Download Gene expression profiles of hair and wool sheep reveal importance

Published May 15, 2015
Gene expression profiles of hair and wool sheep reveal importance
of Th2 immune mechanisms for increased resistance to Haemonchus contortus
K. M. MacKinnon,*1 S. A. Bowdridge,*2 I. Kanevsky-Mullarky,† A. M. Zajac,‡ and D. R. Notter*3
*Department of Animal and Poultry Sciences, Virginia Tech, Blacksburg 24061;
†Department of Dairy Science, Virginia Tech, Blacksburg 24061; and ‡Department of Biomedical
Sciences and Pathobiology, Virginia-Maryland Regional College of Veterinary Medicine, Blacksburg, VA 24061
ABSTRACT: Management of gastrointestinal parasites is a critical issue for sheep producers worldwide.
Increases in the prevalence of drug-resistant worms
have complicated parasite control and increased
economic losses. Therefore, other methods of parasite control need to be assessed, including the use of
genetically resistant animals in breeding programs.
Hair sheep breeds such as the St. Croix have greater
parasite resistance than conventional wool breeds.
However, the immune mechanisms that control parasite resistance in hair or wool breeds have not yet been
fully determined, and information on cytokine expression profiles for both wool sheep selected for increased
resistance and hair sheep is limited. Our objective
was to investigate gene expression differences in 24
parasite-resistant hair and 24 susceptible wool sheep
to identify immune effectors associated with resistance
to Haemonchus contortus. One-half of the lambs were
infected and sacrificed at 3 or 27 d after infection.
Remaining lambs were not infected. Breed differences
in expression of genes associated with Th1 and Th2
immune responses in lymph nodes and abomasal tis-
sue were determined. Th2-associated genes included
IL-4, IL-13, IL-5, IgE, the α chain of the IL-4 receptor, and the α chain of the high-affinity IgE receptor
(FcεRI). Th1-associated genes included interferon
gamma (IFN-γ), the p35 subunit of IL-12 (IL-12 p35),
and the β1 and β2 chains of the IL-12 receptor (IL12 Rβ1 and IL-12 Rβ2, respectively). In both hair and
wool sheep, infection with H. contortus resulted in
greater expression of IgE, IL-13, IL-5, and IL-12 p35
and somewhat reduced expression of IFNγ in lymph
nodes. In abomasal tissue, parasite infection resulted in
greater IgE, IL-13, FcεRI, and IL-12 p35 expression in
infected lambs compared with control lambs. Between
breeds, hair sheep had a stronger Th2 response after
infection than wool sheep, with increased expression
of IgE and IL-13 and decreased expression of IFNγ in
lymph nodes and increased expression of IL-13 and
decreased expression of IL-12 p35 in abomasal tissue. Expression of IL-4 in lymph nodes did not differ
between hair and wool lambs, and IL-4, IL-5, IL-12
Rβ1, and IL-12 Rβ2 expression was too low to measure at the times sampled in abomasal tissue.
Key words: cytokines, gene expression, Haemonchus contortus, immune response, sheep
© 2015 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2015.93:2074–2082
doi:10.2527/jas2014-8652
INTRODUCTION
Management of gastrointestinal parasites is a sig1Present
address: WorldWide Life Sciences, 8810 Westgate
Park Drive, Suite 108, Raleigh, NC 27617.
2Present address: Division of Animal and Nutritional Sciences,
West Virginia University, Morgantown 26506.
3Corresponding author: [email protected]
Received October 24, 2014.
Accepted February 24, 2015.
nificant concern for sheep producers (National Animal
Health Monitoring System, 1996), especially in hot,
humid areas where sheep are continuously exposed to
infection. The blood-feeding nematode Haemonchus
contortus is 1 of the most detrimental parasites of
sheep in tropical, subtropical, and warm temperate
regions. The prevalence of drug-resistant worms has
increased worldwide, with some parasite strains resistant to all classes of anthelmintics (Kaplan, 2004).
Treatment options have correspondingly become more
limited, and more holistic parasite control strategies
2074
Immune effectors in hair and wool sheep
2075
Figure 1. Infection, deworming, and sample collection for infected and control lambs of hair and wool breeds. Days are relative to the final dosing
of infected lambs with 10,000 Haemonchus contortus larvae (Hc). An arrow indicates that lambs were dewormed. An asterisk indicates that lambs were
sacrificed and tissue samples were collected. Cross-hatched lines indicate infection. Control lambs were dosed with 10,000 Haemonchus contortus larvae
on d 11 but were subsequently dewormed on d 12 and 14 to prevent establishment of infection.
will be required, including incorporation of genetically
resistant animals into breeding populations. Selection
to reduce fecal egg counts (FEC) in temperate sheep
breeds has been effective (Woolaston, 1992; Bisset et
al., 1996). However, selection to meaningfully enhance
parasite resistance in susceptible breeds can take many
years (Eady et al., 1997). Important differences in resistance to internal parasites exist among sheep breeds.
In particular, Caribbean hair sheep breeds develop resistance more quickly and at a higher level than wool
sheep maintained under the same conditions (Gamble
and Zajac, 1992; Vanimisetti et al., 2004).
