Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Glycobiology vol. 16 no. 3 pp. 184–196, 2006 doi:10.1093/glycob/cwj055 Advance Access publication on November 10, 2005 A monoclonal antibody against a carbohydrate epitope in lipopolysaccharide differentiates Chlamydophila psittaci from Chlamydophila pecorum, Chlamydophila pneumoniae, and Chlamydia trachomatis Sven Müller-Loennies1,3, Sabine Gronow1,3, Lore Brade3, Roger MacKenzie4, Paul Kosma5, and Helmut Brade2,3 3 Research Center Borstel, Leibniz Center for Medicine and Biosciences, Parkallee 22, D-23845 Borstel, Germany; 4Institute for Biological Sciences, National Research Council Canada, Ottawa, Ontario, Canada K1A 0R6; and 5Department of Chemistry, University of Natural Resources and Applied Life Sciences, A-1190 Vienna, Austria Received on August 9, 2005; revised on November 2, 2005; accepted on November 3, 2005 Lipopolysaccharide (LPS) of Chlamydophila psittaci but not of Chlamydophila pneumoniae or Chlamydia trachomatis contains a tetrasaccharide of 3-deoxy-␣-D-manno-oct-2-ulopyranosonic acid (Kdo) of the sequence Kdo(2®8)[Kdo(2®4)] Kdo(2®4)Kdo. After immunization with the synthetic neoglycoconjugate antigen Kdo(2®8)[Kdo(2®4)]Kdo(2®4) Kdo-BSA, we obtained the mouse monoclonal antibody (mAb) S69-4 which was able to differentiate C. psittaci from Chlamydophila pecorum, C. pneumoniae, and C. trachomatis in double labeling experiments of infected cell monolayers and by enzyme-linked immunosorbent assay (ELISA). The epitope specificity of mAb S69-4 was determined by binding and inhibition assays using bacteria, LPS, and natural or synthetic Kdo oligosaccharides as free ligands or conjugated to BSA. The mAb bound preferentially Kdo(2®8)[Kdo(2®4)]Kdo(2®4)Kdo(2®4) with a KD of 10 M, as determined by surface plasmon resonance (SPR) for the monovalent interaction using mAb or single chain Fv. Crossreactivity was observed with Kdo(2®4)Kdo(2®4) Kdo but not with Kdo(2®8)Kdo(2®4)Kdo, Kdo disaccharides in 2®4- or 2®8-linkage, or Kdo monosaccharide. MAb S69-4 was able to detect LPS on thin-layer chromatography (TLC) plates in amounts of <10 ng by immunostaining. Due to the high sensitivity achieved in this assay, the antibody also detected in vitro products of cloned Kdo transferases of Chlamydia. The antibody can therefore be used in medical and veterinarian diagnostics, general microbiology, analytical biochemistry, and studies of chlamydial LPS biosynthesis. Further contribution to the general understanding of carbohydrate-binding antibodies was obtained by a comparison of the primary structure of mAb S69-4 to that of mAb S45-18 of which the crystal structure in complex with its ligand has been elucidated recently (Nguyen et al., 2003, Nat. Struct. Biol., 10, 1019–1025). Key words: diagnostic/immunofluorescence/Kdo/ neoglycoconjugate 1 These 2 authors contributed equally to this work. To whom correspondence should be addressed; e-mail: [email protected] Introduction Bacteria of the genus Chlamydia are pathogenic, obligatory phagosomal intracellular parasites which cause acute and chronic diseases in animals and humans (Moulder, 1991; Byrne and Ojcius, 2004; Campbell and Kuo, 2004). Chlamydia trachomatis, Chlamydophila psittaci, Chlamydophila pneumoniae, and Chlamydophila pecorum are the most frequently found four species of the family Chlamydiaceae (Everett, 2000). Like other gram-negative bacteria, chlamydiae contain in their outer membrane lipopolysaccharide (LPS) which is an essential constituent and represents one of the major surface antigens of this microorganism. The LPS contains in its saccharide moiety an antigenic epitope shared by all chlamydiae (Nurminen et al., 1983), and thus, represents a family-specific antigen. This epitope is composed of a 3-deoxy-α-D-manno-oct-2-ulopyranosonic acid (Kdo) trisaccharide of the sequence Kdo(2→8)Kdo (2→4)Kdo (Brade et al., 1987) which is biosynthetically assembled by a single, trifunctional Kdo transferase (WaaA) (Belunis et al., 1992). This structure (Figure 1) has been determined first in the LPS of recombinant bacteria expressing chlamydial Kdo transferases (Holst et al., 1993, 1995; Brabetz et al., 2000) and has recently been confirmed on authentic LPS of C. trachomatis serotype L2 and E (Rund et al., 1999; Heine et al., 2003) and C. psittaci 6BC (Rund et al., 2000). At the time of uncontrolled import of exotic birds, particularly paroquets, psittacosis occurred as a severe atypical pneumonia in humans. C. psittaci 6BC was isolated from an infected paroquet and represents one of the reference strains. These studies have shown that the latter contains in addition to the Kdo(2→8)Kdo(2→4)Kdo trisaccharide, a Kdo(2→4)Kdo(2→4)Kdo trisaccharide, and in large amounts a branched Kdo(2→8)[Kdo(2→4)] Kdo(2→4)Kdo(2→4) tetrasaccharide which are all synthesized by a single Kdo transferase (Mamat et al., 1993a; Löbau et al., 1995). A monoclonal antibody (mAb) which binds to the latter oligosaccharide but not to the Kdo(2→8)Kdo(2→4)Kdo trisaccharide would allow the specific detection of C. psittaci in infected tissue by immunohistology and would thus be useful in veterinarian and medical diagnostics. Furthermore, it would allow the specific detection of even small amounts of Kdo oligosaccharides as they are generated in in vitro assays of Kdo transferases and thus facilitate their biochemical characterization. Such an antibody, named mAb S69-4, is described herein. We will show that mAb S69-4 has broad biomedical and biochemical applications. The comparison of mAb S69-4 with mAb S45-18, the structure of which has been © The Author 2005. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected] 184 Monoclonal antibody specific for Chlamydophila psittaci LPS appearance of serum antibodies against the immunizing antigen. The animal with the highest titer in enzyme-linked immunosorbent assay (ELISA) against the immunizing antigen was used for fusion. Spleen cells (1.2 × 108) were fused and seeded into 720 primary wells; 500 primary hybridomas were obtained (58%), 39 of which produced specific antibody. Screening was first done by ELISA using in parallel chlamydial elementary bodies (EB) of C. psittaci 6BC and 2→4/2→4Kdo3-BSA as antigen. Those with best reactivities were further tested by immunofluorescence test (IFT) using cells infected with C. trachomatis or C. psittaci 6BC. After three steps of limiting dilution, we have obtained mAb S69-4 (IgG1) which differentiated best between C. trachomatis and C. psittaci in IFT. Serological characterization of mAb S69-4 by ELISA Fig. 1. Chemical structures of the Kdo region in chlamydial LPS. The trisaccharide Kdo(2→8)Kdo(2→4)Kdo (A) occurs in all chlamydiae investigated so far and represents a family-specific epitope. The trisaccharide Kdo(2→4)Kdo(2→4)Kdo (B) and the tetrasaccharide Kdo(2→8)[Kdo(2→4)]Kdo(2→4)Kdo (C) have been detected only in Chlamydophila psittaci. R represents the lipid A moiety in LPS. determined by crystallography of the antibody Fab fragment in complex with ligand (Nguyen et al., 2003), also contributes to the general understanding of carbohydratebinding antibodies. Results Immunization of mice and preparation of mAbs BALB/c mice were successfully immunized with Kdo4-BSA (for abbreviations see Tables I and VI), as shown