Download A monoclonal antibody against a carbohydrate

Glycobiology vol. 16 no. 3 pp. 184–196, 2006
doi:10.1093/glycob/cwj055
Advance Access publication on November 10, 2005
A monoclonal antibody against a carbohydrate epitope in lipopolysaccharide differentiates
Chlamydophila psittaci from Chlamydophila pecorum, Chlamydophila pneumoniae, and
Chlamydia trachomatis
Sven Müller-Loennies1,3, Sabine Gronow1,3, Lore Brade3,
Roger MacKenzie4, Paul Kosma5, and Helmut Brade2,3
3
Research Center Borstel, Leibniz Center for Medicine and Biosciences,
Parkallee 22, D-23845 Borstel, Germany; 4Institute for Biological Sciences, National Research Council Canada, Ottawa, Ontario, Canada K1A
0R6; and 5Department of Chemistry, University of Natural Resources and
Applied Life Sciences, A-1190 Vienna, Austria
Received on August 9, 2005; revised on November 2, 2005; accepted on
November 3, 2005
Lipopolysaccharide (LPS) of Chlamydophila psittaci but not
of Chlamydophila pneumoniae or Chlamydia trachomatis contains a tetrasaccharide of 3-deoxy-␣-D-manno-oct-2-ulopyranosonic acid (Kdo) of the sequence Kdo(2®8)[Kdo(2®4)]
Kdo(2®4)Kdo. After immunization with the synthetic neoglycoconjugate antigen Kdo(2®8)[Kdo(2®4)]Kdo(2®4) Kdo-BSA,
we obtained the mouse monoclonal antibody (mAb) S69-4 which
was able to differentiate C. psittaci from Chlamydophila
pecorum, C. pneumoniae, and C. trachomatis in double labeling
experiments of infected cell monolayers and by enzyme-linked
immunosorbent assay (ELISA). The epitope specificity of mAb
S69-4 was determined by binding and inhibition assays using
bacteria, LPS, and natural or synthetic Kdo oligosaccharides as
free ligands or conjugated to BSA. The mAb bound preferentially Kdo(2®8)[Kdo(2®4)]Kdo(2®4)Kdo(2®4) with a KD of
10 ␮M, as determined by surface plasmon resonance (SPR) for
the monovalent interaction using mAb or single chain Fv. Crossreactivity was observed with Kdo(2®4)Kdo(2®4) Kdo but not
with Kdo(2®8)Kdo(2®4)Kdo, Kdo disaccharides in 2®4- or
2®8-linkage, or Kdo monosaccharide. MAb S69-4 was able to
detect LPS on thin-layer chromatography (TLC) plates in
amounts of <10 ng by immunostaining. Due to the high sensitivity achieved in this assay, the antibody also detected in vitro
products of cloned Kdo transferases of Chlamydia. The antibody
can therefore be used in medical and veterinarian diagnostics,
general microbiology, analytical biochemistry, and studies of
chlamydial LPS biosynthesis. Further contribution to the general understanding of carbohydrate-binding antibodies was
obtained by a comparison of the primary structure of mAb S69-4
to that of mAb S45-18 of which the crystal structure in complex
with its ligand has been elucidated recently (Nguyen et al., 2003,
Nat. Struct. Biol., 10, 1019–1025).
Key words: diagnostic/immunofluorescence/Kdo/
neoglycoconjugate
1
These
2
authors contributed equally to this work.
To whom correspondence should be addressed; e-mail:
[email protected]
Introduction
Bacteria of the genus Chlamydia are pathogenic, obligatory
phagosomal intracellular parasites which cause acute and
chronic diseases in animals and humans (Moulder, 1991;
Byrne and Ojcius, 2004; Campbell and Kuo, 2004).
Chlamydia trachomatis, Chlamydophila psittaci, Chlamydophila pneumoniae, and Chlamydophila pecorum are the most
frequently found four species of the family Chlamydiaceae
(Everett, 2000). Like other gram-negative bacteria, chlamydiae contain in their outer membrane lipopolysaccharide
(LPS) which is an essential constituent and represents one
of the major surface antigens of this microorganism. The
LPS contains in its saccharide moiety an antigenic epitope
shared by all chlamydiae (Nurminen et al., 1983), and
thus, represents a family-specific antigen. This epitope
is composed of a 3-deoxy-α-D-manno-oct-2-ulopyranosonic
acid (Kdo) trisaccharide of the sequence Kdo(2→8)Kdo
(2→4)Kdo (Brade et al., 1987) which is biosynthetically
assembled by a single, trifunctional Kdo transferase
(WaaA) (Belunis et al., 1992). This structure (Figure 1) has
been determined first in the LPS of recombinant bacteria
expressing chlamydial Kdo transferases (Holst et al., 1993,
1995; Brabetz et al., 2000) and has recently been confirmed
on authentic LPS of C. trachomatis serotype L2 and E
(Rund et al., 1999; Heine et al., 2003) and C. psittaci 6BC
(Rund et al., 2000). At the time of uncontrolled import of
exotic birds, particularly paroquets, psittacosis occurred as
a severe atypical pneumonia in humans. C. psittaci 6BC
was isolated from an infected paroquet and represents one
of the reference strains. These studies have shown that the
latter contains in addition to the Kdo(2→8)Kdo(2→4)Kdo
trisaccharide, a Kdo(2→4)Kdo(2→4)Kdo trisaccharide,
and in large amounts a branched Kdo(2→8)[Kdo(2→4)]
Kdo(2→4)Kdo(2→4) tetrasaccharide which are all synthesized by a single Kdo transferase (Mamat et al.,
1993a; Löbau et al., 1995). A monoclonal antibody
(mAb) which binds to the latter oligosaccharide but not
to the Kdo(2→8)Kdo(2→4)Kdo trisaccharide would
allow the specific detection of C. psittaci in infected
tissue by immunohistology and would thus be useful in
veterinarian and medical diagnostics. Furthermore, it
would allow the specific detection of even small amounts
of Kdo oligosaccharides as they are generated in in vitro
assays of Kdo transferases and thus facilitate their biochemical characterization.
Such an antibody, named mAb S69-4, is described
herein. We will show that mAb S69-4 has broad biomedical
and biochemical applications. The comparison of mAb
S69-4 with mAb S45-18, the structure of which has been
© The Author 2005. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected] 184
Monoclonal antibody specific for Chlamydophila psittaci LPS
appearance of serum antibodies against the immunizing
antigen. The animal with the highest titer in enzyme-linked
immunosorbent assay (ELISA) against the immunizing
antigen was used for fusion. Spleen cells (1.2 × 108) were
fused and seeded into 720 primary wells; 500 primary hybridomas were obtained (58%), 39 of which produced specific
antibody. Screening was first done by ELISA using in parallel chlamydial elementary bodies (EB) of C. psittaci 6BC
and 2→4/2→4Kdo3-BSA as antigen. Those with best reactivities were further tested by immunofluorescence test
(IFT) using cells infected with C. trachomatis or C. psittaci
6BC. After three steps of limiting dilution, we have
obtained mAb S69-4 (IgG1) which differentiated best
between C. trachomatis and C. psittaci in IFT.
Serological characterization of mAb S69-4 by ELISA
Fig. 1. Chemical structures of the Kdo region in chlamydial LPS. The
trisaccharide Kdo(2→8)Kdo(2→4)Kdo (A) occurs in all chlamydiae
investigated so far and represents a family-specific epitope. The
trisaccharide Kdo(2→4)Kdo(2→4)Kdo (B) and the tetrasaccharide
Kdo(2→8)[Kdo(2→4)]Kdo(2→4)Kdo (C) have been detected only in
Chlamydophila psittaci. R represents the lipid A moiety in LPS.
determined by crystallography of the antibody Fab fragment in complex with ligand (Nguyen et al., 2003), also
contributes to the general understanding of carbohydratebinding antibodies.