Infection with nematode parasites primarily elicits
a Th2 immune response, characterized by antibody production, eosinophilia, mastocytosis, and production of
cytokines IL-4, IL-5, and IL-13 (Kooyman et al., 2000;
Pernthaner et al., 2005a; Balic et al., 2006; Lacroux et
al., 2006). Differences in immune response between resistant and susceptible lines of wool sheep have been
explored (Pernthaner et al., 1996, 2005a; Diez-Tascon
et al., 2005; Keane et al., 2006), but few studies have
evaluated gene expression in Caribbean hair sheep. Our
objective was thus to assess breed differences in expression of Th1 and Th2 immune genes and their receptors
in abomasum and lymph node tissues of Caribbean hair
and temperate wool sheep infected with H. contortus.
MATERIALS AND METHODS
Animals, Tissue Collection, and RNA Extraction
All experimental procedures were evaluated and
approved by the Virginia Tech Animal Care and Use
Committee. Twenty-four St. Croix hair and 24 wool
lambs were used for the study. Wool lambs were from
a composite line of 50% Dorset, 25% Rambouillet, and
25% Finnsheep breeding established in 1988 (Notter
and Cockett, 2005). Lambs were born in April at the
Virginia Tech Sheep Center in Blacksburg and were
maintained as contemporaries on pastures known to be
infected with H. contortus. Standard deworming protocols were followed until lambs were approximately 4
mo of age. At this time, lambs were artificially infected
with 3,000 L3 larvae of H. contortus per week for 4
consecutive weeks to further standardize parasite exposure. Lambs were dewormed using levamisole (8 mg/kg
BW) and fenbendazole (10 mg/kg BW) 1 wk after the
last infection, were moved to a drylot to preclude additional nematode infection, and were dewormed again
3 d later. Twelve hair and 12 wool lambs were chosen
at random for experimental infection with H. contortus and were moved to raised indoor pens following
the second deworming. Fecal egg counts were determined as described below for these lambs and revealed
evidence of residual infection in a few lambs, so the 24
lambs were dewormed again 5 d later. Trichostrongylid
FEC were zero in all lambs following this deworming.
Three days after the last deworming (d 0; Fig. 1),
experimental lambs were orally infected with 10,000
H. contortus L3 larvae and remained in indoor pens for
the duration of the study. Six infected lambs of each
breed were sacrificed at 3 and 27 d postinfection (PI)
to assess responses to larvae (d 3) and to adult worms
(d 27). Twelve hair and 12 wool lambs served as controls. Because of space limitations, control lambs remained in drylot for an additional 2 wk and were moved
to indoor pens on d 7 relative to infected lambs. Control
lambs were dewormed on d 8 relative to infected lambs,
received 10,000 L3 larvae of H. contortus on d 11, and
were dewormed on d 12 and 14, thereby allowing brief
initial exposure to L3 larvae and to antigen from killed
larvae, but without establishment of infection. All control
lambs had FEC of zero following deworming on d 14.
Four control lambs of each breed type were sacrificed on
d 17, 27, and 38 (i.e., 3, 13, and 24 d after final deworming) to provide a profile of responses in control lambs.
2076
MacKinnon et al.
Table 1. Forward and reverse primer sequences for real-time reverse transcriptase PCR melting temperature (Tm)
of the amplicons and presence or absence of ovine DNA amplification (DNA)
Gene1
IL-4
IL-4 Rα
IL-5
IL-13
IgE
FceRI
IFN-γ
IL-12 p35
IL-12 Rb1
IL-12 Rb2
β-actin
RPL19
GAPDH
Forward sequence
GCCACACGTGCTTGAACAAA
CCAAGCTCCTGCCCTGTTTA
TGGTGGCAGAGACCTTGACA
AAGCCCTCAGCTAAGCAGGTT
GCGAGACCTACTACTGCAAAGTGA
TGCCGAATCAAAGGATTTGC
TGGAGGACTTCAAAAAGCTGATT
GCTGCAGAAGGCCAGACAA
CTTTGGGTACCTCGGCTTGA
CCTGGGCACAACCCTGTTT
CGCCATGGATGATGATATTGC
GCTCCTCAGCCAAGCACATAC
GCATCGTGGAGGGACTTATGA
Reverse sequence
TGCTTGCCAAGCTGTTGAGA
CCATTTCTAGCAGCCTTAGAGAAGTC
GAATCATCAAGTTCCCATCACCTA
TGGGCCACTTCAATTTTGGT
CACGCTTGCCAACATCCTT
GATCAACCAGTCACTGATGACGTT
TTTATGGCTTTGCGCTGGAT
ATATCTTCATGATCAATCTCCTCAGAAG
CCTCAGTTTCCCCATCTTGAAA
AACAACCCCGACGGAGATC
AAGCCGGCCTTGCACAT
GCCATGGTAATCCTGCTCAGTAC
GGGCCATCCACAGTCTTCTG
Tm, °C
78.9
78.0
78.8
79.2
81.2
76.5
77.1
74.3
75.9
80.1
82.5
79.2
81.7
DNA
No
Yes
No
No
No
No
No
Yes
No
Yes
Yes
Yes
Yes
1IL-4 Rα = α chain of the IL-4 receptor; FcεRI = α chain of the high-affinity IgE receptor; IFNγ = interferon gamma; IL-12 p35 = p35 subunit of IL-12; IL-12 Rβ1
and IL-12 Rβ2 = β1 and β2 chains, respectively, of the IL-12 receptor; RPL 19 = ribosomal protein 19 and GAPDH = glyceraldehyde-3-phosphate dehydrogenase.
Lambs were killed by captive-bolt pistol, followed
by exsanguination. The gastrointestinal tract was removed, and the abomasum was tied off at both ends
and separated from the digestive tract. The abomasum
was then cut along the greater curvature and washed
with room-temperature PBS, and a 2.5 cm2 section
of tissue, including the full thickness and 1 fold of
the abomasum, was removed from the fundic region.