by the The antibody was tested against neoglycoconjugate antigens by ELISA checkerboard titrations using antigen concentrations between 3.2 and 100 pmol/mL to coat the plates; the results are shown in Figure 2. The antibody bound to 2→4/2→4Kdo3-BSA and Kdo4-BSA with comparable affinity (Figure 2E and F). Very weak binding was observed with 2→4Kdo2-BSA and 2→8Kdo2-BSA, and 2→8/2→4Kdo3-BSA (Figure 2B–D) only when high concentrations of antibody (>250 ng/mL) and antigen (>50 pmol/mL) were used. No binding to Kdo-BSA was observed (Figure 2A) even at highest antibody and antigen concentrations. The antibody was also tested against BSA glycoconjugates containing the 4′-monophosphoryl derivatives of deacylated C. psittaci LPS. MAb S69-4 did not bind 2→8/2→4Kdo3-GlcNAc2-4P-BSA (Figure 3C), but reacted equally well with 2→4/2→4Kdo3-GlcNAc2-4PBSA (Figure 3B) and Kdo4-GlcNAc2-4P-BSA (Figure 3A). In further experiments, it was shown by ELISA that mAb S69-4 bound to isolated LPS (Table II) and to whole bacteria (Table III). Finally, we performed inhibition experiments using free oligosaccharides as haptenic inhibitors in ELISA of S69-4 with Kdo4-BSA as solid-phase antigen. Kdo-allyl, 2→4Kdo2-allyl, and 2→8/2→4Kdo3-allyl did not inhibit mAb S69-4, whereas 2→4/2→4Kdo3-allyl, Kdo4-allyl, and Kdo4-GlcNAc2-P2 resulted in 50% inhibition at concentrations of 4.4, 1.7, and 2.1 μM, respectively (Table IV). IFT We were interested to see whether mAb S69-4 could be applied in human and veterinarian medicine for the detection of chlamydial inclusions in tissue culture and in histological samples from patients with chlamydial infections and tested mAb S69-4 in double labeling experiments. Cell monolayers were infected with C. psittaci, C. pneumoniae, or C. trachomatis and then incubated with mAb S69-4 (IgG1) followed by detection with horseradish peroxidaseconjugated (HRP-conjugated) second antibody. In a second step, the cell monolayers were incubated with mAb S5-10 (IgG3) recognizing 2→8/2→4Kdo3 present in all chlamydiae and stained using a fluorescein isothiocyanateconjugated (FITC-conjugated) second antibody. As expected, all three samples were stained with mAb S5-10 (Figure 4A-C), but only the monolayer infected with C. psittaci was stained 185 S. Müller-Loennies et al. Table I. Oligosaccharides used in this study Oligosaccharide structures Abbreviation Synthetic oligosaccharides αKdo(2→OCH2-CH=CH2 Kdo-allyl αKdo(2→4)αKdo(2→OCH2-CH=CH2 2→4Kdo2-allyl αKdo(2→8)αKdo(2→OCH2-CH=CH2 2→8Kdo2-allyl αKdo(2→4)αKdo(2→4)αKdo(2→OCH2-CH=CH2 2→4/2→4Kdo3-allyl αKdo(2→8)αKdo(2→4)αKdo(2→OCH2-CH=CH2 2→8/2→4Kdo3-allyl αKdo(2→8)[αKdo(2→4)]αKdo(2→4)αKdo(2→OCH2-CH=CH2 Kdo4-allyl Oligosaccharides isolated from LPS αKdo(2→8)[αKdo(2→4)]αKdo(2→4)αKdo(2→6)βGlcNAc-4P(1→6)αGlcNAc-1P Kdo4-GlcNAc2-P2 αKdo(2→4)αKdo(2→4)αKdo(2→6)βGlcNAc-4P(1→6)αGlcNAc 2→4/2→4Kdo3-GlcNAc2-4P αKdo(2→8)αKdo(2→4)αKdo(2→6)βGlcNAc-4P(1→6)αGlcNAc 2→8/2→4Kdo3-GlcNAc2-4P by mAb S69-4 (Figure 4D). Each inclusion which was stained with mAb S5-10 was also detected with mAb S69-4 (Figure 4A and D) indicating that the epitope recognized by mAb S69-4 was constantly expressed in C. psittaci. To see whether other strains of the genus Chlamydophila were detected with mAb S69-4, we tested 11 isolates from infected animals in IFT and in ELISA using purified formalinized EB. As summarized in Table V, all four strains of C. psittaci were positive for mAb S69-4, whereas C. pecorum and the mouse biovar of C. trachomatis were negative. The weakly positive result of C. pecorum LW 613-17 was likely to be false positive because the EB of this strain did not react in ELISA and the second strain of bovine C. pecorum (strain LW 623-11) was negative. In conclusion, we have shown that mAb S69-4 can be used in immunohistology to reliably identify C. psittaci at the species level. Detection of LPS with mAb S69-4 by thin-layer chromatography immunostaining Characterization of in vitro reaction products of enzymatic reactions is a difficult task in general but particularly true for Kdo transferases due to the heterogeneous reaction mixture and the low amounts of products. We have generated a whole set of mAb which bind biosynthetic precursors of the early LPS biosynthesis and have shown previously that antibodies are useful tools to identify LPS molecules after their chromatographic separation (Löbau et al., 1995; Brade et al., 2002). Therefore, we tested mAb S69-4 in immunostaining of thin-layer chromatography (TLC) plates on which various LPS were separated. For comparison, we have included mAb S67-27 and mAb S25-23 with known specificities. The results with O-deacylated LPS of recombinant Escherichia coli strains expressing the Kdo transferase WaaA of C. trachomatis (lane 1), C. pneumoniae (lane 2), or C. psittaci (lane 3) are shown in Figure 5. All three LPS exhibited one band (band a) which stained with mAb S25-23 but which was not labeled by mAb S69-4 and thus contained the structure 2→8/2→4Kdo3. Due to the presence of unsubstituted terminal Kdo, these bands also reacted 186 with mAb S67-27. The LPS synthesized by WaaA of C. psittaci (lane 3) showed two additional bands of higher polarity which according to earlier structural studies (Holst et al., 1995) contained 2→4/2→4Kdo3 (band b) and Kdo4 (band c). The closely related LPS structures containing 2→4/2→4Kdo3 and 2→8/2→4Kdo3 were well resolved by TLC and differentiated by mAb S69-4 and mAb S25-23, respectively. The usefulness of TLC combined with immunostaining is further illustrated in Figure 6 where LPS and O-deacylated LPS are compared. Although the heterogeneity of LPS is much higher than that of O-deacylated LPS, the results can be readily interpreted when antibodies of defined specificity are used. For simplicity, only the samples of E. coli expressing WaaA of C. trachomatis (lanes 1 and 2) and C. psittaci (lanes 3 and 4) are shown. It is seen that mAb S69-4 bound only to the LPS and O-deacylated LPS of E. coli-Cps and that these bands were not recognized by mAb S25-23. Figure 7 shows the results of TLC immunostaining when isolated chlamydial LPS of C. psittaci (lanes 1–3) and C. trachomatis (lanes 4–6) were used. Staining with mAb S67-27 showed that both LPS were separated into three major bands, two of which were also stained with mAb S25-23 (bands a and b in Figure 7). In the case of C. psittaci LPS, two bands were stained with mAb S69-4 (band b and c in Figure 7). The two bands which stained with mAb S25-23 must have contained the 2→8/2→4-linked Kdo trisaccharide and represented the main LPS fractions containing four and five fatty acids, as shown earlier by mass spectrometry (Rund et al., 1999). The results also demonstrated the sensitivity of this approach since <10 ng could be detected. Finally, we used mAb S69-4 to detect in vitro products of cloned Kdo transferases. Figure 8 shows the results obtained when Kdo transferases of C. pneumoniae (lane 1), C. psittaci (lane 2), E. coli (lane 3), or C. trachomatis (lane 4) were incubated with synthetic lipid A precursor 406 as acceptor and a Kdo-cytosine monophosphate (CMP) generating system. Staining with S25-23 confirmed that WaaA of E. coli was unable to synthesize a structure recognized by this antibody, whereas mAb S69-4 reacted only with products from