Results
Immunization of mice and preparation of mAbs
BALB/c mice were successfully immunized with Kdo4-BSA
(for abbreviations see Tables I and VI), as shown by the
The antibody was tested against neoglycoconjugate antigens by ELISA checkerboard titrations using antigen concentrations between 3.2 and 100 pmol/mL to coat the
plates; the results are shown in Figure 2. The antibody
bound to 2→4/2→4Kdo3-BSA and Kdo4-BSA with comparable affinity (Figure 2E and F). Very weak binding
was observed with 2→4Kdo2-BSA and 2→8Kdo2-BSA,
and 2→8/2→4Kdo3-BSA (Figure 2B–D) only when high
concentrations of antibody (>250 ng/mL) and antigen
(>50 pmol/mL) were used. No binding to Kdo-BSA was
observed (Figure 2A) even at highest antibody and antigen
concentrations. The antibody was also tested against BSA
glycoconjugates containing the 4′-monophosphoryl derivatives of deacylated C. psittaci LPS. MAb S69-4 did not
bind 2→8/2→4Kdo3-GlcNAc2-4P-BSA (Figure 3C), but
reacted equally well with 2→4/2→4Kdo3-GlcNAc2-4PBSA (Figure 3B) and Kdo4-GlcNAc2-4P-BSA (Figure 3A).
In further experiments, it was shown by ELISA that
mAb S69-4 bound to isolated LPS (Table II) and to whole
bacteria (Table III). Finally, we performed inhibition
experiments using free oligosaccharides as haptenic inhibitors in ELISA of S69-4 with Kdo4-BSA as solid-phase antigen. Kdo-allyl, 2→4Kdo2-allyl, and 2→8/2→4Kdo3-allyl
did not inhibit mAb S69-4, whereas 2→4/2→4Kdo3-allyl,
Kdo4-allyl, and Kdo4-GlcNAc2-P2 resulted in 50% inhibition at concentrations of 4.4, 1.7, and 2.1 μM, respectively
(Table IV).
IFT
We were interested to see whether mAb S69-4 could be
applied in human and veterinarian medicine for the detection of chlamydial inclusions in tissue culture and in histological samples from patients with chlamydial infections
and tested mAb S69-4 in double labeling experiments. Cell
monolayers were infected with C. psittaci, C. pneumoniae,
or C. trachomatis and then incubated with mAb S69-4
(IgG1) followed by detection with horseradish peroxidaseconjugated (HRP-conjugated) second antibody. In a
second step, the cell monolayers were incubated with mAb
S5-10 (IgG3) recognizing 2→8/2→4Kdo3 present in all
chlamydiae and stained using a fluorescein isothiocyanateconjugated (FITC-conjugated) second antibody. As expected,
all three samples were stained with mAb S5-10 (Figure 4A-C),
but only the monolayer infected with C. psittaci was stained
185
S. Müller-Loennies et al.
Table I. Oligosaccharides used in this study
Oligosaccharide structures
Abbreviation
Synthetic oligosaccharides
αKdo(2→OCH2-CH=CH2
Kdo-allyl
αKdo(2→4)αKdo(2→OCH2-CH=CH2
2→4Kdo2-allyl
αKdo(2→8)αKdo(2→OCH2-CH=CH2
2→8Kdo2-allyl
αKdo(2→4)αKdo(2→4)αKdo(2→OCH2-CH=CH2
2→4/2→4Kdo3-allyl
αKdo(2→8)αKdo(2→4)αKdo(2→OCH2-CH=CH2
2→8/2→4Kdo3-allyl
αKdo(2→8)[αKdo(2→4)]αKdo(2→4)αKdo(2→OCH2-CH=CH2
Kdo4-allyl
Oligosaccharides isolated from LPS
αKdo(2→8)[αKdo(2→4)]αKdo(2→4)αKdo(2→6)βGlcNAc-4P(1→6)αGlcNAc-1P
Kdo4-GlcNAc2-P2
αKdo(2→4)αKdo(2→4)αKdo(2→6)βGlcNAc-4P(1→6)αGlcNAc
2→4/2→4Kdo3-GlcNAc2-4P
αKdo(2→8)αKdo(2→4)αKdo(2→6)βGlcNAc-4P(1→6)αGlcNAc
2→8/2→4Kdo3-GlcNAc2-4P
by mAb S69-4 (Figure 4D). Each inclusion which was
stained with mAb S5-10 was also detected with mAb S69-4
(Figure 4A and D) indicating that the epitope recognized
by mAb S69-4 was constantly expressed in C. psittaci. To
see whether other strains of the genus Chlamydophila were
detected with mAb S69-4, we tested 11 isolates from
infected animals in IFT and in ELISA using purified formalinized EB. As summarized in Table V, all four strains of
C. psittaci were positive for mAb S69-4, whereas
C. pecorum and the mouse biovar of C. trachomatis were
negative. The weakly positive result of C. pecorum LW 613-17
was likely to be false positive because the EB of this strain
did not react in ELISA and the second strain of bovine
C. pecorum (strain LW 623-11) was negative. In conclusion,
we have shown that mAb S69-4 can be used in immunohistology to reliably identify C. psittaci at the species level.
Detection of LPS with mAb S69-4 by thin-layer
chromatography immunostaining
Characterization of in vitro reaction products of enzymatic
reactions is a difficult task in general but particularly true
for Kdo transferases due to the heterogeneous reaction
mixture and the low amounts of products. We have generated a whole set of mAb which bind biosynthetic precursors
of the early LPS biosynthesis and have shown previously
that antibodies are useful tools to identify LPS molecules
after their chromatographic separation (Löbau et al., 1995;
Brade et al., 2002). Therefore, we tested mAb S69-4 in
immunostaining of thin-layer chromatography (TLC)
plates on which various LPS were separated. For comparison, we have included mAb S67-27 and mAb S25-23 with
known specificities.
The results with O-deacylated LPS of recombinant
Escherichia coli strains expressing the Kdo transferase
WaaA of C. trachomatis (lane 1), C. pneumoniae (lane 2),
or C. psittaci (lane 3) are shown in Figure 5. All three LPS
exhibited one band (band a) which stained with mAb S25-23
but which was not labeled by mAb S69-4 and thus contained the structure 2→8/2→4Kdo3. Due to the presence
of unsubstituted terminal Kdo, these bands also reacted
186
with mAb S67-27. The LPS synthesized by WaaA of
C. psittaci (lane 3) showed two additional bands of higher
polarity which according to earlier structural studies
(Holst et al., 1995) contained 2→4/2→4Kdo3 (band b) and
Kdo4 (band c). The closely related LPS structures containing 2→4/2→4Kdo3 and 2→8/2→4Kdo3 were well resolved
by TLC and differentiated by mAb S69-4 and mAb S25-23,
respectively.
The usefulness of TLC combined with immunostaining is
further illustrated in Figure 6 where LPS and O-deacylated
LPS are compared. Although the heterogeneity of LPS is
much higher than that of O-deacylated LPS, the results can
be readily interpreted when antibodies of defined specificity
are used. For simplicity, only the samples of E. coli expressing WaaA of C. trachomatis (lanes 1 and 2) and C. psittaci
(lanes 3 and 4) are shown. It is seen that mAb S69-4 bound
only to the LPS and O-deacylated LPS of E. coli-Cps and
that these bands were not recognized by mAb S25-23.
Figure 7 shows the results of TLC immunostaining when
isolated chlamydial LPS of C. psittaci (lanes 1–3) and
C. trachomatis (lanes 4–6) were used. Staining with mAb
S67-27 showed that both LPS were separated into three major
bands, two of which were also stained with mAb S25-23
(bands a and b in Figure 7). In the case of C. psittaci LPS,
two bands were stained with mAb S69-4 (band b and c in
Figure 7). The two bands which stained with mAb S25-23
must have contained the 2→8/2→4-linked Kdo trisaccharide and represented the main LPS fractions containing
four and five fatty acids, as shown earlier by mass spectrometry (Rund et al., 1999). The results also demonstrated
the sensitivity of this approach since <10 ng could be
detected. Finally, we used mAb S69-4 to detect in vitro
products of cloned Kdo transferases. Figure 8 shows the
results obtained when Kdo transferases of C. pneumoniae
(lane 1), C. psittaci (lane 2), E. coli (lane 3), or C. trachomatis (lane 4) were incubated with synthetic lipid A precursor
406 as acceptor and a Kdo-cytosine monophosphate
(CMP) generating system. Staining with S25-23 confirmed
that WaaA of E. coli was unable to synthesize a structure
recognized by this antibody, whereas mAb S69-4 reacted
only with products from C. psittaci WaaA.