Lymph nodes lining the lesser curvature of the abomasum were removed from surrounding adipose tissue
and rinsed in PBS. Lymph node and abomasal tissues
were homogenized separately on ice-cold metal trays,
and 0.1-g samples were immediately frozen in liquid
nitrogen and stored at −80°C
Total RNA was extracted from abomasal tissue
using TRIzol reagent (Invitrogen Inc., Carlsbad, CA)
and from lymph node tissues using RNeasy Miniprep
kit (Qiagen,Hilden, Germany) according to manufacturers’ protocols. The RNA was examined at 260- and
280-nm wavelengths using a UV spectrophotometer to
confirm sufficient concentration and purity (i.e., lack
of protein contamination) for use in real-time reverse
transcriptase (RT) PCR.
Parasitological Techniques
Eggs collected from adult H. contortus were used
to produce a monospecific larval culture (MacKinnon
et al., 2009). Larvae were collected using the Baermann
technique (Zajac and Conboy, 2012), were stored in
deionized water at 4°C, and were used within 1 mo to
infect experimental animals. Experimental infections at
d 0 and 11 in Fig. 1 used larvae from a single culture.
Fecal egg counts were determined at 16, 21, and 27 d PI
using the McMaster technique (Whitlock, 1948).
Primer Design and Validation
Target genes (Table 1) were selected on the basis of cDNA microarray analysis (MacKinnon et al.,
2009) and previous literature. Oligonucleotide sequences for IL-4, interferon gamma (IFNγ), and IL-5
were obtained from Coussens et al. (2004), and Primer
Express software (Applied Biosystems, Waltham, MA)
was used to design primers for the heavy chain of IgE,
IL-13, tumor necrosis factor alpha (TNFα), the p35
subunit of IL-12 (IL-12 p35), the α chain of the highaffinity IgE receptor (FcεRI), the α chain of the IL-4
receptor (IL-4 Rα), and the β1 and β2 chains of the IL12 receptor (IL-12 Rβ1 and IL-12 Rβ2, respectively)
on the basis of known bovine and ovine sequences.
Primer pairs were selected to have 1 of the 2 primers
spanning an exon-intron junction, where applicable,
to limit DNA amplification. Candidate housekeeping
(HK) genes were glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, and ribosomal protein
L19. Primer sequences for HK genes were obtained
from the Michigan State University Center for Animal
Functional Genomics (http://www.ans.msu.edu/research1/functional_genomics_and_bioinfomatics).
Primer sequences, presence or absence of DNA amplification, and melting temperatures of the corresponding amplicons are listed in Table 1.
Primer pairs were evaluated for ovine and bovine
cDNA and DNA amplification and contamination by
including a blank (negative) control. Amplification efficiency for primer pairs was assessed to ensure similar
HK and target gene amplification. To determine amplification efficiency, 1, 3.16, 10, 31.6, and 100 ng of
cDNA were used as described below, and the slope of
cycle threshold (Ct) values for log10 cDNA concentrations was obtained. A slope of −3.33 indicated 100%
2077
Immune effectors in hair and wool sheep
amplification efficiency. Multiple primer pairs for
TNFα were evaluated, but none met the above criteria,
and TNFα was excluded from our analysis. Multiple
HK genes were tested for amplification in abomasal
and lymph node tissue of infected and control lambs.
Glyceraldehyde-3-phosphate dehydrogenase had consistent expression (Ct ± SE = 19.34 ± 0.36) and was
used for the analyses.
cDNA synthesis and Real-Time RT-PCR
First-strand cDNA was reverse transcribed from 2.2
μg total RNA using a High Capacity cDNA Archive Kit
(Applied Biosystems) according to the manufacturer’s
protocol. Reverse-transcribed samples were diluted to a
concentration of 10 ng/μL using RNase-free diethylpyrocarbonate-treated (DEPC) water and stored at −20°C.
Each RT-PCR reaction was performed in a total volume
of 25 μL using 2 μL (10 ng/μL) of reverse-transcribed
RNA, 12.5 μL SYBR Green PCR master mix (Applied
Biosystems), 1.5 μL (5 μM concentration) forward and
reverse primers, and 7.5 μL DEPC water. Samples were
loaded into optical 96-well plates (Applied Biosystems)
in duplicate, and RT-PCR was performed on an ABI
PRISM 7300 sequence detection system (Applied
Biosystems) under the following conditions: 50°C for
2 min, 95°C for 10 min, and 40 cycles of 95°C for 15
s and 60°C for 1 min. A melting curve was obtained
at the end of each run to ensure amplification of only
1 product. If variation in Ct values between duplicates
exceeded 0.125 or multiple products were found, the
sample was rerun until acceptable values were obtained.
Mean Ct values for sample duplicates were used for all
analyses.
