Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Human microbiota wikipedia , lookup
Traveler's diarrhea wikipedia , lookup
Gene nomenclature wikipedia , lookup
Quorum sensing wikipedia , lookup
Triclocarban wikipedia , lookup
Community fingerprinting wikipedia , lookup
Carbapenem-resistant enterobacteriaceae wikipedia , lookup
Saccharomyces cerevisiae wikipedia , lookup
RESEARCH LETTER An improved Escherichia coli donor strain for diparental mating Sabrina Thoma & Max Schobert Institute of Microbiology, Technische Universität Braunschweig, Braunschweig, Germany Correspondence: Max Schobert, Institute of Microbiology, Technische Universität Braunschweig, Spielmannstr. 7, D-38106 Braunschweig, Germany. Tel.: 149 531 391 5857; fax: 149 531 391 5854; e-mail: [email protected] Received 16 September 2008; accepted 13 February 2009. First published online 23 March 2009. Abstract We present a new method for diparental mating with the outstanding advantage that counterselection of the Escherichia coli donor strain is not required. This improved method uses a new donor strain, E. coli ST18, a hemA deletion mutant defective in tetrapyrrole biosynthesis. The hemA mutation can be complemented by addition of 5-aminolevulinic acid. Therefore, counterselection is carried out only using standard media and growth conditions optimal for the recipient strain. Consequently, recipient strains are isolated in a significantly shorter period. DOI:10.1111/j.1574-6968.2009.01556.x Editor: Wilfrid Mitchell Keywords diparental mating; Escherichia coli; hemA; heme biosynthesis. Introduction Introduction of DNA into prokaryotes is an essential step for generating genetically modified organisms. Different methods were developed during the last few decades based on conjugation, transduction and transformation (Miller, 1992). The most common method for introduction of DNA into Escherichia coli is transformation of competent cells using heat shock or electroporation (Sambrook et al., 1989). Efficient transformation protocols for other bacteria have also been published (Potter, 1988; Wirth et al., 1989; Glenn et al., 1992; Choi et al., 2006). However, as transformation protocols are not available for all bacteria and as transformation efficiency decreases with increasing plasmid size, conjugation is still a method of choice to transfer DNA. Usually bacterial conjugation is carried out in mating experiments involving a donor and a recipient strain (Miller, 1992). The transfer of a conjugative plasmid requires an oriT (origin of transfer) and the gene products of the tra (transfer) and mob (mobilization) gene clusters (Firth et al., 1996; Lanka & Pansegrau, 1999). The E. coli S17lpir strain (Simon et al., 1983) is often used as donor for diparental matings with various gram-negative recipient strains such as Yersinia pseudotuberculosis (Rosqvist et al., FEMS Microbiol Lett 294 (2009) 127–132 1990), Salmonella dublin (Galyov et al., 1997), Burkholderia pseudomallei (Stevens et al., 2002), Caulobacter crescentus (Skerker & Shapiro, 2000) and gram-positive coryneform bacteria (Schäfer et al., 1990) and the actinobacterium Streptomyces toyocaensis (Solenberg et al., 1997). Escherichia coli S17lpir carries the transfer genes of the broadhost-range INcP-type plasmid RP4 integrated into the chromosome. Several methods for counterselection of the auxotroph E. coli S17lpir exist. One obvious possibility is counterselection using a minimal medium without proline and a carbon source that cannot be utilized by E. coli, for example minimal medium with 0.3% citrate (Hoang et al., 1998). One drawback of a minimal medium might be slower growth of the recipient strains, and it is clearly not applicable for auxotrophic recipient strains. Another possibility is the use of antibiotic-resistant recipient strains, and spontaneous rifampicin- or nalidixic acid-resistant recipients are often used (Nunn & Lidstrom, 1986; Miller, 1992). Some recipient strains such as Pseudomonas aeruginosa have a high intrinsic resistance to antibiotics, for example to chloramphenicol, a property that can be used for counterselection (Nehme & Poole, 2005). However, counterselection using antibiotics can result in physiological changes of the recipient strain during the mating procedure, for example, induction of efflux pumps (Teran et al., 2003). Moreover, isolation 2009 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c 