Monoclonal antibody specific for Chlamydophila psittaci LPS
Fig. 2. Binding of mAb S69-4 to synthetic Kdo oligosaccharides conjugated to BSA. ELISA plates were coated with graded concentrations of neoglycoconjugates corresponding to 100 (●), 50 (▲), 25 (■), 12.5 (䊊), 6.3 (䉭), and 3.2 (ⵧ) pmol of ligand per mL using 50 μL per well and reacted with mAb S69-4
at the concentrations indicated on the abscissa. The antigens were Kdo-BSA (A), Kdo(2→4)Kdo-BSA (B), Kdo(2→8)Kdo-BSA (C),
Kdo(2→8)Kdo(2→4)Kdo-BSA (D), Kdo(2→4)Kdo(2→4)Kdo-BSA (E), and Kdo(2→8)[Kdo(2→4)]Kdo(2→4)Kdo-BSA (F).Values given are the mean of
quadruplicates with confidence values not exceeding 10%.
Fig. 3. Binding of mAb S69-4 to deacylated LPS conjugated to BSA. ELISA plates were coated with graded concentrations of neoglycoconjugates corresponding to 100 (●), 50 (▲), 25 (■), 12.5 (䊊), 6.3 (䉭), and 3.2 (ⵧ) pmol of ligand per mL using 50 μL per well and reacted with mAb S69-4 at the concentrations indicated on the abscissa. The antigens were Kdo(2→8)[Kdo(2→4)]Kdo(2→4)Kdo(2→6)βGlcNAc-4P(1→6)αGlcNAc-BSA (A),
Kdo(2→4)Kdo(2→4)Kdo(2→6)βGlcNAc-4P(1→6)αGlcNAc-BSA (B), and Kdo(2→8)Kdo(2→4)Kdo(2→6)βGlcNAc-4P(1→6)αGlcNAc (C). Values
given are the mean of quadruplicates with confidence values not exceeding 10%.
187
S. Müller-Loennies et al.
Table II. Reactivity of mAbs in ELISA using graded amounts of different LPS
Final concentration
(ng/mL) of
indicated
mAb yielding
OD405 >0.2
Source of LPS
Amount
of antigen
(ng/well)
S69-4
S25-23
Chlamydia trachomatis L2
250
>1000
1
50
>1000
2
10
>1000
2
2
>1000
8
Chlamydophila psittaci 6BC
E. coli-Ctr
E. coli-Cps
250
4
8
50
8
8
10
16
16
2
125
63
250
>1000
1
50
>1000
2
10
>1000
4
2
>1000
16
250
16
16
50
32
32
10
63
63
2
125
250
Table III. Reactivity of mAbs in ELISA with graded amounts of bacteria
as solid-phase antigens
Final concentration
(ng/mL) of indicated
mAb yielding
OD405 >0.2
Bacterial antigena
Amount
of antigen
(μg/well)
Chlamydia trachomatis L2
4
1000
2
2
1000
2
1
1000
2
4
4
4
2
4
4
1
8
8
4
500
8
Chlamydophila psittaci 6BC
E. coli-Ctr
E. coli-Cps
S69-4
S25-23
2
1000
8
1
>2000
16
4
4
16
2
4
32
1
8
63
a
Heat-inactivated E. coli bacteria or formalin-inactivated EBs were used
to coat ELISA plates.
188
Table IV. Inhibition of mAb S69-4 with haptenic oligosaccharides
Concentration (mM) of inhibitor
yielding 50% inhibitionb
Inhibitora
Kdo
360
2→4-Kdo2
>200
2→8/2→4-Kdo3
>140
2→4/2→4-Kdo3
4.4
Kdo4
1.7
Kdo4-GlcNAc2-P2
2.1
aFor detailed structures see Table I.
bKdo -BSA was used to coat ELISA
4
plates at a concentration of
100 pmol/mL.
Single-chain variable fragments
The genes encoding the variable domains of mAb S69-4
were cloned and expressed as single-chain variable fragments (scFv) to allow a sequence comparison with the two
well characterized antibodies mAb S45-18 and mAb S25-2
which have been crystallized in complex with the antigen
(Nguyen et al., 2003). The sequence alignment (Figure 9)
showed that mAb S69-4 is highly homologous to the germline mAb S25-2, and the mAb S45-18 and major differences
are confined to VH CDR3. S69-4 VL was identical to the
VL domain of S25-2. Apart from the CDR3, the VH
domain was identical to mAb S45-18 showing the same
mutations away from the germline.
Surface plasmon resonance (SPR)-binding studies of
S69-4 and its scFv with various ligands revealed the dissociation constants (KD) of the immobilized antibody
toward Kdo4-GlcNAc2-P2, 2→4/2→4Kdo3-GlcNAc2-P2,
and 2→8/2→4Kdo3-GlcNAc2-P2 of 10, 20, and 200 μM,
respectively. The interaction with the latter ligand could not
be determined reliably at a NaCl concentration of 150 mM
and was thus measured at 300 mM NaCl. Under all conditions tested, the interaction with 2→4Kdo2-GlcNAc2-P2
was too weak to allow the determination of the KD value.
The same measurements with immobilized scFv instead of
mAb S69-4 yielded binding constants of 10, 100, and 800 μM
for Kdo4-GlcNAc2-P2, 2→4/2→4Kdo3-GlcNAc2-P2, and
2→8/2→4Kdo3-GlcNAc2-P2 at 150 mM NaCl, respectively. SPR thus revealed a 2- to 10-fold higher affinity of
S69-4 for Kdo4-GlcNAc2-P2 over 2→4/2→4Kdo3-GlcNAc2P2 and an 20- to 80-fold reduced affinity toward the Kdotrisaccharide which contained 2→8-linked terminal Kdo.
The ligand 2→4Kdo2-GlcNAc2-P2 was not recognized by
mAb S69-4 and its scFv.
Discussion
Studies on the chemical and antigenic structure of chlamydial LPS have shown that it represents a surface-exposed
antigen which contains in the whole family Chlamydiaceae
a 2→8/2→4Kdo3 trisaccharide (for structures see Table I
and Figure 1). MAbs against 2→8/2→4Kdo3 are used in
human and veterinarian microbiology to identify chlamydiae
at the family level. The applications are immunohistology
Monoclonal antibody specific for Chlamydophila psittaci LPS
Fig. 4. Detection of chlamydial inclusions in tissue culture by double labeling with mAb S5-10 and S69-4. Tissue culture monolayers were infected with
Chlamydophila psittaci (A, D), Chlamydophila pneumoniae (B, E), or Chlamydia trachomatis (C, F) reacted with mAb S5-10 (IgG3) (A–C) and S69-4 (IgG1)
(D–F) and developed with second antibodies conjugated to FITC or HRP, respectively (See Materials and methods).
and identification of chlamydial inclusions in tissue culture
used for the isolation of chlamydiae from clinical specimen.
In addition, defined oligosaccharides representing the familyspecific epitope as obtained by degradation of LPS or by
chemical synthesis are used as antigens to detect antibodies
against chlamydial LPS in serum samples from animals or
men (Brade et al., 1994; Griffiths et al., 1996).
The species C. psittaci contains in addition a 2→4/
2→4Kdo3 trisaccharide and a Kdo4-branched tetrasaccharide (Holst et al., 1995; Brabetz et al., 2000; Rund et al.,
2000). Antibodies which bind 2→4/2→4Kdo3 and Kdo4
but not 2→8/2→4Kdo3 would (1) allow the identification
of C. psittaci, (2) be a useful tool to detect individual LPS
species in analytical biochemistry and in enzymology of
Kdo transferases and (3) contribute to the general understanding of antibody-carbohydrate recognition.