Statistical Methods
Differences in Ct values between GAPDH and target genes (ΔCt) for each lamb were analyzed for each
gene using a general linear model (SAS Inst. Inc., Cary,
NC). The initial model included effects of breed (hair
or wool), group (infection status by day of sacrifice),
and breed by group interaction. However, no systematic changes in expression levels across sampling times
were observed in control lambs, and observations for
control lambs were subsequently averaged across collection days. Linear contrasts among the resulting 6
means for control lambs and infected lambs at 3 and
27 d PI for each breed type were used to test effects
of breed type and experimental infection. Two-tailed
t tests were used to test breed differences within each
treatment group, and Dunnett’s test was used to compare averages for control lambs to those for infected
lambs at 3 and 27 d PI. Effects of breed type were test-
ed separately for control lambs and for infected lambs
at 3 and 27 d PI. Breed comparisons were orthogonal
to one another and to the contrasts used to compare infected and control lambs and were therefore tested with
2-tailed t tests. Differences were considered significant
at P < 0.05 unless stated otherwise. Tests were based
on ΔCt means. However, for presentation purposes,
ΔΔCt values were calculated as differences between
least squares means of control wool sheep and least
squares means for other groups of lambs, and 2-∆∆ct
values were used to show fold changes in gene expression for infected and control hair and wool sheep on
each day of sacrifice relative to control wool lambs.
RESULTS
Parasitology
Nematode infection, as assessed by FEC, was
not observed in control lambs, but lambs infected
with H. contortus all had measurable FEC by 16 d PI
(MacKinnon et al., 2010). The mean FEC for wool
sheep was similar to that of hair sheep at 16 d PI but
was 2.8-fold higher at 21 d PI (n = 3,647 ± 770 and
1,280 ± 867, respectively) and 2.5-fold higher at 27 d
PI (n = 3,136 ± 1,599 and 1,267 ± 837, respectively; P =
0.12 for average FEC at 21 and 27 d). Worm numbers in
the abomasum at 27 d PI were 1.8-fold higher in wool
compared with hair lambs (n = 4,535 ± 690 and 2,491
± 753, respectively; P = 0.07; MacKinnon et al., 2010).
Differences in worm counts and FEC were based on
only 6 lambs of each type, but significant differences in
FEC between these hair and wool sheep types were previously reported by Notter et al. (2003) and Vanimisetti
et al. (2004), with lower FEC in hair lambs.
Gene Expression in Abomasal and Lymph Node Tissue
Cytokine, IgE, and associated receptor genes
evaluated in this study (Table 1) all had quantifiable
expression in lymph node tissue, but expression of
IL-4, IL-5, IL-12 Rβ1, and IL-12 Rβ2 was too low
to measure at the times sampled in abomasal tissue.
Compared with wool sheep, control hair sheep had
greater expression of IgE in lymph nodes (P < 0.001)
and lower expression of FcεRI in both lymph nodes
and abomasal tissue (P < 0.05; Fig. 2 and 3).
Infection with H. contortus was associated with
large changes in gene expression in abomasal tissue and
lymph nodes of both breeds. At 3 d PI, lymph nodes
of infected lambs had higher expression of IL-13 (6.0fold; P < 0.001), IL-5 (1.9-fold; P < 0.01), IL-12 p35
(2.0-fold; P < 0.05), and IgE (3.4-fold; P < 0.01) compared with control lambs but lower expression of IFNγ
2078
MacKinnon et al.
Figure 2. Relative expression of IgE, the α chain of the high-affinity IgE receptor (FcεRI), IL-13, IL-5, the p35 subunit of IL-12 (IL-12 p35), and
interferon gamma (IFNγ) genes in lymph nodes of wool and hair sheep. Control lambs were infected and then immediately treated. Values for these lambs
are averages of measurements taken 3, 13, and 24 d after final deworming of control lambs (Fig. 1). Breeds with different labels (a, b and x, y) differ (P <
0.05 and P < 0.10, respectively) within infection status and sampling day. Infected lambs differ from controls at †P < 0.10, *P < 0.05, **P < 0.01, or ***P <
0.001. Methods used to derive fold-changes in gene expression are described in the text.
(P < 0.10; Fig. 2). In abomasal tissue, infected lambs
had higher expression compared with control lambs for
IL-13 (7.7-fold; P < 0.01), FcεRI (2.1-fold; P < 0.01),
and IgE (2.4-fold; P < 0.10) at 3 d PI but had somewhat
lower expression of IFNγ (P < 0.10; Fig. 3).
Differences between breeds in gene expression were
observed in infected lambs at 3 d PI. An increase in IgE
expression was observed in both breeds at 3 d after infection, but hair sheep had a much greater increase in
expression of IgE in lymph nodes compared with wool
sheep (Fig. 2). Hair sheep also tended to have lower expression (P < 0.10) of FcεRI in lymph nodes at 3 d PI
compared with wool sheep, but expression levels in abomasal tissue were somewhat greater (P < 0.20) for hair
sheep. Expression of IL-12 p35, a cytokine subunit asso-
ciated with Th1 immune responses (Collins et al., 1999),
increased relative to control lambs in both lymph nodes
and abomasal tissues of wool lambs at 3 d PI but did not
change in hair sheep. Increases relative to control lambs
in expression of IL-13 in lymph nodes and abomasal tissue and of IL-5 in lymph nodes and reduced expression
of IFNγ were consistent across breed types at 3 d PI.
At 27 d after infection, IgE expression remained
higher in lymph nodes (P < 0.05; Fig. 2) and, to a lesser extent, in abomasal tissue (P < 0.10; Fig. 3) of hair
compared with wool lambs. In wool lambs, expression
of IL-13 in both lymph nodes and abomasal tissue declined precipitously relative to levels observed at 3 d
PI. Reductions in IL-13 expression were also observed
in lymph nodes and abomasal tissue of hair lambs but
2079
Immune effectors in hair and wool sheep
Figure 3. Relative expression of IgE, the α chain of the high-affinity IgE receptor (FcεRI), IL-13, the p35 subunit of IL-12 (IL-12 p35), and interferon
gamma (IFNγ) genes in abomasa of wool and hair sheep. Control lambs were infected and then immediately treated. Values for these lambs are averages
of measurements taken 3, 13, and 27 d after final deworming of control lambs (Fig. 1). Breeds with different labels (a, b and x, y) differ (P < 0.05 and P <
0.10, respectively) within infection status and sampling day. Infected lambs differ from controls at †P < 0.10, *P < 0.05, **P < 0.01, or ***P < 0.001.