C. psittaci WaaA. Monoclonal antibody specific for Chlamydophila psittaci LPS Fig. 2. Binding of mAb S69-4 to synthetic Kdo oligosaccharides conjugated to BSA. ELISA plates were coated with graded concentrations of neoglycoconjugates corresponding to 100 (●), 50 (▲), 25 (■), 12.5 (䊊), 6.3 (䉭), and 3.2 (ⵧ) pmol of ligand per mL using 50 μL per well and reacted with mAb S69-4 at the concentrations indicated on the abscissa. The antigens were Kdo-BSA (A), Kdo(2→4)Kdo-BSA (B), Kdo(2→8)Kdo-BSA (C), Kdo(2→8)Kdo(2→4)Kdo-BSA (D), Kdo(2→4)Kdo(2→4)Kdo-BSA (E), and Kdo(2→8)[Kdo(2→4)]Kdo(2→4)Kdo-BSA (F).Values given are the mean of quadruplicates with confidence values not exceeding 10%. Fig. 3. Binding of mAb S69-4 to deacylated LPS conjugated to BSA. ELISA plates were coated with graded concentrations of neoglycoconjugates corresponding to 100 (●), 50 (▲), 25 (■), 12.5 (䊊), 6.3 (䉭), and 3.2 (ⵧ) pmol of ligand per mL using 50 μL per well and reacted with mAb S69-4 at the concentrations indicated on the abscissa. The antigens were Kdo(2→8)[Kdo(2→4)]Kdo(2→4)Kdo(2→6)βGlcNAc-4P(1→6)αGlcNAc-BSA (A), Kdo(2→4)Kdo(2→4)Kdo(2→6)βGlcNAc-4P(1→6)αGlcNAc-BSA (B), and Kdo(2→8)Kdo(2→4)Kdo(2→6)βGlcNAc-4P(1→6)αGlcNAc (C). Values given are the mean of quadruplicates with confidence values not exceeding 10%. 187 S. Müller-Loennies et al. Table II. Reactivity of mAbs in ELISA using graded amounts of different LPS Final concentration (ng/mL) of indicated mAb yielding OD405 >0.2 Source of LPS Amount of antigen (ng/well) S69-4 S25-23 Chlamydia trachomatis L2 250 >1000 1 50 >1000 2 10 >1000 2 2 >1000 8 Chlamydophila psittaci 6BC E. coli-Ctr E. coli-Cps 250 4 8 50 8 8 10 16 16 2 125 63 250 >1000 1 50 >1000 2 10 >1000 4 2 >1000 16 250 16 16 50 32 32 10 63 63 2 125 250 Table III. Reactivity of mAbs in ELISA with graded amounts of bacteria as solid-phase antigens Final concentration (ng/mL) of indicated mAb yielding OD405 >0.2 Bacterial antigena Amount of antigen (μg/well) Chlamydia trachomatis L2 4 1000 2 2 1000 2 1 1000 2 4 4 4 2 4 4 1 8 8 4 500 8 Chlamydophila psittaci 6BC E. coli-Ctr E. coli-Cps S69-4 S25-23 2 1000 8 1 >2000 16 4 4 16 2 4 32 1 8 63 a Heat-inactivated E. coli bacteria or formalin-inactivated EBs were used to coat ELISA plates. 188 Table IV. Inhibition of mAb S69-4 with haptenic oligosaccharides Concentration (mM) of inhibitor yielding 50% inhibitionb Inhibitora Kdo 360 2→4-Kdo2 >200 2→8/2→4-Kdo3 >140 2→4/2→4-Kdo3 4.4 Kdo4 1.7 Kdo4-GlcNAc2-P2 2.1 aFor detailed structures see Table I. bKdo -BSA was used to coat ELISA 4 plates at a concentration of 100 pmol/mL. Single-chain variable fragments The genes encoding the variable domains of mAb S69-4 were cloned and expressed as single-chain variable fragments (scFv) to allow a sequence comparison with the two well characterized antibodies mAb S45-18 and mAb S25-2 which have been crystallized in complex with the antigen (Nguyen et al., 2003). The sequence alignment (Figure 9) showed that mAb S69-4 is highly homologous to the germline mAb S25-2, and the mAb S45-18 and major differences are confined to VH CDR3. S69-4 VL was identical to the VL domain of S25-2. Apart from the CDR3, the VH domain was identical to mAb S45-18 showing the same mutations away from the germline. Surface plasmon resonance (SPR)-binding studies of S69-4 and its scFv with various ligands revealed the dissociation constants (KD) of the immobilized antibody toward Kdo4-GlcNAc2-P2, 2→4/2→4Kdo3-GlcNAc2-P2, and 2→8/2→4Kdo3-GlcNAc2-P2 of 10, 20, and 200 μM, respectively. The interaction with the latter ligand could not be determined reliably at a NaCl concentration of 150 mM and was thus measured at 300 mM NaCl. Under all conditions tested, the interaction with 2→4Kdo2-GlcNAc2-P2 was too weak to allow the determination of the KD value. The same measurements with immobilized scFv instead of mAb S69-4 yielded binding constants of 10, 100, and 800 μM for Kdo4-GlcNAc2-P2, 2→4/2→4Kdo3-GlcNAc2-P2, and 2→8/2→4Kdo3-GlcNAc2-P2 at 150 mM NaCl, respectively. SPR thus revealed a 2- to 10-fold higher affinity of S69-4 for Kdo4-GlcNAc2-P2 over 2→4/2→4Kdo3-GlcNAc2P2 and an 20- to 80-fold reduced affinity toward the Kdotrisaccharide which contained 2→8-linked terminal Kdo. The ligand 2→4Kdo2-GlcNAc2-P2 was not recognized by mAb S69-4 and its scFv. Discussion Studies on the chemical and antigenic structure of chlamydial LPS have shown that it represents a surface-exposed antigen which contains in the whole family Chlamydiaceae a 2→8/2→4Kdo3 trisaccharide (for structures see Table I and Figure 1). MAbs against 2→8/2→4Kdo3 are used in human and veterinarian microbiology to identify chlamydiae at the family level. The applications are immunohistology Monoclonal antibody specific for Chlamydophila psittaci LPS Fig. 4. Detection of chlamydial inclusions in tissue culture by double labeling with mAb S5-10 and S69-4. Tissue culture monolayers were infected with Chlamydophila psittaci (A, D), Chlamydophila pneumoniae (B, E), or Chlamydia trachomatis (C, F) reacted with mAb S5-10 (IgG3) (A–C) and S69-4 (IgG1) (D–F) and developed with second antibodies conjugated to FITC or HRP, respectively (See Materials and methods). and identification of chlamydial inclusions in tissue culture used for the isolation of chlamydiae from clinical specimen. In addition, defined oligosaccharides representing the familyspecific epitope as obtained by degradation of LPS or by chemical synthesis are used as antigens to detect antibodies against chlamydial LPS in serum samples from animals or men (Brade et al., 1994; Griffiths et al., 1996). The species C. psittaci contains in addition a 2→4/ 2→4Kdo3 trisaccharide and a Kdo4-branched tetrasaccharide (Holst et al., 1995; Brabetz et al., 2000; Rund et al., 2000). Antibodies which bind 2→4/2→4Kdo3 and Kdo4 but not 2→8/2→4Kdo3 would (1) allow the identification of C. psittaci, (2) be a useful tool to detect individual LPS species in analytical biochemistry and in enzymology of Kdo transferases and (3) contribute to the general understanding of antibody-carbohydrate recognition. We have obtained such an antibody, mAb S69-4, upon immunization of mice with a synthetic neoglycoconjugate containing the branched Kdo4 tetrasaccharide. To elucidate the specificity of mAb S69-4 in detail, we have measured its reactivity with a panel of neoglycoconjugates containing LPS-related synthetic and natural oligosaccharides. The antibody bound with highest affinity to those structures containing the branched Kdo4 tetrasaccharide or the 2→4/2→4Kdo3 trisaccharide. To demonstrate that the epitope recognized by mAb S69-4 was also accessible in LPS, other serological assays were used. When isolated LPS of C. trachomatis and C. psittaci 6BC or LPS of recombinant E. coli strains expressing the Kdo transferase of either chlamydial strain were used as antigens in ELISA-binding assays; the results were fully in accordance with those obtained with the artificial neoglycoconjugates. The results obtained by direct-binding assays were confirmed by inhibition experiments using structurally defined oligosaccharides as inhibitors. Even when bacteria or chlamydial EB were used as antigens in ELISA, the specificity of the reaction of mAb S69-4 was not diminished. Finally, double labeling experiments of chlamydial