We have obtained such an antibody, mAb S69-4, upon
immunization of mice with a synthetic neoglycoconjugate
containing the branched Kdo4 tetrasaccharide. To elucidate the specificity of mAb S69-4 in detail, we have measured its reactivity with a panel of neoglycoconjugates
containing LPS-related synthetic and natural oligosaccharides. The antibody bound with highest affinity to those
structures containing the branched Kdo4 tetrasaccharide or
the 2→4/2→4Kdo3 trisaccharide. To demonstrate that the
epitope recognized by mAb S69-4 was also accessible in
LPS, other serological assays were used. When isolated LPS
of C. trachomatis and C. psittaci 6BC or LPS of recombinant E. coli strains expressing the Kdo transferase of either
chlamydial strain were used as antigens in ELISA-binding
assays; the results were fully in accordance with those
obtained with the artificial neoglycoconjugates. The results
obtained by direct-binding assays were confirmed by inhibition experiments using structurally defined oligosaccharides as inhibitors. Even when bacteria or chlamydial EB
were used as antigens in ELISA, the specificity of the reaction
of mAb S69-4 was not diminished. Finally, double labeling
experiments of chlamydial inclusions in tissue culture
showed that mAb S69-4 could differentiate C. psittaci from
C. trachomatis and C. pneumoniae (Figure 4). When we
tested by IFT and ELISA 11 isolates of animal origin, comprising the mouse and porcine biovar of C. trachomatis,
four C. psittaci and five C. pecorum strains, we found that
only those strains classified as C. psittaci gave a positive
reaction. We were not in the position to do other experiments than those summarized in Table V because we do not
have isolated LPS nor have the Kdo transferase of any
C. pecorum strain been cloned. Nevertheless, this is good
evidence that C. pecorum LPS does not contain the epitope
recognized by mAb S69-4. It will be interesting to know the
sequence of the Kdo transferase gene of C. pecorum to learn
how similar it is to those of the other known chlamydial
Kdo transferases and to learn about the chemical structure
of C. pecorum LPS.
We have then asked whether mAb S69-4 could be used
for the detection of individual molecular LPS species after
separation by TLC. We have therefore performed immunostaining with isolated LPS and O-deacylated LPS from
recombinant E. coli (Figures 5 and 6) or Chlamydia (Figure 7)
after TLC. Using a staining protocol without fixation of the
TLC plate, we could detect <10 ng in an individual band.
This allowed us to apply as little as 50–500 ng of LPS which
despite being highly heterogeneous could be separated into
distinct bands. Owing to the high sensitivity achieved under
these conditions, the antibody could be used to detect in
vitro products of Kdo transferases (Figure 8). The results
obtained confirmed the previous notion (Brabetz et al.,
2000) that the cloned WaaA of C. trachomatis and C. pneumoniae are unable to generate the branched Kdo4. When
antibodies are available or can be generated against individual enzymatic products, this relatively simple method
already provides much information on in vitro products
189
S. Müller-Loennies et al.
Table V. Detection of chlamydial EB in infected monolayers by mAb S69-4 in IFT and in ELISA
Result by
Strain
Serovar
Species
IFT
ELISAa
LW613-17
2
Chlamydophila pecorum (bovine)
Weak positive
Negative
LW623-11
2
Chlamydophila pecorum (bovine)
Negative
Negative
66-P-130-14
3
Chlamydophila pecorum
Negative
Negative
S-45-17
5
Chlamydia trachomatis (porcine biovar)
Negative
Negative
1708-11
6
Chlamydophila pecorum (porcine biovar)
Negative
Negative
Chlamydia trachomatis (mouse biovar)
Negative
Negative
Mouse pneumonitis
64-H-281
8
Chlamydophila psittaci (guinea pig)
Positive
Positive
Feline pneumonitis
7
Chlamydophila psittaci
Positive
Not done
Chlamydophila psittaci (serovar B from bovine abortion)
Positive
Positive
Chlamydophila pecorum (ovine isolate)
Negative
Negative
Chlamydophila psittaci (cockatiel isolate)
Positive
Positive
98-18524/2
JP-I-751-5
Avian 96LSU-Coct
9
Not done, concentration of EB suspension too low.
aNegative results are those giving an OD of <0.1 with mAb 69-4 even at the highest antigen concentration and an OD >0.2 with mAb 25-23 even at the
lowest antigen concentration (Materials and methods).
Fig. 5. Characterization of O-deacylated LPS from recombinant Escherichia coli expressing the Kdo transferase WaaA from Chlamydophila trachomatis, Chlamydophila pneumoniae, or Chlamydophila psittaci using
mAbs. Isolated O-deacylated LPS (2 μg each) of E. coli-Ctr (lane 1),
E. coli-Cpn (lane 2), or E. coli-Cps (lane 3) were separated by TLC and
stained with mAb S67-27 recognizing a single Kdo residue (Brade et al.,
2002), mAb S25-23 recognizing αKdo-(2→8)-αKdo-(2→4)-Kdo trisaccharide (Fu et al., 1992), or mAb S69-4 (this study). For the labeling of
bands (a, b, and c), see text.
Fig. 6. Comparison of LPS and O-deacylated LPS from recombinant
Escherichia coli expressing Kdo transferase WaaA from Chlamydophila
trachomatis, Chlamydophila pneumoniae, or Chlamydophila psittaci using
mAbs. Isolated LPS (100 ng each) or O-deacylated LPS (500 ng each) of
E. coli-Ctr (lanes 1 and 2) or E. coli-Cps (lanes 3 and 4) were separated by
TLC and stained with mAb A20 recognizing a single Kdo residue (Brade
et al., 2002), mAb S25-23 recognizing αKdo-(2→8)-αKdo-(2→4)-Kdo
trisaccharide (Fu et al., 1992), or mAb S69-4 (this study).
generated by glycosyltransferases and will facilitate the biochemical characterization of such enzymes. Furthermore,
this approach helps to decide which product should be purified for further analyses by mass spectrometry or nuclear
magnetic resonance (NMR).
Recently, crystal structures of the mAb S45-18 in
complex with 2→4/2→4Kdo3-GlcNAc2-P2 and S25-2 in
complex with 2-O-allyl derivatives of Kdo, 2→8Kdo2,
2→4Kdo2, and 2→8/2→4Kdo3 have been described at high
resolution and revealed the characteristics of an antibody
combining site which is able to bind Kdo oligosaccharides
(Nguyen et al., 2003). We have therefore cloned the variable domains of S69-4 as scFv to compare their primary
structures. MAb S69-4 was highly homologous to both
mAb S25-2 and S45-18 with a combining site almost identical
to the one described for mAb S45-18. Thus, amino acids
from CDR1 and CDR3 of VL and all three CDR of VH
contributed to complex formation and all amino acids
involved in ligand binding by mAb S45-18 were conserved
in mAb S69-4 (see following paragraph). The CDR3 loop
of VH which is known to be an important factor determining antibody specificity was of the same length and showed
conserved features important for the secondary structure
(Shirai et al., 1996, 1999; Morea et al., 1998).
The crystallized complex of S45-18 and 2→4/2→4Kdo3GlcNAc2-P2 identified ArgL30c, LysH52d, and ArgH52 as
being involved in electrostatic interactions with the ligand.
Additional hydrogen bonds are formed between the ligand
and Asn30a, SerL91, TyrL92, ArgL95, and TyrH33. The
same amino acids are present in mAb S69-4 at identical
190
Monoclonal antibody specific for Chlamydophila psittaci LPS
Fig. 7. Characterization of LPS from Chlamydia trachomatis and
Chlamydophila psittaci using mAbs. Isolated LPS of C. trachomatis (lanes
1–3) or C. psittaci (lanes 4–6) in amounts of 100 ng (lanes 1 and 4), 50 ng
(lanes 2 and 5), or 20 ng (lanes 3 and 6) were separated by TLC and
stained with mAbs as in Figure 5. For the labeling of bands (a, b, and c),
see text and for abbreviations of E. coli strains see Materials and methods.
Fig. 8. Detection of in vitro products of Kdo transferases of Escherichia
coli and Chlamydia. Synthetic lipid A precursor 406 was reacted in vitro
with a Kdo-CMP generating system and cloned Kdo transferases of
Chlamydophila pneumoniae (lane 1), Chlamydophila psittaci (lane 2),
E. coli (lane 3), or Chlamydia trachomatis (lane 4). Reaction products were
separated by TLC and stained with mAbs as in Figure 6.
positions (Figure 9). The bases of the CDR3 VH loops in
both antibodies are formed on the N-terminal side by
AlaH93, ArgH94, and AspH95 and on the C-terminal side
by AlaH100b, MetH100c, and AspH100d. In the center of
the loop, mAb S69-4 and S45-18 both contain PheH97
which has been shown in the crystal structure of S45-18 to
be involved in stacking interactions with three 2→4-linked
Kdo residues (Nguyen et al., 2003). In the same complex,
AspH100a has been shown to be involved in hydrogen
bonding the ligand mediated by a structured water molecule.