Methods used to derive fold-changes in gene expression are described in the text.
were less precipitous, resulting in significantly greater
IL-13 expression in both lymph nodes (P < 0.001) and
abomasal tissue (P < 0.05) of hair lambs at 27 d PI.
The greater expression of IL-12 p35 observed in wool
lambs at 3 d PI was also present at 27 d, although expression levels in both breed types tended to decline
from 3 to 27 d PI. Greater expression of IFNγ in both
lymph nodes (P < 0.05) and, to a lesser extent, abomasal tissue (P < 0.10) of wool lambs provides further
evidence for a more strongly polarized Th2 immune
response in hair lambs. Declines in expression of
FcεRI in both lymph nodes and abomasal tissue and of
IL-5 in lymph nodes at 27 d PI relative to 3 d PI were
generally consistent across breed types.
DISCUSSION
Wool sheep infected with gastrointestinal nematodes
predominantly produce a Th2-type immune response
(Meeusen et al., 2005; Pernthaner et al., 2005a; Lacroux
et al., 2006). Essential immune mechanisms needed for
increased resistance to H. contortus in sheep are mediated
by T cells expressing the CD4+ (“cluster of differentiation 4”) pattern of cell-surface proteins (Peña et al., 2006),
but precise mechanisms of activation and development
of protective immunity are unknown. We have shown a
difference in gene expression between 2 sheep breeds in
infected lambs at 3 and 27 d PI that indicates involvement
of specific cytokines, immunoglobulins, and receptors in
the immune response of sheep to H. contortus infection.
2080
MacKinnon et al.
Infection with H. contortus induced a Th2-type response by 3 d PI in tissues of both hair and wool sheep,
with increased expression of Th2 genes, including IL-13,
IL-5, and IgE but not IL-4. Expression of the Th1 cytokine IFNγ was reduced in both breeds at 3 d PI. However,
expression of the Th1 cytokine IL-12 p35 was increased
in wool lambs but not in hair lambs. Evidence for a more
persistent Th2 immune response in hair sheep was observed at 27 d PI when expression of IL-13 returned to
control levels in wool lambs but remained elevated in
hair lambs. Higher levels of expression of IFNγ and IL12 p35 were observed in both tissues in wool lambs at 27
d PI, but levels of these cytokines in hair lambs at 27 d PI
did not exceed those observed in control lambs.
Increased expression of IL-13, IL-5, and IL-4, as
well as IFNγ, was reported in lymph nodes of Romney
sheep infected with Trichostrongylus colubriformis, an
intestinal nematode parasite (Pernthaner et al., 2006). In
younger sheep of a different breed, Lacroux et al. (2006)
also reported increased IL-13, IL-5, and IL-4 in abomasal
and lymph tissues of infected lambs but no differences
between infected and control lambs in IFNγ, IL-12 p35,
IL-10, or TNFα. Differences between studies in expression of IFNγ may be associated with parasite-produced
IFNγ homologs that can alter host immune responses
to facilitate a more favorable Th1 environment for the
parasite (Grencis, 2001). Maizels et al. (2004) identified
a multitude of proteins produced by different gastrointestinal parasites that appear similar to host cytokines.
Increases in IL-13 and IL-5 in lambs infected with
H. contortus were not surprising. Interleukin-13 is
produced by Th2 cells and induces IgE-class switching in bovine cells (Trigona et al., 1999), which was
consistent with the observed increase in IgE expression. Increased IL-13 causes B cell, but not T cell, activation and proliferation (Trigona et al., 1999), activates mast cells (Kaur et al., 2006), regulates IFNγ,
and drives Th2 responses (Webb et al., 2007). Mast
cells and Th2 cells produce IL-5, which has been associated with eosinophil recruitment and activation and
larval damage (Rainbird et al., 1998), and eosinophil
viability can be increased through synergistic effects
of IL-13 and IL-5 (Luttmann et al., 1999). Production
of IL-5 in abdominal lymph nodes and abomasal tissue indicates a Th2 response, recruitment of eosinophils to the abomasum (MacKinnon et al., 2010), and
increased IgE gene expression within 3 d of infection.
Control hair lambs had higher IgE gene expression
in lymph nodes than control wool lambs, but differences were much smaller than those observed in lambs
with an active parasite infection. Previous attempts to
vaccinate lambs against H. contortus using isolated excretory/secretory (ES) products of adult worms led to
transient elevations in ES-specific serum IgE following
treatment (Kooyman et al., 2000; Vervelde et al., 2003).
An IgE-reactive antigen was also identified on the surface of infective larvae of Teladorsagia circumcincta
but not H. contortus (Huntley et al., 2001). Immune responses in control lambs thus potentially reflected both
background levels of gene expression and responses to
antigen from killed L3 larvae. However, no time trends
in gene expression were observed in control lambs, suggesting that observed differences mainly reflected differences in background IgE expression. Greater background levels of IgE expression may be associated with
larger numbers of IgE-bound mast cells in the gastrointestinal tract, enabling hair sheep to respond more rapidly to invading parasites. Increased numbers of mast
cells, which bind IgE, were reported in association
with parasitism (Lacroux et al., 2006). These cells can
be activated and degranulated by binding with worm
antigens and direct cascades of immune events. Mast
cells can cause increased IgE production and directly
produce IL-4 and IL-13 (Henz et al., 2001).