inclusions in tissue culture showed that mAb S69-4 could differentiate C. psittaci from C. trachomatis and C. pneumoniae (Figure 4). When we tested by IFT and ELISA 11 isolates of animal origin, comprising the mouse and porcine biovar of C. trachomatis, four C. psittaci and five C. pecorum strains, we found that only those strains classified as C. psittaci gave a positive reaction. We were not in the position to do other experiments than those summarized in Table V because we do not have isolated LPS nor have the Kdo transferase of any C. pecorum strain been cloned. Nevertheless, this is good evidence that C. pecorum LPS does not contain the epitope recognized by mAb S69-4. It will be interesting to know the sequence of the Kdo transferase gene of C. pecorum to learn how similar it is to those of the other known chlamydial Kdo transferases and to learn about the chemical structure of C. pecorum LPS. We have then asked whether mAb S69-4 could be used for the detection of individual molecular LPS species after separation by TLC. We have therefore performed immunostaining with isolated LPS and O-deacylated LPS from recombinant E. coli (Figures 5 and 6) or Chlamydia (Figure 7) after TLC. Using a staining protocol without fixation of the TLC plate, we could detect <10 ng in an individual band. This allowed us to apply as little as 50–500 ng of LPS which despite being highly heterogeneous could be separated into distinct bands. Owing to the high sensitivity achieved under these conditions, the antibody could be used to detect in vitro products of Kdo transferases (Figure 8). The results obtained confirmed the previous notion (Brabetz et al., 2000) that the cloned WaaA of C. trachomatis and C. pneumoniae are unable to generate the branched Kdo4. When antibodies are available or can be generated against individual enzymatic products, this relatively simple method already provides much information on in vitro products 189 S. Müller-Loennies et al. Table V. Detection of chlamydial EB in infected monolayers by mAb S69-4 in IFT and in ELISA Result by Strain Serovar Species IFT ELISAa LW613-17 2 Chlamydophila pecorum (bovine) Weak positive Negative LW623-11 2 Chlamydophila pecorum (bovine) Negative Negative 66-P-130-14 3 Chlamydophila pecorum Negative Negative S-45-17 5 Chlamydia trachomatis (porcine biovar) Negative Negative 1708-11 6 Chlamydophila pecorum (porcine biovar) Negative Negative Chlamydia trachomatis (mouse biovar) Negative Negative Mouse pneumonitis 64-H-281 8 Chlamydophila psittaci (guinea pig) Positive Positive Feline pneumonitis 7 Chlamydophila psittaci Positive Not done Chlamydophila psittaci (serovar B from bovine abortion) Positive Positive Chlamydophila pecorum (ovine isolate) Negative Negative Chlamydophila psittaci (cockatiel isolate) Positive Positive 98-18524/2 JP-I-751-5 Avian 96LSU-Coct 9 Not done, concentration of EB suspension too low. aNegative results are those giving an OD of <0.1 with mAb 69-4 even at the highest antigen concentration and an OD >0.2 with mAb 25-23 even at the lowest antigen concentration (Materials and methods). Fig. 5. Characterization of O-deacylated LPS from recombinant Escherichia coli expressing the Kdo transferase WaaA from Chlamydophila trachomatis, Chlamydophila pneumoniae, or Chlamydophila psittaci using mAbs. Isolated O-deacylated LPS (2 μg each) of E. coli-Ctr (lane 1), E. coli-Cpn (lane 2), or E. coli-Cps (lane 3) were separated by TLC and stained with mAb S67-27 recognizing a single Kdo residue (Brade et al., 2002), mAb S25-23 recognizing αKdo-(2→8)-αKdo-(2→4)-Kdo trisaccharide (Fu et al., 1992), or mAb S69-4 (this study). For the labeling of bands (a, b, and c), see text. Fig. 6. Comparison of LPS and O-deacylated LPS from recombinant Escherichia coli expressing Kdo transferase WaaA from Chlamydophila trachomatis, Chlamydophila pneumoniae, or Chlamydophila psittaci using mAbs. Isolated LPS (100 ng each) or O-deacylated LPS (500 ng each) of E. coli-Ctr (lanes 1 and 2) or E. coli-Cps (lanes 3 and 4) were separated by TLC and stained with mAb A20 recognizing a single Kdo residue (Brade et al., 2002), mAb S25-23 recognizing αKdo-(2→8)-αKdo-(2→4)-Kdo trisaccharide (Fu et al., 1992), or mAb S69-4 (this study). generated by glycosyltransferases and will facilitate the biochemical characterization of such enzymes. Furthermore, this approach helps to decide which product should be purified for further analyses by mass spectrometry or nuclear magnetic resonance (NMR). Recently, crystal structures of the mAb S45-18 in complex with 2→4/2→4Kdo3-GlcNAc2-P2 and S25-2 in complex with 2-O-allyl derivatives of Kdo, 2→8Kdo2, 2→4Kdo2, and 2→8/2→4Kdo3 have been described at high resolution and revealed the characteristics of an antibody combining site which is able to bind Kdo oligosaccharides (Nguyen et al., 2003). We have therefore cloned the variable domains of S69-4 as scFv to compare their primary structures. MAb S69-4 was highly homologous to both mAb S25-2 and S45-18 with a combining site almost identical to the one described for mAb S45-18. Thus, amino acids from CDR1 and CDR3 of VL and all three CDR of VH contributed to complex formation and all amino acids involved in ligand binding by mAb S45-18 were conserved in mAb S69-4 (see following paragraph). The CDR3 loop of VH which is known to be an important factor determining antibody specificity was of the same length and showed conserved features important for the secondary structure (Shirai et al., 1996, 1999; Morea et al., 1998). The crystallized complex of S45-18 and 2→4/2→4Kdo3GlcNAc2-P2 identified ArgL30c, LysH52d, and ArgH52 as being involved in electrostatic interactions with the ligand. Additional hydrogen bonds are formed between the ligand and Asn30a, SerL91, TyrL92, ArgL95, and TyrH33. The same amino acids are present in mAb S69-4 at identical 190 Monoclonal antibody specific for Chlamydophila psittaci LPS Fig. 7. Characterization of LPS from Chlamydia trachomatis and Chlamydophila psittaci using mAbs. Isolated LPS of C. trachomatis (lanes 1–3) or C. psittaci (lanes 4–6) in amounts of 100 ng (lanes 1 and 4), 50 ng (lanes 2 and 5), or 20 ng (lanes 3 and 6) were separated by TLC and stained with mAbs as in Figure 5. For the labeling of bands (a, b, and c), see text and for abbreviations of E. coli strains see Materials and methods. Fig. 8. Detection of in vitro products of Kdo transferases of Escherichia coli and Chlamydia. Synthetic lipid A precursor 406 was reacted in vitro with a Kdo-CMP generating system and cloned Kdo transferases of Chlamydophila pneumoniae (lane 1), Chlamydophila psittaci (lane 2), E. coli (lane 3), or Chlamydia trachomatis (lane 4). Reaction products were separated by TLC and stained with mAbs as in Figure 6. positions (Figure 9). The bases of the CDR3 VH loops in both antibodies are formed on the N-terminal side by AlaH93, ArgH94, and AspH95 and on the C-terminal side by AlaH100b, MetH100c, and AspH100d. In the center of the loop, mAb S69-4 and S45-18 both contain PheH97 which has been shown in the crystal structure of S45-18 to be involved in stacking interactions with three 2→4-linked Kdo residues (Nguyen et al., 2003). In the same complex, AspH100a has been shown to be involved in hydrogen bonding the ligand mediated by a structured water