The residues of the CDR3 VH loops in both antibodies
form a kink which is stabilized by a hydrogen bond
between MetH100c carbonyl and the TrpH101 side chain
(Shirai et al., 1999). The loop is further stabilized by a salt
bridge between ArgH94 and AspH100d which is commonly
found in antibodies. This salt bridge is missing in mAb
S25-2 leading to higher flexibility and adaptation of the
loop to bind oligosaccharides which contain 2→8-linked
Kdo-residues, such as 2→8/2→4Kdo3. PheH97 which has
been shown to confer 2→4/2→4Kdo3 specificity to S45-18
is present at the same position in mAb S69-4. This residue
was shown to restrict the conformational space available
for the ligand, thus excluding 2→8-linked Kdo residues and
provided hydrophobic stacking interactions with all three
Kdo-residues of a 2→4/2→4Kdo3 ligand. Owing to the
identical framework and the conserved amino acids which
are important for the interaction, it seemed reasonable to
assume a similar mode of binding. However, SPR analyses
of the antibody and of its scFv (Figure 10) showed a relatively weak affinity of 10 μM (KD) in comparison with other
Kdo-binding antibodies (Müller-Loennies et al., 2000) and
S45-18 (KD, 20 nM, unpublished) which was approximately
three orders of magnitudes lower. The main difference
between mAb S45-18 and S69-4 is the composition of the
four amino acid stretch surrounding PheH97 on either side.
Because the CDR3 VH of mAb S45-18 is not stabilized by
an extensive network of hydrogen bonds, it is difficult to
predict how this amino acid change would affect the secondary structure of CDR3 VH in mAb S69-4. However, it
is likely that a repositioning of PheH97 takes place which
results in loss of affinity or binding. We have observed that
purified mAb S69-4 and also its scFv are unstable over time
without loss of solubility. It may therefore be that the
observed instability is the loss of binding because of different conformational states of CDR3 VH. SPR analyses
showed that only 10% on average of the immobilized scFv
were accessible for binding. Despite identical amino acid
sequences apart from CDR3 VH, such a loss of activity has
not been observed previously for mAb S25-2 and S45-18. A
higher flexibility of CDR3 VH in mAb S69-4 may result in
a high entropic penalty paid upon ligand binding and thus
may be responsible for the observed loss of overall affinity.
Importantly, this could also be the reason for the improved
distinction between the linear 2→4/2→4Kdo3 trisaccharide
and the branched Kdo4 tetrasaccharide in comparison with
mAb S45-18 contradicting the general notion that the maturation of the antibody response leads to increased specificity accompanied by an increase in affinity (MacLennan
et al., 1992; Furukawa et al., 2001).
Currently, we are characterizing the antibody response
against the branched Kdo4 tetrasaccharide in more detail
aiming at the identification of an antibody with higher
specificity for the terminal branchpoint. It will be interesting to see whether antibodies do exist which display simultaneously high specificity and high affinity against this
structure and, if so, how the antibody combining site will
compare with S45-18 and S69-4.
Materials and methods
Bacteria and bacterial LPS
Partially purified EB and LPS of C. trachomatis serotype L2
(Rund et al., 1999) and C. psittaci strain 6BC (Rund et al.,
2000) were prepared, as described in the respective references.
LPS containing Chlamydia-specific Kdo oligosaccharides were
isolated from recombinant E. coli strains (re mutant F515)
containing plasmid pFEN207 (Kdo transferase waaA of C.
trachomatis [Nano and Caldwell, 1985]) or pUM140 (waaA of
C. psittaci) (Holst et al., 1993, 1995; Mamat et al., 1993b) or
pLM 110 (Löbau et al., 1995). These LPS are abbreviated as
E. coli-Ctr, E. coli-Cps, and E. coli-Cpn, respectively. For
ELISA, partially purified EB were inactivated with 0.02%
formaldehyde and washed twice in phosphate-buffered saline
(PBS); E. coli-Ctr and E. coli-Cps bacteria were heat inactivated
(100°C, 1 h). Purified EB and cover slips with infected cell
monolayers of various strains of C. psittaci and C. pecorum
191
S. Müller-Loennies et al.
Fig. 9. Amino acid sequence alignment of VL and VH of mAbs S69-4, S45-18, and S25-2. The numbering of residues and assignment of CDR (shaded)
was done according to studies by Chothia (Chothia and Lesk, 1987; Chothia et al., 1992; Al Lazikani et al., 1997) and Kabat (Martin, 1996) as described
by Andrew C. Martin (University College London, UK, http://www.bioinf.org.uk/).
and two strains of C. trachomatis of animal origin were kindly
provided by J. Storz (Baton Rouge, LA).
Kdo (thiobarbiturate assay) and is depicted in Table VI in
nmol of ligand per mg of BSA.
mAbs
Synthetic and isolated oligosaccharides and
neoglycoconjugate antigens
All antigens used in this study are abbreviated according to
Table I. The synthetic allyl glycosides were synthesized as
described (Kosma, 1999; Kosma et al., 2000; references
therein). The allyl glycosides R-OCH2-CH=CH2 were conjugated with cysteamine yielding R-O(CH2)3-S-(CH2)2NH3+, which were activated with thiophosgene into the
isothiocyanate derivatives R-O(CH2)3-S-(CH2)2-N=C=S
and then conjugated to BSA yielding R-O(CH2)3-S-(CH2)2NH-CS-NH-BSA, wherein R represents the glycosyl residue (Lee and Lee, 1974).
Natural oligosaccharides were obtained from LPS of
E. coli-Cps after deacylation and separation of the oligosaccharide mixture by high-performance anion exchange chromatography as described (Holst et al., 1993) and were
conjugated to BSA as reported (Müller-Loennies et al.,
2002; references therein). The amount of ligand present in
the conjugates was determined by measuring the amount of
protein (Bradford assay, Bio-Rad, Munich, Germany) and
192
BALB/c mice were immunized following a protocol
described (Stähli et al., 1983). Mice (group of four) were
injected on day 0 with Kdo4-BSA (50 μg) in PBS (125 μL)
emulsified with an equal volume of Freund’s complete
adjuvant. One aliquot (50 μL) was injected i.p., and four
aliquots (50 μL each) were injected s.c. at four different
sites. On day 28, again 50 μg of the antigen in PBS (50 μL)
emulsified with an equal volume of Freund’s incomplete
adjuvant were injected i.p. Seven days later, the mice bled
from the tail vein, and the sera were tested for the presence
of antibodies against the immunizing antigen. The mouse
with the highest titer received three booster injections of
200 μg each in PBS on days 161, 162, and 163; the first one
i.v., the last two i.p. Two days after the last injection, the
animal was exsanguinated, and the spleen was removed.
Spleen cells were prepared and fused according to conventional protocols. Hybridomas were screened by ELISA
using 2→4/2→4Kdo3-BSA or EB of C. psittaci. Further
screening was done by IFT. MAb S69-4 was identified as
the most relevant clone; it was cloned thrice by limiting
Monoclonal antibody specific for Chlamydophila psittaci LPS
chlamydial LPS, mAb S67-27 (IgG1; Brade et al., 2002)
and mAb A20 (IgM; Rozalski et al., 1989), recognizing
both a single α-pyranosidically linked Kdo residue.
All antibodies used in this study are listed in Table VII.
ELISA using neoglycoconjugate antigens
Fig. 10. Representative SPR data for the interaction of oligosaccharide
with immobilized antibody. Sensorgram overlays showing the binding of
0.2–1000 μM 2→4/2→4Kdo3 to immobilized S69-4 scFv (A). Fitting of
the equilibrium data to a steady-state model (B).
Table VI. Neoglycoconjugates used in this study
Neoglycoconjugatea
Amount of ligand (nmol) per mg
of conjugate
Kdo-BSA
167
2→4Kdo2-BSA
136
2→8Kdo2-BSA
130
Neoglycoconjugates in carbonate buffer (50 mM, pH 9.2)
were coated onto MaxiSorp microtiter plates (96-well, Ubottom, Nunc, Wiesbaden, Germany) at 4°C over night.