Expression of FcεRI in lymph nodes and abomasal
tissues of control lambs was higher for hair sheep than
for wool sheep. Expression of FcεRI in lymph nodes
of infected lambs at 3 d PI was essentially identical to
that observed in control lambs. However, FcεRI expression tended to increase in abomasal tissue of hair
lambs at 3 d PI and then declined at 27 d PI relative to
levels of expression found at d 3. Gamble and Zajac
(1992) provided evidence for a potential role of mast
cells in increased resistance of hair sheep, and these
cells could be involved in observed changes in FcεRI
expression. Mast cells commonly express FcεRI (Galli
et al., 2011) and are considered precursors to globule
leukocytes (Huntley et al., 1984). Although this cell
type did not increase at d 3 (MacKinnon et al., 2010),
eosinophils were higher in hair sheep and are known
to express FcεRI. Increased expression of FcεRI in
hair lambs thus potentially results from accumulation
of a variety of innate immune cells in the abomasum
of infected hair lambs. Lower FcεRI expression in
abomasal tissue of wool sheep at 3 d PI may result
from a reduced ability to recruit immune cells to the
site of infection. Feedback loops reflecting effects of
IgE and FcεRI on FcεRI gene expression are complex,
generally involving positive association between IgE
and FcεRI expression (Burton and Oettgen, 2011).
However, antigen binding and internalization of antigen-IgE complexes by mast cells may have negative
effects on FcεRI expression (Brenzovich et al., 2009).
Stronger polarization toward a Th2 immune response in hair sheep is consistent with the results of
Pernthaner et al. (2005a, 2006), who reported stronger
Th2 responses after infection in resistant, compared
with susceptible, lines of Romney sheep infected with
Immune effectors in hair and wool sheep
T. colubriformis. When compared with susceptible
animals, resistant sheep had increased IL-5, IL-13,
and TNFα expression in lymph nodes but did not differ in expression of IL-4 or IFNγ. Resistant lines of
Merino and Romney sheep also had greater IgE production than susceptible lines (Bendixsen et al., 2004;
Pernthaner et al., 2005b).
Decreased expression of Th1 cytokines such as IL-12
and IFNγ may result from downregulation by increased
Th2 cytokine levels in infected hair sheep (Webb et al.,
2007). Recombinant bovine IL-12 directly caused increased IFNγ production by T cells (Collins et al., 1999).
Therefore, reduced expression of IL-12 p35 at 3 and 27 d
PI may have led to the observed decrease in IFNγ at 27 d.
Cytokine profiles at d 27 of infection may also reflect the
total worm burden, as hair sheep potentially have fewer
worms than wool sheep by 27 d PI.
These results support a stronger Th2 response in
infected hair sheep, with large breed differences in
expression of IL-13 but not IL-4. Large changes in
gene expression were observed within 3 d of infection,
presumably in response to larval antigens, suggesting
that mechanisms driving resistance to gastrointestinal nematodes are initiated immediately on entry of
parasitic larvae to the gastrointestinal tract and that
immune responses in this period may be critical to expression of parasite resistance.
LITERATURE CITED
Balic, A., C. P. Cunningham, and E. N. Meeusen. 2006. Eosinophil
interactions with Haemonchus contortus larvae in the
ovine gastrointestinal tract. Parasite Immunol. 28:107–115.
doi:10.1111/j.1365-3024.2006.00816.x.
Bendixsen, T., R. G. Windon, J. F. Huntley, A. MacKellar, R. J.
Davey, S. J. McClure, and D. L. Emery. 2004. Development of
a new monoclonal antibody to ovine chimeric IgE and its detection of systemic and local IgE antibody responses to the intestinal nematode Trichostrongylus colubriformis. Vet. Immunol.
Immunopathol. 97:11–24. doi:10.1016/j.vetimm.2003.08.009.
Bisset, S. A., A. Vlassoff, P. G. Douch, W. E. Jonas, C. J. West,
and R. S. Green. 1996. Nematode burdens and immunological responses following natural challenge in Romney lambs
selectively bred for low or high faecal worm egg count. Vet.
Parasitol. 61:249–263. doi:10.1016/0304-4017(95)00836-5.
Brenzovich, J., M. Macey, J. Fernando, H. J. Chong, B. Barnstein,
P. Mirmonsef, J. K. Morales, A. Kimura, T. D. Cruz, and J.
Ryan. 2009. IgE signaling suppresses FcεRI expression. J.
Leukoc. Biol. 86:1351–1358. doi:10.1189/jlb.0409231.
Burton, O. T., and H. C. Oettgen. 2011. Beyond immediate hypersensitivity: Evolving roles for IgE antibodies in immune homeostasis and allergic diseases. Immunol. Rev. 242:128–143.
doi:10.1111/j.1600-065X.2011.01024.x.
Collins, R. A., C. J. Howard, S. E. Duggan, and D. Werling. 1999.
Bovine interleukin-12 and modulation of IFNγ production.
Vet. Immunol. Immunopathol. 68:193–207. doi:10.1016/
S0165-2427(99)00020-3.