molecule. The residues of the CDR3 VH loops in both antibodies form a kink which is stabilized by a hydrogen bond between MetH100c carbonyl and the TrpH101 side chain (Shirai et al., 1999). The loop is further stabilized by a salt bridge between ArgH94 and AspH100d which is commonly found in antibodies. This salt bridge is missing in mAb S25-2 leading to higher flexibility and adaptation of the loop to bind oligosaccharides which contain 2→8-linked Kdo-residues, such as 2→8/2→4Kdo3. PheH97 which has been shown to confer 2→4/2→4Kdo3 specificity to S45-18 is present at the same position in mAb S69-4. This residue was shown to restrict the conformational space available for the ligand, thus excluding 2→8-linked Kdo residues and provided hydrophobic stacking interactions with all three Kdo-residues of a 2→4/2→4Kdo3 ligand. Owing to the identical framework and the conserved amino acids which are important for the interaction, it seemed reasonable to assume a similar mode of binding. However, SPR analyses of the antibody and of its scFv (Figure 10) showed a relatively weak affinity of 10 μM (KD) in comparison with other Kdo-binding antibodies (Müller-Loennies et al., 2000) and S45-18 (KD, 20 nM, unpublished) which was approximately three orders of magnitudes lower. The main difference between mAb S45-18 and S69-4 is the composition of the four amino acid stretch surrounding PheH97 on either side. Because the CDR3 VH of mAb S45-18 is not stabilized by an extensive network of hydrogen bonds, it is difficult to predict how this amino acid change would affect the secondary structure of CDR3 VH in mAb S69-4. However, it is likely that a repositioning of PheH97 takes place which results in loss of affinity or binding. We have observed that purified mAb S69-4 and also its scFv are unstable over time without loss of solubility. It may therefore be that the observed instability is the loss of binding because of different conformational states of CDR3 VH. SPR analyses showed that only 10% on average of the immobilized scFv were accessible for binding. Despite identical amino acid sequences apart from CDR3 VH, such a loss of activity has not been observed previously for mAb S25-2 and S45-18. A higher flexibility of CDR3 VH in mAb S69-4 may result in a high entropic penalty paid upon ligand binding and thus may be responsible for the observed loss of overall affinity. Importantly, this could also be the reason for the improved distinction between the linear 2→4/2→4Kdo3 trisaccharide and the branched Kdo4 tetrasaccharide in comparison with mAb S45-18 contradicting the general notion that the maturation of the antibody response leads to increased specificity accompanied by an increase in affinity (MacLennan et al., 1992; Furukawa et al., 2001). Currently, we are characterizing the antibody response against the branched Kdo4 tetrasaccharide in more detail aiming at the identification of an antibody with higher specificity for the terminal branchpoint. It will be interesting to see whether antibodies do exist which display simultaneously high specificity and high affinity against this structure and, if so, how the antibody combining site will compare with S45-18 and S69-4. Materials and methods Bacteria and bacterial LPS Partially purified EB and LPS of C. trachomatis serotype L2 (Rund et al., 1999) and C. psittaci strain 6BC (Rund et al., 2000) were prepared, as described in the respective references. LPS containing Chlamydia-specific Kdo oligosaccharides were isolated from recombinant E. coli strains (re mutant F515) containing plasmid pFEN207 (Kdo transferase waaA of C. trachomatis [Nano and Caldwell, 1985]) or pUM140 (waaA of C. psittaci) (Holst et al., 1993, 1995; Mamat et al., 1993b) or pLM 110 (Löbau et al., 1995). These LPS are abbreviated as E. coli-Ctr, E. coli-Cps, and E. coli-Cpn, respectively. For ELISA, partially purified EB were inactivated with 0.02% formaldehyde and washed twice in phosphate-buffered saline (PBS); E. coli-Ctr and E. coli-Cps bacteria were heat inactivated (100°C, 1 h). Purified EB and cover slips with infected cell monolayers of various strains of C. psittaci and C. pecorum 191 S. Müller-Loennies et al. Fig. 9. Amino acid sequence alignment of VL and VH of mAbs S69-4, S45-18, and S25-2. The numbering of residues and assignment of CDR (shaded) was done according to studies by Chothia (Chothia and Lesk, 1987; Chothia et al., 1992; Al Lazikani et al., 1997) and Kabat (Martin, 1996) as described by Andrew C. Martin (University College London, UK, http://www.bioinf.org.uk/). and two strains of C. trachomatis of animal origin were kindly provided by J. Storz (Baton Rouge, LA). Kdo (thiobarbiturate assay) and is depicted in Table VI in nmol of ligand per mg of BSA. mAbs Synthetic and isolated oligosaccharides and neoglycoconjugate antigens All antigens used in this study are abbreviated according to Table I. The synthetic allyl glycosides were synthesized as described (Kosma, 1999; Kosma et al., 2000; references therein). The allyl glycosides R-OCH2-CH=CH2 were conjugated with cysteamine yielding R-O(CH2)3-S-(CH2)2NH3+, which were activated with thiophosgene into the isothiocyanate derivatives R-O(CH2)3-S-(CH2)2-N=C=S and then conjugated to BSA yielding R-O(CH2)3-S-(CH2)2NH-CS-NH-BSA, wherein R represents the glycosyl residue (Lee and Lee, 1974). Natural oligosaccharides were obtained from LPS of E. coli-Cps after deacylation and separation of the oligosaccharide mixture by high-performance anion exchange chromatography as described (Holst et al., 1993) and were conjugated to BSA as reported (Müller-Loennies et al., 2002; references therein). The amount of ligand present in the conjugates was determined by measuring the amount of protein (Bradford assay, Bio-Rad, Munich, Germany) and 192 BALB/c mice were immunized following a protocol described (Stähli et al., 1983). Mice (group of four) were injected on day 0 with Kdo4-BSA (50 μg) in PBS (125 μL) emulsified with an equal volume of Freund’s complete adjuvant. One aliquot (50 μL) was injected i.p., and four aliquots (50 μL each) were injected s.c. at four different sites. On day 28, again 50 μg of the antigen in PBS (50 μL) emulsified with an equal volume of Freund’s incomplete adjuvant were injected i.p. Seven days later, the mice bled from the tail vein, and the sera were tested for the presence of antibodies against the immunizing antigen. The mouse with the highest titer received three booster injections of 200 μg each in PBS on days 161, 162, and 163; the first one i.v., the last two i.p. Two days after the last injection, the animal was exsanguinated, and the spleen was removed. Spleen cells were prepared and fused according to conventional protocols. Hybridomas were screened by ELISA using 2→4/2→4Kdo3-BSA or EB of C. psittaci. Further screening was done by IFT. MAb S69-4 was identified as the most relevant clone; it was cloned thrice by limiting Monoclonal antibody specific for Chlamydophila psittaci LPS chlamydial LPS, mAb S67-27 (IgG1; Brade et al., 2002) and mAb A20 (IgM; Rozalski et al., 1989), recognizing both a single α-pyranosidically linked Kdo residue. All antibodies used in this study are listed in Table VII. ELISA using neoglycoconjugate antigens Fig. 10. Representative SPR data for the interaction