Antigen solutions were adjusted to equimolar concentrations
based on the amount of ligand present in the respective glycoconjugate. If not stated otherwise, 50 μL of volumes were
used. Plates were washed twice in PBS supplemented with
Tween 20 (0.05%, Bio-Rad) and thimerosal (0.01%, PBS-T)
and were then blocked with PBS-T supplemented with casein
(2.5%, PBS-TC) for 1 h at 37°C on a rocker platform followed by two washings. Appropriate antibody dilutions in
PBS-TC supplemented with 5% BSA (PBS–TCB) were
added and incubated for 1 h at 37°C. After two washings,
peroxidase-conjugated goat anti-mouse IgG (heavy- and
light-chain specific; Dianova, Hamburg, Germany) or IgM
(μ-chain specific; Dianova) was added (both diluted 1:1000
in PBS–TCB), and incubation was continued for 1 h at 37°C.
The plates were washed three times with PBS-T. Substrate
solution was freshly prepared and was composed of azino-di3-ethylbenzthiazolinsulfonic acid (1 mg) dissolved in substrate buffer (0.1 M sodium citrate, pH 4.5; 1 mL) followed
by the addition of hydrogen peroxide (25 μL of a 0.1% solution). After 30 min at 37°C, the reaction was stopped by the
addition of aqueous oxalic acid (2%), and the plates were
read by a microplate reader (Tecan Sunrise, Crailsheim,
Germany) at 405 nm. Tests were run twice in quadruplicates
with confidence values not exceeding 10%.
For ELISA inhibition, serial 2-fold dilutions of inhibitor
in PBS–TCB (30 μL) were mixed in V-shaped microtiter
plates (Nunc) with an equal volume of antibody diluted in
the same buffer to give an OD405 of 1.0 without the addition of inhibitor. After incubation (15 min, 37°C), 50 μL of
the mixture were added to antigen-coated ELISA plates.
Further steps were as described above. All measurements
were done in duplicates.
2→4/2→4Kdo3-BSA
53
2→8/2→4Kdo3-BSA
82
ELISA using LPS antigens
Kdo4-BSA
97
Kdo4-GlcNAc2-P2-BSA
92
When LPS was used as an antigen in ELISA, microtiter
polyvinyl plates (96-well, Falcon 3911; Becton Dickinson,
Heidelberg, Germany) were coated with LPS of varying
concentration (2–250 ng/well) diluted in PBS (pH 7.2) and
were incubated overnight at 4°C. PBS and PBS-containing
solutions were supplemented with thimerosal (0.01%). Further incubation steps were performed at 37°C under gentle
agitation. The coated plates were washed four times with
PBS and were blocked for 1 h with PBS supplemented with
casein (2.5%, Sigma, Munich, Germany; PBS-C; 200 μL per
well). Serial dilutions of mAb diluted in PBS-C were subsequently added, and the mixture was incubated for 1 h at
37°C. After washing as described above, secondary antibodies diluted in PBS-C (same source and dilution as
above) were added. After four washings in PBS, the following steps were done as described for ELISA using neoglycoconjugate antigens.
2→4/2→4Kdo3-GlcNAc2-4P-BSA
144
2→8/2→4Kdo3-GlcNAc2-4P-BSA
128
aFor
chemical structures of glycosyl moieties see Table I.
dilution, isotyped with a commercially available isotyper kit
(Bio-Rad), and purified by affinity chromatography using an
affinity support of AH-Sepharose 4B to which the ligand
Kdo(2→8)[Kdo(2→4)]Kdo(2→4)Kdo(2→6)βGlcN-4P(1→6)
αGlcN-1P was conjugated by the glutardialdehyde method.
As controls served mAb S25-23 and mAb S5-10 (IgG1
and IgG3, respectively; Fu et al., 1992), both recognizing
the family-specific epitope Kdo(2→8)Kdo(2→4)Kdo of
193
S. Müller-Loennies et al.
Table VII. mAbs used in this study
Antibody
Isotype
Immunogen
Specificity
Reference
S69-4
IgG1
Kdo4-BSA
LPS of Chlamydophila psittaci
This study
S25-23
IgG1
2→8/2→4Kdo3-GlcNAc-BSA
Family-specific epitope of Chlamydiaceae
Kdo4, 2→4/2→4Kdo3
Fu et al. (1992)
2→8/2→4Kdo3
S5-10
IgG3
Chlamydophila psittaci EB, formalin-inactivated
Family-specific epitope of Chlamydiaceae
S25-2
IgG1
2→8/2→4Kdo3-GlcNAc-BSA
Family-specific epitope of Chlamydiaceae
Brade et al. (1990)
2→8/2→4Kdo3
Fu et al. (1992)
2→8Kdo2
S45-18
IgG1
2→4/2→4Kdo3-BSA
2→4/2→4Kdo3, 2→4Kdo2
Brade et al. (2000)
S67-27
IgG1
A20
IgM
Kdo-BSA
Terminal Kdo
Brade et al. (2002)
Salmonella enterica sv. Minnesota Re mutant R595
Terminal Kdo
Rozalski et al. (1989)
ELISA using bacterial antigens
Microtiter plates (96-well, MaxiSorp, Nunc) were coated
with chlamydial EB or E. coli bacteria in carbonate buffer
(50 mM, pH 9.2) for 2 days at 4°C. Excess antigen was
removed by two washing steps with PBS (200 μL/well) followed by blocking with PBS-C for 1 h at 37°C. After washing
with PBS, purified mAb (2 μg/mL) in PBS supplemented
with casein (2.5%) and BSA (5%) was added and incubated
for 1 h at 37°C. After two washing steps with PBS, the addition of secondary antibodies and substrate was as described
for ELISA using neoglycoconjugate antigens, but omitting
Tween 20 from all buffers. For screening of various
chlamydial strains, where no purified EB suspensions were
available, four two-fold serial dilutions were tested.
IFT and immunoperoxidase staining
L929 and HL cells were grown in 96-well microtiter plates
(Nunc). After reaching confluence, they were infected with C.
trachomatis or C. psittaci (L929) or C. pneumoniae (HL) by
centrifugation at 440 × g for 1 h at room temperature. After
48 h, the cells were fixed in methanol and stained by double
labeling. Monolayers were first incubated with mAb S69-4
(undiluted supernatant), then with rabbit anti-mouse IgG1
(isotyper-Kit, Bio-Rad) and then developed with goat antirabbit IgG conjugated to HRP (1:50, Dianova) and 4-chloronaphtol as substrate; after washing, the monolayers were then
incubated with mAb S5-10 (undiluted supernatant) and stained
with FITC-conjugated goat anti-mouse IgG (1:50, Dianova).
TLC and TLC immunostaining
LPS were separated on silica gel 60 TLC plates with aluminum support (Merck, Darmstadt, Germany) with a solvent
system of CHCl3/pyridine/88% aqueous formic acid/water
(30:70:16:10, vol/vol/vol/vol). For TLC immunostaining,
the following protocol without fixation of the plates was
used. Where not stated otherwise, incubations were performed at room temperature on a rocking table. A tray was
filled up to 3 cm with blocking buffer composed of 50 mM
Tris–HCl, 200 mM NaCl, pH 7.4, supplemented with 5%
nonfat dry milk or 3% BSA depending on the antibody
194
used. The plate was slowly dipped into the tray (note: if this
step is done too quickly, air bubbles will come up in the silica layer followed by its destruction) and left for 1 h. The
buffer was replaced by the same buffer containing appropriately diluted first antibody and left over night. Washing
was done five times for 5 min each, after which HRP-conjugated goat anti-mouse IgG (heavy- and light-chain specific;
Dianova) or IgM (μ-chain specific; Dianova), both diluted
1:1000 in blocking buffer, was added. Incubation was continued for 2 h followed by washing four times for 5 min
each in 50 mM Tris–HCl, 200 mM NaCl, pH 7.4, and once
in substrate buffer (0.1 M sodium citrate, pH 4.5). Bound
antibody was then detected by incubation for 30 min in the
dark without rocking with substrate solution (30 mL)
which was freshly prepared and was composed of 25 mL of
substrate buffer, 5 mL of 4-chloro-1-naphthol (3 mg/mL in
MeOH) and hydrogen peroxide (10 μL of a 30% solution).
The plates were washed four times for 30 s in water,
removed from the tray, and immediately dried with a fan
followed by thorough drying at 37°C. If not documented
directly, plates were stored in the dark to avoid fading of
the stain.