2081
Coussens, P. M., N. Verman, M. A. Coussens, M. D. Elftman, and
A. M. McNulty. 2004. Cytokine gene expression in peripheral
blood mononuclear cells and tissues of cattle infected with
Mycobacterium avium subsp. paratuberculosis: Evidence for
an inherent proinflammatory gene expression pattern. Infect.
Immun. 72:1409–1422. doi:10.1128/IAI.72.3.1409-1422.2004.
Diez-Tascon, C., O. M. Keane, T. Wilson, A. Zadissa, D. L.
Hyndman, D. B. Baird, J. C. McEwan, and A. M. Crawford.
2005. Microarray analysis of selection lines from outbred
populations to identify genes involved with nematode
parasite resistance in sheep. Physiol. Genomics 21:59–69.
doi:10.1152/physiolgenomics.00257.2004.
Eady, S. J., R. R. Woolaston, J. L. Ward, G. D. Gray, J. Karsson,
and J. Greef. 1997. Nemesis—Systems for incorporating resistance to worms in Merino breeding programs. Proc. Assoc.
Adv. Anim. Breed. Genet. 12:507–511.
Galli, H. R., N. Borregaard, and T. A. Wynn. 2011. Phenotypic
and functional plasticity of cells of innate immunity:
Macrophages, mast cells and neutrophils. Nat. Immunol.
12:1035–1044. doi:10.1038/ni.2109.
Gamble, H. R., and A. M. Zajac. 1992. Resistance of St. Croix
lambs to Haemonchus contortus in experimentally and
naturally acquired infections. Vet. Parasitol. 41:211–225.
doi:10.1016/0304-4017(92)90081-J.
Grencis, R. K. 2001. Cytokine regulation of resistance and susceptibility to intestinal nematode infection—From host to parasite.
Vet. Parasitol. 100:45–50. doi:10.1016/S0304-4017(01)00482-4.
Henz, B. M., M. Maurer, U. Lippert, M. Worm, and M. Babina. 2001.
Mast cells as initiators of immunity and host defense. Exp.
Dermatol. 10:1–10. doi:10.1034/j.1600-0625.2001.100101.x.
Huntley, J. F., G. Newlands, and H. R. P. Miller. 1984. The isolation
and characterization of globule leukocytes: Their derivation
from mucosal mast cells in parasitized sheep. Parasite Immunol.
6:371–390. doi:10.1111/j.1365-3024.1984.tb00809.x.
Huntley, J. F., J. Redmond, W. Welfare, G. Brennan, F. Jackson, F.
Kooyman, and L. Vervelde. 2001. Studies on the immunoglobulin E responses to Teladorsagia circumcincta in sheep:
Purification of a major high molecular weight allergen. Parasite
Immunol. 23:227–235. doi:10.1046/j.1365-3024.2001.00377.x.
Kaplan, R. M. 2004. Drug resistance in nematodes of veterinary
importance: A status report. Trends Parasitol. 20:477–481.
doi:10.1016/j.pt.2004.08.001.
Kaur, D., F. Hollins, L. Woodman, W. Yang, P. Monk, R. May,
P. Bradding, and C. E. Brightling. 2006. Mast cells express
IL-13R alpha 1: IL-13 promotes human lung mast cell proliferation and Fc epsilon RI expression. Allergy 61:1047–1053.
doi:10.1111/j.1398-9995.2006.01139.x.
Keane, O. M., A. Zadissa, T. Wilson, D. L. Hyndman, G. J. Greer,
D. B. Baird, A. F. McCulloch, A. M. Crawford, and J. C.
McEwan. 2006. Gene expression profiling of naive sheep
genetically resistant and susceptible to gastrointestinal nematodes. BMC Genomics 7:42. doi:10.1186/1471-2164-7-42.
Kooyman, F. N., H. D. Schallig, M. A. Van Leeuwen, A. MacKellar,
J. F. Huntley, A. W. Cornelissen, and L. Vervelde. 2000.
Protection in lambs vaccinated with Haemonchus contortus
antigens is age related, and correlates with IgE rather than
IgG1 antibody. Parasite Immunol. 22:13–20. doi:10.1046/
j.1365-3024.2000.00265.x.
Lacroux, C., T. H. Nguyen, O. Andreoletti, F. Prevot, C. Grisez, J.
P. Bergeaud, L. Gruner, J. C. Brunel, D. Francois, P. Dorchies,
and P. Jacquiet. 2006. Haemonchus contortus (Nematoda:
Trichostrongylidae) infection in lambs elicits an unequivocal
Th2 immune response. Vet. Res. 37:607–622. doi:10.1051/
vetres:2006022.
2082
MacKinnon et al.
Luttmann, W., T. Matthiesen, H. Matthys, and J. C. Virchow Jr. 1999.
Synergistic effects ofinterleukin-4 or interleukin-13 and tumor necrosis factor-alpha on eosinophil activation in vitro. Am. J. Respir.
Cell Mol. Biol. 20:474–480. doi:10.1165/ajrcmb.20.3.3326.
MacKinnon, K. M., J. L. Burton, A. M. Zajac, and D. R. Notter.
2009. Microarray analysis reveals differences in gene expression profiles of hair and wool sheep infected with
Haemonchus contortus. Vet. Immunol. Immunopathol.
130:210–220. doi:10.1016/j.vetimm.2009.02.013.
MacKinnon, K. M., A. M. Zajac, F. N. J. Kooyman, and D. R. Notter.