of oligosaccharide with immobilized antibody. Sensorgram overlays showing the binding of 0.2–1000 μM 2→4/2→4Kdo3 to immobilized S69-4 scFv (A). Fitting of the equilibrium data to a steady-state model (B). Table VI. Neoglycoconjugates used in this study Neoglycoconjugatea Amount of ligand (nmol) per mg of conjugate Kdo-BSA 167 2→4Kdo2-BSA 136 2→8Kdo2-BSA 130 Neoglycoconjugates in carbonate buffer (50 mM, pH 9.2) were coated onto MaxiSorp microtiter plates (96-well, Ubottom, Nunc, Wiesbaden, Germany) at 4°C over night. Antigen solutions were adjusted to equimolar concentrations based on the amount of ligand present in the respective glycoconjugate. If not stated otherwise, 50 μL of volumes were used. Plates were washed twice in PBS supplemented with Tween 20 (0.05%, Bio-Rad) and thimerosal (0.01%, PBS-T) and were then blocked with PBS-T supplemented with casein (2.5%, PBS-TC) for 1 h at 37°C on a rocker platform followed by two washings. Appropriate antibody dilutions in PBS-TC supplemented with 5% BSA (PBS–TCB) were added and incubated for 1 h at 37°C. After two washings, peroxidase-conjugated goat anti-mouse IgG (heavy- and light-chain specific; Dianova, Hamburg, Germany) or IgM (μ-chain specific; Dianova) was added (both diluted 1:1000 in PBS–TCB), and incubation was continued for 1 h at 37°C. The plates were washed three times with PBS-T. Substrate solution was freshly prepared and was composed of azino-di3-ethylbenzthiazolinsulfonic acid (1 mg) dissolved in substrate buffer (0.1 M sodium citrate, pH 4.5; 1 mL) followed by the addition of hydrogen peroxide (25 μL of a 0.1% solution). After 30 min at 37°C, the reaction was stopped by the addition of aqueous oxalic acid (2%), and the plates were read by a microplate reader (Tecan Sunrise, Crailsheim, Germany) at 405 nm. Tests were run twice in quadruplicates with confidence values not exceeding 10%. For ELISA inhibition, serial 2-fold dilutions of inhibitor in PBS–TCB (30 μL) were mixed in V-shaped microtiter plates (Nunc) with an equal volume of antibody diluted in the same buffer to give an OD405 of 1.0 without the addition of inhibitor. After incubation (15 min, 37°C), 50 μL of the mixture were added to antigen-coated ELISA plates. Further steps were as described above. All measurements were done in duplicates. 2→4/2→4Kdo3-BSA 53 2→8/2→4Kdo3-BSA 82 ELISA using LPS antigens Kdo4-BSA 97 Kdo4-GlcNAc2-P2-BSA 92 When LPS was used as an antigen in ELISA, microtiter polyvinyl plates (96-well, Falcon 3911; Becton Dickinson, Heidelberg, Germany) were coated with LPS of varying concentration (2–250 ng/well) diluted in PBS (pH 7.2) and were incubated overnight at 4°C. PBS and PBS-containing solutions were supplemented with thimerosal (0.01%). Further incubation steps were performed at 37°C under gentle agitation. The coated plates were washed four times with PBS and were blocked for 1 h with PBS supplemented with casein (2.5%, Sigma, Munich, Germany; PBS-C; 200 μL per well). Serial dilutions of mAb diluted in PBS-C were subsequently added, and the mixture was incubated for 1 h at 37°C. After washing as described above, secondary antibodies diluted in PBS-C (same source and dilution as above) were added. After four washings in PBS, the following steps were done as described for ELISA using neoglycoconjugate antigens. 2→4/2→4Kdo3-GlcNAc2-4P-BSA 144 2→8/2→4Kdo3-GlcNAc2-4P-BSA 128 aFor chemical structures of glycosyl moieties see Table I. dilution, isotyped with a commercially available isotyper kit (Bio-Rad), and purified by affinity chromatography using an affinity support of AH-Sepharose 4B to which the ligand Kdo(2→8)[Kdo(2→4)]Kdo(2→4)Kdo(2→6)βGlcN-4P(1→6) αGlcN-1P was conjugated by the glutardialdehyde method. As controls served mAb S25-23 and mAb S5-10 (IgG1 and IgG3, respectively; Fu et al., 1992), both recognizing the family-specific epitope Kdo(2→8)Kdo(2→4)Kdo of 193 S. Müller-Loennies et al. Table VII. mAbs used in this study Antibody Isotype Immunogen Specificity Reference S69-4 IgG1 Kdo4-BSA LPS of Chlamydophila psittaci This study S25-23 IgG1 2→8/2→4Kdo3-GlcNAc-BSA Family-specific epitope of Chlamydiaceae Kdo4, 2→4/2→4Kdo3 Fu et al. (1992) 2→8/2→4Kdo3 S5-10 IgG3 Chlamydophila psittaci EB, formalin-inactivated Family-specific epitope of Chlamydiaceae S25-2 IgG1 2→8/2→4Kdo3-GlcNAc-BSA Family-specific epitope of Chlamydiaceae Brade et al. (1990) 2→8/2→4Kdo3 Fu et al. (1992) 2→8Kdo2 S45-18 IgG1 2→4/2→4Kdo3-BSA 2→4/2→4Kdo3, 2→4Kdo2 Brade et al. (2000) S67-27 IgG1 A20 IgM Kdo-BSA Terminal Kdo Brade et al. (2002) Salmonella enterica sv. Minnesota Re mutant R595 Terminal Kdo Rozalski et al. (1989) ELISA using bacterial antigens Microtiter plates (96-well, MaxiSorp, Nunc) were coated with chlamydial EB or E. coli bacteria in carbonate buffer (50 mM, pH 9.2) for 2 days at 4°C. Excess antigen was removed by two washing steps with PBS (200 μL/well) followed by blocking with PBS-C for 1 h at 37°C. After washing with PBS, purified mAb (2 μg/mL) in PBS supplemented with casein (2.5%) and BSA (5%) was added and incubated for 1 h at 37°C. After two washing steps with PBS, the addition of secondary antibodies and substrate was as described for ELISA using neoglycoconjugate antigens, but omitting Tween 20 from all buffers. For screening of various chlamydial strains, where no purified EB suspensions were available, four two-fold serial dilutions were tested. IFT and immunoperoxidase staining L929 and HL cells were grown in 96-well microtiter plates (Nunc). After reaching confluence, they were infected with C. trachomatis or C. psittaci (L929) or C. pneumoniae (HL) by centrifugation at 440 × g for 1 h at room temperature. After 48 h, the cells were fixed in methanol and stained by double labeling. Monolayers were first incubated with mAb S69-4 (undiluted supernatant), then with rabbit anti-mouse IgG1 (isotyper-Kit, Bio-Rad) and then developed with goat antirabbit IgG conjugated to HRP (1:50, Dianova) and 4-chloronaphtol as substrate; after washing, the monolayers were then incubated with mAb S5-10 (undiluted supernatant) and stained with FITC-conjugated goat anti-mouse IgG (1:50, Dianova). TLC and TLC immunostaining LPS were separated on silica gel 60 TLC plates with aluminum support (Merck, Darmstadt, Germany) with a solvent system of CHCl3/pyridine/88% aqueous formic acid/water (30:70:16:10, vol/vol/vol/vol). For TLC immunostaining, the following protocol without fixation of the plates was used. Where not stated otherwise, incubations were performed at room temperature on a rocking table. A tray was filled up to 3 cm with blocking buffer composed of 50 mM Tris–HCl, 200 mM NaCl, pH 7.4, supplemented with 5% nonfat dry milk or 3% BSA depending on the antibody 194 used. The plate was slowly dipped into the tray (note: if this step is done too quickly, air bubbles will come up in the silica layer followed by its destruction) and left for 1 h. The buffer was replaced by the same buffer containing appropriately diluted first antibody and left over night. Washing was done five times for 5 min each, after which HRP-conjugated goat anti-mouse IgG (heavy- and light-chain specific; Dianova) or IgM (μ-chain specific; Dianova), both diluted 1:1000 in blocking buffer, was added. Incubation was continued for 2 h followed by washing four times