Detection of LPS and in vitro products of cloned Kdo
transferases in TLC
Kdo transferases were obtained from cell lysates of recombinant Corynebacterium glutamicum containing plasmid
pJKB15 (waaA of C. pneumoniae; Brabetz et al., 2000),
pJKB16 (waaA of E. coli; (Bode et al., 1998), pJKB17
(waaA of C. psittaci; Brabetz et al., 2000), or pJKB18
(waaA of C. trachomatis; Brabetz et al., 2000). In vitro
assays containing the respective Kdo transferase and a
Kdo-CMP generating system were performed as described
(Gronow et al., 2000). The products were separated by TLC
and detected in TLC immunoblots with mAbs as reported
(Gronow et al., 2000).
Cloning of scFv 69-4
For cloning of VL and VH genes of mAb S69-4, total RNA
was isolated from 1 × 107 hybridoma cells using the
Monoclonal antibody specific for Chlamydophila psittaci LPS
peqGold TriFast RNA isolation kit (PeqLab Biotechnologie GmbH, Erlangen, Germany). Twenty micrograms of
RNA was used for first strand cDNA synthesis by reverse
transcription using the oligo (dT)12–18 primer and SuperScript II reverse transcriptase (Invitrogen GmbH,
Karlsruhe, Germany). The protocol and primer sets
described by Barbas III et al. (2001) were used for mouse
VLκ and VH gene amplification. The amplified products
were ligated by T/A cloning (TOPO-TA Cloning kit, Invitrogen), assembled into scFv by overlap extension polymerase chain reaction (PCR) using the primer set and
conditions of Barbas III et al. (2001) and cloned into
pComb 3XSS after SfiI digest. For the expression of soluble protein, scFv S69-4 was cloned into pSJF8 (Narang et
al., 1987) after amplification from pComb3 XSS using the
primers 5′-GGGGGGAATTCATGAAAAAGACAGCTA
TCGCGATTGC-3′ (5′ reverse) and 5′-GGGGGATCC
CTTCAAATCTTCCTCACTGATTAGCTTCTGTTCA
GATCTTGAGGAGACGGTGACTGAGGT-3′ (3′ forward). The construct was cloned by EcoRI and BamHI
restriction sites (underlined) introducing a c-myc tag at 3′
and replacing the hemagglutinin tag present in pComb3
XSS. Soluble scFv was expressed in E. coli TG-1 as
described (Müller-Loennies et al., 2000) and extracted from
the periplasm of cultures grown over a period of 5 days at
24°C using polymyxin B as follows. The pelleted cells were
resuspended in PBS, pH 7.2, and polymyxin B sulfate
(Fluka, Buchs SG, Switzerland) was added to a final concentration of 0.1 mg/mL. After stirring for 4 h in the cold,
the cells were pelleted and the supernatant collected. This
procedure was repeated three times with further addition of
polymyxin B at the second time. Soluble scFv was purified
from the supernatant by immobilized metal ion affinity
chromatography (IMAC) on HiTrap affinity columns
(Amersham Biosciences, Uppsala, Sweden). Monomeric
scFv was obtained by fast protein liquid chromatography
on a HiLoad Superdex HR75 16/60 pg column (Amersham
Biosciences). Soluble scFv was also identified in the culture
supernatant and obtained by IMAC from (NH4)2SO4 precipitates. In total, a yield of 2 mg of purified protein per
liter of E. coli TG-1 culture was obtained.
SPR
Analyses were performed with a BIACORE 3000 instrument
(Biacore). Either mAb S69-4 or scFv was immobilized on
CM5 sensor chips (Biacore, Uppsala, Sweden) at a surface
density of ∼13,000 and 3500 RU for mAb and scFv, respectively, using the amine coupling kit from Biacore. The surface
with immobilized scFv was unstable over time and was therefore freshly prepared for each set of experiments. Analyses
were carried out at 25°C in 10 mM Hepes, pH 7.4, containing
3 mM ethylenediaminetetraacetic acid (EDTA), 0.005% P-20,
and 150 or 300 mM NaCl. Surface regeneration was not necessary. Data were evaluated using the BIAevaluation 3.0 software (Biacore). Owing to the instability of the protein on the
surface, the maximum RU available for binding was low. A
low affinity of mAb S69-4 toward all antigens and a large bulk
change because of differences in buffer composition prevented
a reliable determination of rate constants. Therefore, KD values were determined from binding analysis at steady state.
Acknowledgments
We thank U. Agge, V. Susott, I. von Cube, S. Cohrs, N. Harmel
(Research Center Borstel), and T. Hirama (NRC) for technical assistance. This work was supported by the Deutsche
Forschungsgemeinschaft grant SFB 470, A1 (S.G.), and C1
(H.B. and L.B.) and the Austrian Science Fund FWF grant
13843 and 17407 to P.K.
Abbreviations
BSA, bovine serum albumin; CMP, cytosine monophosphate; E. coli-Cps, lipopolysaccharide isolated from E. coli
F515 expressing the Kdo transferase of C. psittaci; E. coliCtr, lipopolysaccharide isolated from E. coli F515 expressing the Kdo transferase of C. trachomatis; EB, elementary
body; ELISA, enzyme-linked immunosorbent assay; FITC,
fluorescein isothiocyanate; GlcNAc, 2-amino-2-deoxy-glucopyranose; HRP, horseradish peroxidase; IFT, immunofluorescence test; Ig, immunoglobulin; IMAC, immobilized
metal ion affinity chromatography; Kdo, 3-deoxy-α-Dmanno-oct-2-ulopyranosonic acid; LPS, lipopolysaccharide; mAb, monoclonal antibody; PBS, phosphate-buffered
saline; scFv, single chain variable fragment; SPR, surface
plasmon resonance; TLC, thin-layer chromatography.
References
Al Lazikani, B., Lesk, A.M., and Chothia, C. (1997) Standard conformations for the canonical structures of immunoglobulins. J. Mol. Biol.,
273, 927–948.
Barbas III, C.F., Burton, D.R., Scott, J.K., and Silverman, G.J. (2001)
Phage Display: A Laboratory Manual. Cold Spring Harbor Laboratory
Press, New York.
Belunis, C.J., Mdluli, K.E., Raetz, C.R.H., and Nano, F.E. (1992) A novel
3-deoxy-D-manno-octulosonic acid transferase from Chlamydia trachomatis required for expression of the genus-specific epitope. J. Biol.
Chem., 267, 18702–18707.
Bode, C.E., Brabetz, W., and Brade, H. (1998) Cloning and characterization of 3-deoxy-D-manno-oct-2-ulosonic acid (Kdo) transferase genes
(kdtA) from Acinetobacter baumannii and Acinetobacter haemolyticus. Eur. J. Biochem., 254, 404–412.
Brabetz, W., Lindner, B., and Brade, H. (2000) Comparative analyses of
secondary gene products of 3-deoxy-D-manno-oct-2-ulosonic acid
transferases from Chlamydiaceae in Escherichia coli K-12. Eur. J. Biochem., 267, 5458–5465.
Brade, H., Brade, L., and Nano, F.E. (1987) Chemical and serological
investigations on the genus-specific lipopolysaccharide epitope of
Chlamydia. Proc. Natl. Acad. Sci. U. S. A., 84, 2508–2512.
Brade, L., Holst, O., Kosma, P., Zhang, Y.X., Paulsen, H., Krausse, R.,
and Brade, H. (1990) Characterization of murine monoclonal and
murine, rabbit, and human polyclonal antibodies against chlamydial
lipopolysaccharide. Infect. Immun., 58, 205–213.
Brade, L., Brunnemann, H., Ernst, M., Fu, Y., Holst, O., Kosma, P.,
Näher, H., Persson, K., and Brade, H. (1994) Occurrence of antibodies
against chlamydial lipopolysaccharide in human sera as measured by
ELISA using an artificial glycoconjugate antigen. FEMS Immunol.
Med. Microbiol., 8, 27–42.
Brade, L., Rozalski, A., Kosma, P., and Brade, H. (2000) A monoclonal antibody recognizing the 3-deoxy-α-D-manno-oct-2ulosonic acid (Kdo) trisaccharide αKdo(2→4)αKdo(2→4)αKdo of
Chlamydophila psittaci 6BC lipopolysaccharide. J. Endotoxin Res.,
6, 361–368.
