reaction on nuclear matrix-bound templates. Anal.
Biochem. 313, 196-207.
Mirkovitch, J., Mirault, M.-E. and Laemmli, U. K. (1984). Organization of
the higher-order chromatin loop: specific DNA attachment sites on nuclear
scaffold. Cell 39, 223-232.
Parada, L. A., McQueen, P. G., Munson, P. J. and Misteli, T. (2002).
Conservation of relative chromosome positioning in normal and cancer
cells. Curr. Biol. 12, 1692-1697.
Ragoczy, T., Telling, A., Sawado, T., Groudine, M. and Kosak, S. T. (2003).
A genetic analysis of chromosome territory looping: diverse roles for distal
regulatory elements. Chromosome Res. 11, 513-525.
Ratsch, A., Joos, S., Kioschis, P. and Lichter, P. (2002). Topological
organization of the MYC/IGK locus in Burkett’s lymphoma cells assessed
by nuclear halo preparations. Exp. Cell. Res. 273, 12-20.
Razin, S. V. (1987). DNA interaction with the nuclear matrix and spatial
organization of replication and transcription. BioEssays 6, 19-23.
Razin, S. V. (1999). Chromosomal DNA loops may constitute basic units of
the genome organization and evolution. Crit. Rev. Eukaryotic Gene Expr. 9,
279-283.
Razin, S. V. (2001). The nuclear matrix and chromosomal DNA loops: is there
any correlation between partitioning of the genome into loops and functional
domains. Cell. Mol. Biol. Lett. 6, 59-69.
Razin, S. V., Mantieva, V. L. and Georgiev, G. P. (1979). The similarity of
DNA sequences remaining bound to scaffold upon nuclease treatment of
interphase nuclei and metaphase chromosomes. Nucleic Acids Res. 7, 17131735.
Razin, S. V., Petrov, P. and Hancock, R. (1991). Precise localization of the
α-globin gene cluster within one of the 20- to 300-kilobase DNA fragment
released by cleavage of chicken chromosomal DNA at topoisomerase II site
in vivo: evidence that the fragment are DNA loops or domains. Proc. Natl.
Acad. Sci. USA 88, 8515-8519.
Razin, S. V., Hancock, R., Iarovaia, O., Westergaard, O., Gromova, I.
and Georgiev, G. P. (1993). Structural-functional organization of
chromosomal DNA domains. Cold Spring Harbor Symp. Quant. Biol. 58,
25-35.
Robinson, S. I., Small, D., Idzerda, R., McKnight, G. S. and Vogelstein, B.
(1983). The association of active genes with the nuclear matrix of the
chicken oviduct. Nucleic Acids Res. 15, 5113-5130.
Roix, J. J., McQueen, P. G., Munson, P. J., Parada, L. A. and Misteli, T.
(2003). Spatial proximity of translocation-prone gene loci in human
lymphomas. Nat. Genet. 34, 287-291.
Rowley, J. D. (1993). Rearrangements involving chromosome band 11q23 in
acute leukaemia. Semin. Cancer Biol. 4, 377-385.
Shibuya, M. L., Ueno, A. M., Vannais, D. B., Craven, P. A. and Valdren,
C. A. (1994). Megabase pair deletions in mutant mammalian cells following
exposure to amsacrine, an inhibitor of DNA topoisomerase II. Cancer Res.
54, 1092-1097.
Super, H. J., McCabe, N. R., Thirman, M. J., Larson, R. A., le Beau, M.
M., Pedersen-Bjergaard, J., Philip, P., Diaz, M. O. and Rowley, J. D.
(1993). Rearrangements of MLL gene in therapy-related acute myeloid
leukemia in patients previously treated with agents targeting DNAtopoisomerase II. Blood 82, 3705-3711.
Svetlova, E. and Razin, S. V. (2001). The loop pattern of chromosomal DNA
4590
Journal of Cell Science 117 (19)
may significantly differ in AT-rich and GC-rich isochores. Doklady
Biochem. Biophys. 377, 135-136.
Svetlova, E. Y., Razin, S. V. and Debatisse, M. (2001). Mammalian
recombination hot spot and DNA loop anchorage region: a model for the
study of common fragile sites. J. Cell. Biochem. 36, 170-178.
Westendorf, J. J., Yamamoto, C. M., Lenny, N., Downing, J. R., Selsted,
M. E. and Hiebert, S. W. (1998). The t(8;21) fusion product, AML-1-ETO,
associates
with
C/EBP-alpha,
inhibits
C/EBP-alpha-dependent
transcription, and blocks granulocytic differentiation. Mol. Cell. Biol. 18,
322-333.
Whitmarsh, R. J., Saginario, C., Zhuo, Y., Hilgenfeld, E., Rappaport, E.
F., Megonigal, M. D., Carroll, M., Liu, M., Osheroff, N., Cheung, N. K.
et al. (2003). Reciprocal DNA topoisomerase II cleavage events at 5′-
TATTA-3′ sequences in MLL and AF-9 create homologous single-stranded
overhangs that anneal to form der(11) and der(9) genomic breakpoint
junctions in treatment-related AML without further processing. Oncogene
22, 8448-8459.
Zhang, T., Hillion, J., Tong, J. H., Cao, Q., Chen, S. J., Berger, R. and
Chen, Z. (1994). AML-1 gene rearrangement and AML-1-ETO gene
expression as molecular markers of acute myeloblastic leukemia with
t(8;21). Leukemia 8, 729-734.
Zhang, Y., Strissel, P., Strick, R., Chen, J., Nucifora, G., le Beau, M. M.,
Larson, R. A. and Rowley, J. D. (2002). Genomic DNA breakpoints in
AML1/RUNX1 and ETO cluster with topoisomerase II DNA cleavage and
DNase I hypersensitive sites in t(8;21) leukemia. Proc. Natl. Acad. Sci. USA
99, 3070-3075.