for 5 min each in 50 mM Tris–HCl, 200 mM NaCl, pH 7.4, and once in substrate buffer (0.1 M sodium citrate, pH 4.5). Bound antibody was then detected by incubation for 30 min in the dark without rocking with substrate solution (30 mL) which was freshly prepared and was composed of 25 mL of substrate buffer, 5 mL of 4-chloro-1-naphthol (3 mg/mL in MeOH) and hydrogen peroxide (10 μL of a 30% solution). The plates were washed four times for 30 s in water, removed from the tray, and immediately dried with a fan followed by thorough drying at 37°C. If not documented directly, plates were stored in the dark to avoid fading of the stain. Detection of LPS and in vitro products of cloned Kdo transferases in TLC Kdo transferases were obtained from cell lysates of recombinant Corynebacterium glutamicum containing plasmid pJKB15 (waaA of C. pneumoniae; Brabetz et al., 2000), pJKB16 (waaA of E. coli; (Bode et al., 1998), pJKB17 (waaA of C. psittaci; Brabetz et al., 2000), or pJKB18 (waaA of C. trachomatis; Brabetz et al., 2000). In vitro assays containing the respective Kdo transferase and a Kdo-CMP generating system were performed as described (Gronow et al., 2000). The products were separated by TLC and detected in TLC immunoblots with mAbs as reported (Gronow et al., 2000). Cloning of scFv 69-4 For cloning of VL and VH genes of mAb S69-4, total RNA was isolated from 1 × 107 hybridoma cells using the Monoclonal antibody specific for Chlamydophila psittaci LPS peqGold TriFast RNA isolation kit (PeqLab Biotechnologie GmbH, Erlangen, Germany). Twenty micrograms of RNA was used for first strand cDNA synthesis by reverse transcription using the oligo (dT)12–18 primer and SuperScript II reverse transcriptase (Invitrogen GmbH, Karlsruhe, Germany). The protocol and primer sets described by Barbas III et al. (2001) were used for mouse VLκ and VH gene amplification. The amplified products were ligated by T/A cloning (TOPO-TA Cloning kit, Invitrogen), assembled into scFv by overlap extension polymerase chain reaction (PCR) using the primer set and conditions of Barbas III et al. (2001) and cloned into pComb 3XSS after SfiI digest. For the expression of soluble protein, scFv S69-4 was cloned into pSJF8 (Narang et al., 1987) after amplification from pComb3 XSS using the primers 5′-GGGGGGAATTCATGAAAAAGACAGCTA TCGCGATTGC-3′ (5′ reverse) and 5′-GGGGGATCC CTTCAAATCTTCCTCACTGATTAGCTTCTGTTCA GATCTTGAGGAGACGGTGACTGAGGT-3′ (3′ forward). The construct was cloned by EcoRI and BamHI restriction sites (underlined) introducing a c-myc tag at 3′ and replacing the hemagglutinin tag present in pComb3 XSS. Soluble scFv was expressed in E. coli TG-1 as described (Müller-Loennies et al., 2000) and extracted from the periplasm of cultures grown over a period of 5 days at 24°C using polymyxin B as follows. The pelleted cells were resuspended in PBS, pH 7.2, and polymyxin B sulfate (Fluka, Buchs SG, Switzerland) was added to a final concentration of 0.1 mg/mL. After stirring for 4 h in the cold, the cells were pelleted and the supernatant collected. This procedure was repeated three times with further addition of polymyxin B at the second time. Soluble scFv was purified from the supernatant by immobilized metal ion affinity chromatography (IMAC) on HiTrap affinity columns (Amersham Biosciences, Uppsala, Sweden). Monomeric scFv was obtained by fast protein liquid chromatography on a HiLoad Superdex HR75 16/60 pg column (Amersham Biosciences). Soluble scFv was also identified in the culture supernatant and obtained by IMAC from (NH4)2SO4 precipitates. In total, a yield of 2 mg of purified protein per liter of E. coli TG-1 culture was obtained. SPR Analyses were performed with a BIACORE 3000 instrument (Biacore). Either mAb S69-4 or scFv was immobilized on CM5 sensor chips (Biacore, Uppsala, Sweden) at a surface density of ∼13,000 and 3500 RU for mAb and scFv, respectively, using the amine coupling kit from Biacore. The surface with immobilized scFv was unstable over time and was therefore freshly prepared for each set of experiments. Analyses were carried out at 25°C in 10 mM Hepes, pH 7.4, containing 3 mM ethylenediaminetetraacetic acid (EDTA), 0.005% P-20, and 150 or 300 mM NaCl. Surface regeneration was not necessary. Data were evaluated using the BIAevaluation 3.0 software (Biacore). Owing to the instability of the protein on the surface, the maximum RU available for binding was low. A low affinity of mAb S69-4 toward all antigens and a large bulk change because of differences in buffer composition prevented a reliable determination of rate constants. Therefore, KD values were determined from binding analysis at steady state. Acknowledgments We thank U. Agge, V. Susott, I. von Cube, S. Cohrs, N. Harmel (Research Center Borstel), and T. Hirama (NRC) for technical assistance. This work was supported by the Deutsche Forschungsgemeinschaft grant SFB 470, A1 (S.G.), and C1 (H.B. and L.B.) and the Austrian Science Fund FWF grant 13843 and 17407 to P.K. Abbreviations BSA, bovine serum albumin; CMP, cytosine monophosphate; E. coli-Cps, lipopolysaccharide isolated from E. coli F515 expressing the Kdo transferase of C. psittaci; E. coliCtr, lipopolysaccharide isolated from E. coli F515 expressing the Kdo transferase of C. trachomatis; EB, elementary body; ELISA, enzyme-linked immunosorbent assay; FITC, fluorescein isothiocyanate; GlcNAc, 2-amino-2-deoxy-glucopyranose; HRP, horseradish peroxidase; IFT, immunofluorescence test; Ig, immunoglobulin; IMAC, immobilized metal ion affinity chromatography; Kdo, 3-deoxy-α-Dmanno-oct-2-ulopyranosonic acid; LPS, lipopolysaccharide; mAb, monoclonal antibody; PBS, phosphate-buffered saline; scFv, single chain variable fragment; SPR, surface plasmon resonance; TLC, thin-layer chromatography. References Al Lazikani, B., Lesk, A.M., and Chothia, C. (1997) Standard conformations for the canonical structures of immunoglobulins. J. Mol. Biol., 273, 927–948. Barbas III, C.F., Burton, D.R., Scott, J.K., and Silverman, G.J. (2001) Phage Display: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Belunis, C.J., Mdluli, K.E., Raetz, C.R.H., and Nano, F.E. (1992) A novel 3-deoxy-D-manno-octulosonic acid transferase from Chlamydia trachomatis required for expression of the genus-specific epitope. J. Biol. Chem., 267, 18702–18707. Bode, C.E., Brabetz, W., and Brade, H. (1998) Cloning and characterization of 3-deoxy-D-manno-oct-2-ulosonic acid (Kdo) transferase genes (kdtA) from Acinetobacter baumannii and Acinetobacter haemolyticus. Eur. J. Biochem., 254, 404–412. Brabetz, W., Lindner, B., and Brade, H. (2000) Comparative analyses of secondary gene products of 3-deoxy-D-manno-oct-2-ulosonic acid transferases from Chlamydiaceae in Escherichia coli K-12. Eur. J. Biochem., 267, 5458–5465. Brade, H., Brade, L., and Nano, F.E. (1987) Chemical and serological investigations on the genus-specific lipopolysaccharide epitope of Chlamydia. Proc. Natl. Acad. Sci. U. S. A., 84, 2508–2512. Brade, L., Holst, O., Kosma, P., Zhang, Y.X., Paulsen, H., Krausse, R., and Brade, H. (1990) Characterization of murine monoclonal and murine, rabbit, and human polyclonal antibodies against chlamydial lipopolysaccharide. Infect. Immun., 58, 205–213. Brade, L., Brunnemann, H., Ernst, M., Fu, Y., Holst, O., Kosma, P., Näher, H., Persson, K., and