2010. Differences in immune parameters are associated with resistance to Haemonchus contortus in Caribbean hair sheep. Parasite
Immunol. 32:484–493. doi:10.1111/j.1365-3024.2010.01211.x.
Maizels, R. M., A. Balic, N. Gomez-Escobar, M. Nair, M. D.
Taylor, and J. E. Allen. 2004. Helminth parasites—Masters of
regulation. Immunol. Rev. 201:89–116. doi:10.1111/j.01052896.2004.00191.x.
Meeusen, E. N., A. Balic, and V. Bowles. 2005. Cells, cytokines
and other molecules associated with rejection of gastrointestinal nematode parasites. Vet. Immunol. Immunopathol.
108:121–125. doi:10.1016/j.vetimm.2005.07.002.
National Animal Health Monitoring System. 1996. U.S. sheep
health and management practices. Natl. Anim. Health Monit.
Syst., USDA, APHIS, Fort Collins, CO.
Notter, D. R., S. A. Andrew, and A. M. Zajac. 2003. Responses of
hair and wool sheep to a single fixed dose of infective larvae
of Haemonchus contortus. Small Rumin. Res. 47:221–225.
doi:10.1016/S0921-4488(02)00279-1.
Notter, D. R., and N. E. Cockett. 2005. Opportunities for detection and use of QTL influencing seasonal reproduction in
sheep: A review. Genet. Sel. Evol. 37(Suppl. 1):S39–S53.
doi:10.1186/1297-9686-37-S1-S39.
Peña, M. T., J. E. Miller, and D. W. Horohov. 2006. Effect of CD4+
T lymphocyte depletion on resistance of Gulf Coast Native
lambs to Haemonchus contortus infection. Vet. Parasitol.
138:240–246. doi:10.1016/j.vetpar.2005.12.026.
Pernthaner, A., S. A. Cole, L. Morrison, R. Green, R. J. Shaw, and
W. R. Hein. 2006. Cytokine and antibody subclass responses
in the intestinal lymph of sheep during repeated experimental infections with the nematode parasite Trichostrongylus
colubriformis. Vet. Immunol. Immunopathol. 114:135–148.
doi:10.1016/j.vetimm.2006.08.004.
Pernthaner, A., S. A. Cole, L. Morrison, and W. R. Hein. 2005a.
Increased expression of interleukin-5 (IL-5), IL-13, and tumor necrosis factor alpha genes in intestinal lymph cells of
sheep selected for enhanced resistance to nematodes during
infection with Trichostrongylus colubriformis. Infect. Immun.
73:2175–2183. doi:10.1128/IAI.73.4.2175-2183.2005.
Pernthaner, A., R. J. Shaw, M. M. McNeill, L. Morrison, and W.
R. Hein. 2005b. Total and nematode-specific IgE responses
in intestinal lymph of genetically resistant and susceptible
sheep during infection with Trichostrongylus colubriformis.
Vet. Immunol. Immunopathol. 104:69–80. doi:10.1016/j.
vetimm.2004.10.008.
Pernthaner, A., M. Stankiewicz, W. Cabaj, A. Pfeffer, R. S. Green, and
P. G. Douch. 1996. Immune responsiveness of nematode-resistant or susceptible Romney line-bred sheep to continuous infection with Trichostrongylus axei. Vet. Immunol. Immunopathol.
51:137–146. doi:10.1016/0165-2427(95)05498-7.
Rainbird, M. A., D. Macmillan, and E. N. Meeusen. 1998.
Eosinophil-mediated killing of Haemonchus contortus larvae: Effect of eosinophil activation and role of antibody,
complement and interleukin-5. Parasite Immunol. 20:93–103.
doi:10.1046/j.1365-3024.1998.00132.x.
Trigona, W. L., W. C. Brown, and D. M. Estes. 1999. Functional
implications for signaling via the IL4R/IL13R complex
on bovine cells. Vet. Immunol. Immunopathol. 72:73–79.
doi:10.1016/S0165-2427(99)00117-8.
Vanimisetti, H. B., S. P. Greiner, A. M. Zajac, and D. R. Notter. 2004.
Performance of hair sheep composite breeds: Resistance of
lambs to Haemonchus contortus. J. Anim. Sci. 82:595–604.
Vervelde, L., N. Bakker, F. N. J. Kooyman, A. W. C. A. Cornelissen,
C. M. C. Bank, A. K. Nyame, R. D. Cummings, and I. van
Die. 2003. Vaccination-induced protection of lambs against
the parasitic nematode Haemonchus contortus correlates
with high IgG antibody responses to the LDNF glycan antigen. Glycobiology 13:795–804. doi:10.1093/glycob/cwg107.
Webb, D. C., Y. Cai, K. I. Matthaei, and P. S. Foster. 2007.
Comparative roles of IL-4, IL-13, and IL-4Rα in dendritic
cell maturation and CD4+ Th2 cell function. J. Immunol.
178:219–227. doi:10.4049/jimmunol.178.1.219.
Whitlock, H. V. 1948. Some modifications of the McMaster helminth egg-counting technique apparatus. J. Counc. Sci. Ind.
Res. 21:177–180.
Woolaston, R. R. 1992. Selection of Merino sheep for increased
and decreased resistance to Haemonchus contortus: Periparturient effects on faecal egg counts. Int. J. Parasitol.
22:947–953. doi:10.1016/0020-7519(92)90052-M.
Zajac, A. M., and G. A. Conboy. 2012. Veterinary clinical parasitology. 8th ed. Wiley-Blackwell, Hoboken, NJ.