128 and use of, for example, spontaneous rifampicin-resistant recipient strains is sometimes problematic as these resistant mutants have additional unwanted phenotypes (Jin & Gross, 1988). Pseudomonas aeruginosa clinical isolates from patients with cystic fibrosis are often auxotrophic and are not always accessible to electroporation (Diver et al., 1990). Diparental mating with E. coli as donor strain is problematic because the use of minimal medium for E. coli counterselection is not possible. Because of the possibility of secondary mutations or the induction of efflux pumps, the use of rifampicin-resistant clones or chloramphenicol is not appropriate. To avoid difficulties with counterselection of the donor strain, we generated an E. coli hemA knockout mutant (E. coli ST18), which requires 5-aminolevulinic acid (ALA) for growth. The hemA gene encodes a glutamyl-tRNA reductase, which catalyzes the first step of heme biosynthesis. Hemes are essential cofactors for energy conserving, electron transport complexes and for various enzymes and receptor proteins. In E. coli, ALA is synthesized by the C5-pathway from the five-carbon skeleton of glutamate in three enzymecatalyzed steps. If the glutamyl-tRNA reductase (HemA) is missing, E. coli is no longer able to synthesize tetrapyrroles for growth (Li et al., 1989; Chen et al., 1994). This mutation can be complemented by external addition of ALA, which allows growth to occur on rich medium. Here we show that the hemA deletion mutant of E. coli S17lpir (E. coli ST18) is a suitable donor strain for P. aeruginosa, Pseudomonas putida and Pseudomonas fluorescens. Furthermore, E. coli ST18 can also be used as a donor strain for the generation of P. aeruginosa transposon mutants using the Mariner transposon on a mobilizable suicide plasmid (Kulasekara et al., 2005). In addition, the Alphaproteobacteria, Rhodobacter capsulatus and Rhodobacter sphaeroides, which are popular model organisms for studies of the photochemical reaction center and nitrogen fixation, were successfully used as recipients. As no special medium, antibiotic or growth conditions are necessary to restrict growth of the E. coli donor strain, the recipient strain is obtained under optimal growth conditions in a significantly shorter time. Materials and methods Media and growth conditions For the selection of E. coli mutants and transformants, Luria–Bertani (LB) medium supplemented with kanamycin (25 mg mL1), ampicillin (10 mg mL1), chloramphenicol (34 mg mL1) or tetracycline (10 mg mL1) was used. Selection of transformed pseudomonads was achieved using LB or modified AB minimal medium (Heydorn et al., 2000; Schreiber et al., 2006) supplemented with 100 mg mL1 tetracycline 2009 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c S. Thoma & M. Schobert or 80 mg mL1 gentamicin. Rhodobacter strains were incubated aerobically in LB. After the mating with E. coli S17lpir, Rhodobacter transformants were selected under anaerobic conditions on LB medium supplemented with 0.2% (v/v) dimethyl sulfoxide (DMSO) as terminal electron acceptor (Donohue & Kaplan, 1991) and 1 mg mL1 tetracycline. For complementation of the E. coli hemA knockout mutant, a 50 mg mL1 stock solution of ALA in water was prepared. The final concentration of ALA in the growth medium was 50 mg mL1. Escherichia coli and P. aeruginosa were incubated at 37 1C. Pseudomonas fluorescens, P. putida and the Rhodobacter strains were incubated at 30 1C. The OD was measured at 578 nm. Bacteria and plasmids The strains and plasmids used in this study are shown in Table 1. For mating experiments two, E. coli donor strains were tested, E. coli S17lpir DhemA (ST18) and its parent strain, E. coli S17lpir (Simon et al., 1983). Growth conditions For growth experiments the wild-type E. coli S17lpir and the mutant E. coli ST18 were precultured overnight in 5 mL LB broth. The main culture (200 mL LB) was started by diluting the preculture of up to 4000-fold to a calculated OD578 nm of 0.001 and was incubated aerobically. The E. coli ST18 cultures were supplemented with 50 mg mL1 ALA as indicated. Construction of the hemA knockout in E. coli S17kpir For the generation of the E. coli S17lpir DhemA (ST18) knockout mutant, we used the method developed by Datsenko & Wanner (2000) to disrupt chromosomal genes in E. coli by replacing the gene of interest with a kanamycin