Brade, H. (1994) Occurrence of antibodies against chlamydial lipopolysaccharide in human sera as measured by ELISA using an artificial glycoconjugate antigen. FEMS Immunol. Med. Microbiol., 8, 27–42. Brade, L., Rozalski, A., Kosma, P., and Brade, H. (2000) A monoclonal antibody recognizing the 3-deoxy-α-D-manno-oct-2ulosonic acid (Kdo) trisaccharide αKdo(2→4)αKdo(2→4)αKdo of Chlamydophila psittaci 6BC lipopolysaccharide. J. Endotoxin Res., 6, 361–368. Brade, L., Gronow, S., Wimmer, N., Kosma, P., and Brade, H. (2002) Monoclonal antibodies against 3-deoxy-α-D-manno-oct-2-ulosonic 195 S. Müller-Loennies et al. acid (Kdo) and D-glycero-α-D-talo-oct-2-ulosonic acid (Ko). J. Endotoxin Res., 8, 357–364. Byrne, G.I. and Ojcius, D.M. (2004) Chlamydia and apoptosis: life and death decisions of an intracellular pathogen. Nat. Rev. Microbiol., 2, 802–808. Campbell, L.A. and Kuo, C.C. (2004) Chlamydia pneumoniae – an infectious risk factor for atherosclerosis? Nat. Rev. Microbiol., 2, 23–32. Chothia, C. and Lesk, A.M. (1987) Canonical structures for the hypervariable regions of immunoglobulins. J. Mol. Biol., 196, 901–917. Chothia, C., Lesk, A.M., Gherardi, E., Tomlinson, I.M., Walter, G., Marks, J.D., Llewelyn, M.B., and Winter, G. (1992) Structural repertoire of the human VH segments. J. Mol. Biol., 227, 799–817. Everett, K.D. (2000) Chlamydia and Chlamydiales: more than meets the eye. Vet. Microbiol., 75, 109–126. Fu, Y., Baumann, M., Kosma, P., Brade, L., and Brade, H. (1992) A synthetic glycoconjugate representing the genus-specific epitope of chlamydial lipopolysaccharide exhibits the same specificity as its natural counterpart. Infect. Immun., 60, 1314–1321. Furukawa, K., Shirai, H., Azuma, T., and Nakamura, H. (2001) A role of the third complementarity-determining region in the affinity maturation of an antibody. J. Biol. Chem., 276, 27622–27628. Griffiths, P.C., Plater, J.M., Horigan, M.W., Rose, M.P., Venables, C., and Dawson, M. (1996) Serological diagnosis of ovine enzootic abortion by comparative inclusion immunofluorescence assay, recombinant lipopolysaccharide enzyme-linked immunosorbent assay, and complement fixation test. J. Clin. Microbiol., 34, 1512–1518. Gronow, S., Brabetz, W., and Brade, H. (2000) Comparative functional characterization in vitro of heptosyltransferase I (WaaC) and II (WaaF) from Escherichia coli. Eur. J. Biochem., 267, 6602–6611. Heine, H., Müller-Loennies, S., Brade, L., Lindner, B., and Brade, H. (2003) Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC. Eur. J. Biochem., 270, 440–450. Holst, O., Broer, W., Thomas-Oates, J.E., Mamat, U., and Brade, H. (1993) Structural analysis of two oligosaccharide bisphosphates isolated from the lipopolysaccharide of a recombinant strain of Escherichia coli F515 (Re chemotype) expressing the genus-specific epitope of Chlamydia lipopolysaccharide. Eur. J. Biochem., 214, 703–710. Holst, O., Bock, K., Brade, L., and Brade, H. (1995) The structures of oligosaccharide bisphosphates isolated from the lipopolysaccharide of a recombinant Escherichia coli strain expressing the gene gseA [3-deoxyD-manno-octulopyranosonic acid (Kdo) transferase] of Chlamydia psittaci 6BC. Eur. J. Biochem., 229, 194–200. Kosma, P. (1999) Chlamydial lipopolysaccharide. Biochim. Biophys. Acta, 1455, 387–402. Kosma, P., Reiter, A., Hofinger, A., Brade, L., and Brade, H. (2000) Synthesis of neoglycoproteins containing Kdo epitopes specific for Chlamydophila psittaci lipopolysaccharide. J. Endotoxin. Res., 6, 57–69. Lee, R.T. and Lee, Y.C. (1974) Synthesis of 3-(3-aminoethyl-thio) propyl glycosides. Carbohydr. Res., 37, 193–201. Löbau, S., Mamat, U., Brabetz, W., and Brade, H. (1995) Molecular cloning, sequence analysis, and functional characterization of the lipopolysaccharide biosynthetic gene kdtA encoding 3-deoxy-α-Dmanno-octulosonic acid transferase of Chlamydia pneumoniae strain TW-183. Mol. Microbiol., 18, 391–399. 196 MacLennan, I.C., Liu, Y.J., and Johnson, G.D. (1992) Maturation and dispersal of B-cell clones during T cell-dependent antibody responses. Immunol. Rev., 126, 143–161. Mamat, U., Baumann, M., Schmidt, G., and Brade, H. (1993a) The genusspecific lipopolysaccharide epitope of Chlamydia is assembled in C. psittaci and C. trachomatis by glycosyltransferases of low homology. Mol. Microbiol., 10, 935–941. Mamat, U., Baumann, M., Schmidt, G., and Brade, H. (1993b) The genusspecific lipopolysaccharide epitope of Chlamydia is assembled in C. psittaci and C. trachomatis by glycosyltransferases of low homology. Mol. Microbiol., 10, 935–941. Martin, A.C. (1996) Accessing the Kabat antibody sequence database by computer. Proteins, 25, 130–133. Morea, V., Tramontano, A., Rustici, M., Chothia, C., and Lesk, A.M. (1998) Conformations of the third hypervariable region in the VH domain of immunoglobulins. J. Mol. Biol., 275, 269–294. Moulder, J.W. (1991) Interaction of Chlamydiae and host cells in vitro. Microbiol. Rev., 55, 143–190. Müller-Loennies, S., MacKenzie, C.R., Patenaude, S.I., Evans, S.V., Kosma, P., Brade, H., Brade, L., and Narang, S. (2000) Characterization of high affinity monoclonal antibodies specific for chlamydial lipopolysaccharide. Glycobiology, 10, 121–130. Müller-Loennies, S., Grimmecke, D., Brade, L., Lindner, B., Kosma, P., and Brade, H. (2002) A novel strategy for the synthesis of neoglycoconjugates from deacylated deep rough lipopolysaccharides. J. Endotoxin. Res., 8, 295–305. Nano, F.E. and Caldwell, H.D. (1985) Expression of the chlamydial genus-specific lipopolysaccharide epitope in Escherichia coli. Science, 228, 742–744. Narang, S.A., Yao, F.L., Michniewicz, J.J., Dubuc, G., Phipps, J., and Somorjai, R.L. (1987) Hierarchical strategy for protein folding and design: synthesis and expression of T4 lysozyme gene and two putative folding mutants. Protein Eng., 1, 481–485. Nguyen, H.P., Seto, N.O., MacKenzie, C.R., Brade, L., Kosma, P., Brade, H., and Evans, S.V. (2003) Germline antibody recognition of distinct carbohydrate epitopes. Nat. Struct. Biol., 10, 1019–1025. Nurminen, M., Leinonen, M., Saikku, P., and Mäkelä, P.H. (1983) The genus specific antigen of Chlamydia: resemblance to the lipopolysaccharide of enteric bacteria. Science, 220, 1279–1281. Rozalski, A., Brade, L., Kosma, P., Appelmelk, B.J., Krogmann, C., and Brade, H. (1989) Epitope specificities of murine monoclonal and rabbit polyclonal antibodies against enterobacterial lipopolysaccharides of the Re chemotype. Infect. Immun., 57, 2645–2652. Rund, S., Lindner, B., Brade, H., and Holst, O. (1999) Structural analysis of the lipopolysaccharide from Chlamydia trachomatis serotype L2. J. Biol. Chem., 274, 16819–16824. Rund, S., Lindner, B., Brade, H., and Holst, O. (2000) Structural analysis of the lipopolysaccharide from Chlamydophila psittaci strain 6BC. Eur. J. Biochem., 267, 5717–5726. Shirai, H., Kidera, A., and Nakamura, H. (1996) Structural classification of CDR-H3 in antibodies. FEBS Lett., 399, 1–8. Shirai, H., Kidera, A., and Nakamura, H. (1999) H3-rules: identification of CDR-H3 structures in antibodies. FEBS Lett., 455, 188–197. Stähli, C., Staehelin, T., and Miggiano, V. (1983) Spleen cell analysis and optimal immunization for high-frequency production of specific hybridomas. Methods Enzymol., 92, 26–36.