Brade, L., Gronow, S., Wimmer, N., Kosma, P., and Brade, H. (2002)
Monoclonal antibodies against 3-deoxy-α-D-manno-oct-2-ulosonic
195
S. Müller-Loennies et al.
acid (Kdo) and D-glycero-α-D-talo-oct-2-ulosonic acid (Ko). J. Endotoxin Res., 8, 357–364.
Byrne, G.I. and Ojcius, D.M. (2004) Chlamydia and apoptosis: life and
death decisions of an intracellular pathogen. Nat. Rev. Microbiol., 2,
802–808.
Campbell, L.A. and Kuo, C.C. (2004) Chlamydia pneumoniae – an infectious risk factor for atherosclerosis? Nat. Rev. Microbiol., 2, 23–32.
Chothia, C. and Lesk, A.M. (1987) Canonical structures for the hypervariable regions of immunoglobulins. J. Mol. Biol., 196, 901–917.
Chothia, C., Lesk, A.M., Gherardi, E., Tomlinson, I.M., Walter, G.,
Marks, J.D., Llewelyn, M.B., and Winter, G. (1992) Structural repertoire of the human VH segments. J. Mol. Biol., 227, 799–817.
Everett, K.D. (2000) Chlamydia and Chlamydiales: more than meets the
eye. Vet. Microbiol., 75, 109–126.
Fu, Y., Baumann, M., Kosma, P., Brade, L., and Brade, H. (1992) A synthetic glycoconjugate representing the genus-specific epitope of
chlamydial lipopolysaccharide exhibits the same specificity as its natural counterpart. Infect. Immun., 60, 1314–1321.
Furukawa, K., Shirai, H., Azuma, T., and Nakamura, H. (2001) A role of
the third complementarity-determining region in the affinity maturation of an antibody. J. Biol. Chem., 276, 27622–27628.
Griffiths, P.C., Plater, J.M., Horigan, M.W., Rose, M.P., Venables, C.,
and Dawson, M. (1996) Serological diagnosis of ovine enzootic abortion by comparative inclusion immunofluorescence assay, recombinant
lipopolysaccharide enzyme-linked immunosorbent assay, and complement fixation test. J. Clin. Microbiol., 34, 1512–1518.
Gronow, S., Brabetz, W., and Brade, H. (2000) Comparative functional
characterization in vitro of heptosyltransferase I (WaaC) and II
(WaaF) from Escherichia coli. Eur. J. Biochem., 267, 6602–6611.
Heine, H., Müller-Loennies, S., Brade, L., Lindner, B., and Brade, H.
(2003) Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC. Eur. J. Biochem., 270, 440–450.
Holst, O., Broer, W., Thomas-Oates, J.E., Mamat, U., and Brade, H.
(1993) Structural analysis of two oligosaccharide bisphosphates isolated from the lipopolysaccharide of a recombinant strain of
Escherichia coli F515 (Re chemotype) expressing the genus-specific
epitope of Chlamydia lipopolysaccharide. Eur. J. Biochem., 214,
703–710.
Holst, O., Bock, K., Brade, L., and Brade, H. (1995) The structures of oligosaccharide bisphosphates isolated from the lipopolysaccharide of a
recombinant Escherichia coli strain expressing the gene gseA [3-deoxyD-manno-octulopyranosonic acid (Kdo) transferase] of Chlamydia
psittaci 6BC. Eur. J. Biochem., 229, 194–200.
Kosma, P. (1999) Chlamydial lipopolysaccharide. Biochim. Biophys. Acta,
1455, 387–402.
Kosma, P., Reiter, A., Hofinger, A., Brade, L., and Brade, H. (2000)
Synthesis of neoglycoproteins containing Kdo epitopes specific for
Chlamydophila psittaci lipopolysaccharide. J. Endotoxin. Res., 6, 57–69.
Lee, R.T. and Lee, Y.C. (1974) Synthesis of 3-(3-aminoethyl-thio) propyl
glycosides. Carbohydr. Res., 37, 193–201.
Löbau, S., Mamat, U., Brabetz, W., and Brade, H. (1995) Molecular cloning, sequence analysis, and functional characterization of the
lipopolysaccharide biosynthetic gene kdtA encoding 3-deoxy-α-Dmanno-octulosonic acid transferase of Chlamydia pneumoniae strain
TW-183. Mol. Microbiol., 18, 391–399.
196
MacLennan, I.C., Liu, Y.J., and Johnson, G.D. (1992) Maturation and
dispersal of B-cell clones during T cell-dependent antibody responses.
Immunol. Rev., 126, 143–161.
Mamat, U., Baumann, M., Schmidt, G., and Brade, H. (1993a) The genusspecific lipopolysaccharide epitope of Chlamydia is assembled in
C. psittaci and C. trachomatis by glycosyltransferases of low homology.
Mol. Microbiol., 10, 935–941.
Mamat, U., Baumann, M., Schmidt, G., and Brade, H. (1993b) The genusspecific lipopolysaccharide epitope of Chlamydia is assembled in
C. psittaci and C. trachomatis by glycosyltransferases of low homology.
Mol. Microbiol., 10, 935–941.
Martin, A.C. (1996) Accessing the Kabat antibody sequence database by
computer. Proteins, 25, 130–133.
Morea, V., Tramontano, A., Rustici, M., Chothia, C., and Lesk, A.M.
(1998) Conformations of the third hypervariable region in the VH
domain of immunoglobulins. J. Mol. Biol., 275, 269–294.
Moulder, J.W. (1991) Interaction of Chlamydiae and host cells in vitro.
Microbiol. Rev., 55, 143–190.
Müller-Loennies, S., MacKenzie, C.R., Patenaude, S.I., Evans, S.V.,
Kosma, P., Brade, H., Brade, L., and Narang, S. (2000) Characterization of high affinity monoclonal antibodies specific for chlamydial
lipopolysaccharide. Glycobiology, 10, 121–130.
Müller-Loennies, S., Grimmecke, D., Brade, L., Lindner, B., Kosma, P.,
and Brade, H. (2002) A novel strategy for the synthesis of neoglycoconjugates from deacylated deep rough lipopolysaccharides. J. Endotoxin. Res., 8, 295–305.
Nano, F.E. and Caldwell, H.D. (1985) Expression of the chlamydial
genus-specific lipopolysaccharide epitope in Escherichia coli. Science,
228, 742–744.
Narang, S.A., Yao, F.L., Michniewicz, J.J., Dubuc, G., Phipps, J., and
Somorjai, R.L. (1987) Hierarchical strategy for protein folding and
design: synthesis and expression of T4 lysozyme gene and two putative
folding mutants. Protein Eng., 1, 481–485.
Nguyen, H.P., Seto, N.O., MacKenzie, C.R., Brade, L., Kosma, P., Brade, H.,
and Evans, S.V. (2003) Germline antibody recognition of distinct
carbohydrate epitopes. Nat. Struct. Biol., 10, 1019–1025.
Nurminen, M., Leinonen, M., Saikku, P., and Mäkelä, P.H. (1983) The
genus specific antigen of Chlamydia: resemblance to the lipopolysaccharide of enteric bacteria. Science, 220, 1279–1281.
Rozalski, A., Brade, L., Kosma, P., Appelmelk, B.J., Krogmann, C., and
Brade, H. (1989) Epitope specificities of murine monoclonal and rabbit
polyclonal antibodies against enterobacterial lipopolysaccharides of the
Re chemotype. Infect. Immun., 57, 2645–2652.
Rund, S., Lindner, B., Brade, H., and Holst, O. (1999) Structural analysis
of the lipopolysaccharide from Chlamydia trachomatis serotype L2.
J. Biol. Chem., 274, 16819–16824.
Rund, S., Lindner, B., Brade, H., and Holst, O. (2000) Structural analysis
of the lipopolysaccharide from Chlamydophila psittaci strain 6BC. Eur.
J. Biochem., 267, 5717–5726.
Shirai, H., Kidera, A., and Nakamura, H. (1996) Structural classification
of CDR-H3 in antibodies. FEBS Lett., 399, 1–8.
Shirai, H., Kidera, A., and Nakamura, H. (1999) H3-rules: identification
of CDR-H3 structures in antibodies. FEBS Lett., 455, 188–197.
Stähli, C., Staehelin, T., and Miggiano, V. (1983) Spleen cell analysis and
optimal immunization for high-frequency production of specific hybridomas. Methods Enzymol., 92, 26–36.