resistance (kan) gene via recombination by the phage l Red recombinase system. Plasmid pKD13 carries a kan gene flanked by Flp recombination targets (FRT) sites, which are 65-nt recognition target sites for the site-specific Flp recombinase. This enzyme promotes recombination at a 13bp sequence within the 65-nt FRT site (Cox, 1983). After successful mutagenesis via the phage l Red recombinase system, the Flp recombinase eliminates the kan gene, thereby generating an unmarked mutant strain. The kan gene of pKD13 was amplified using primers homologous to the flanking sites of the plasmid pKD13, which in addition carried extensions homologous to the chromosomal regions adjacent to the hemA gene (pKD13hemA-fwd: 5 0 -AACG TTGGTATTATTTCCCGCAGACATGACCCTTTTAGCAAT TCCGGGGATCCGTCGACC-3 0 and pKD13hemA-rev: FEMS Microbiol Lett 294 (2009) 127–132 129 An improved donor strain for diparental mating Table 1. Strains and plasmids used in this study Bacterial strains or plasmids Genotypes or phenotypes Sources or References Pseudomonas aeruginosa PAO1 Pseudomonas putida KT2440 (ATCC 47054) Rhodobacter capsulatus ZY5 Rhodobacter sphaeroides 2.4.1 (ATCC 17023) Escherichia coli S17 lpir ST18 Plasmids pKD13 Wild type Wild type Wild type Wild type Dunn & Holloway (1971) Bagdasarian et al. (1981) Yang & Bauer (1990) ATCC pro thi hsdR1 Tpr Smr; chromosome::RP4-2 Tc::Mu-Kan::Tn7/lpir S17 lpir DhemA Simon et al. (1983) This study (DSM 22074) ApR KanR gene disruption system, carries kanamycin resistance gene flanked by FRT (FLP recognition target) sites ApR gene disruption system, carries genes for l Red recombinase system (a, b, exo) under control of an arabinose inducible promoter, temperature-sensitive replicon ApR, source of FLP recombinase TcR, cosmid cloning vector Mini-TnM delivery vector, ApR GmR Datsenko & Wanner (2000) pKD42 pFLP2 pLAFR3 pBT20 Datsenko & Wanner (2000) Hoang et al. (1998) Staskawicz et al. (1987) Kulasekara et al. (2005) Ap, ampicillin; Kan, kanamycin; Tc, tetracycline; Sm, streptomycin, Gm, gentamicin; Tp, trimethoprim. 5 0 -AAAAAGAAAATGATGTACTGCTACTCCAGCCCGAG GCTGTGTGTAGGCTGGAGCTGCTGCTTC-3 0 ). A PCR product was generated that consisted of the kan gene flanked by 40- and 43-bp sequences homologous to the regions adjacent to the hemA gene of E. coli. The plasmid pKD42 (Datsenko & Wanner, 2000) contains the genes of the phage l Red protein recombination machinery, consisting of three proteins: Gam, encoded by g, which inhibits the host RecBCD exonuclease V, as well as Bet (b) and Exo (exo), promoting recombination of the homologous DNA ends of the PCR product. This system was used to silence the E. coli S17lpir rec system, which is involved in exonuclease V-mediated degradation of linear DNA fragments, and thus results in better transformation and recombination rates. Kanamycin-resistant clones were selected on LB supplemented with 50 mg mL1 ALA and successful recombination was verified by PCR amplification of new junction fragments. The kanamycin-resistance cassette was then eliminated using the helper plasmid pFLP2 encoding the Flp recombinase. This recombinase promotes recombination of Flp FRT sites, which flank the antibiotic cassette, and thereby excises the cassette from the chromosome (Cherepanov & Wackernagel, 1995). The unmarked mutant was named E. coli ST18 and was used for diparental mating. ST18 is deposited at the German collection of microorganisms and cell cultures DSMZ (DSMZ 22074). Mating procedure E. coli ST18 and its parent strain E. coli S17lpir using calcium chloride competent cells (Sambrook et al., 1989). Separate cultures of donor and recipient were incubated aerobically overnight at 30 or 37 1C with shaking at 200 r.p.m in LB broth containing tetracycline or ALA if necessary. After incubation, the OD578 nm of the cultures was measured and adjusted to 6.0 with LB by dilution or concentration. Then 2 mL of the donor strain and 200 mL of the recipient were centrifuged for 1 min at 16 000 g. Pellets were resuspended in 50 mL LB broth and mixed. The suspension was dropped onto a dry agar plate and incubated for 6 h at 30 or 37 1C for pseudomonads, while matings with Rhodobacter strains were incubated aerobically for 72 h at 30 1C. After incubation, the cells were scraped off the agar plate and suspended in 1 mL LB broth. For determination of the mating efficiency, serial dilutions of a mating experiment were plated on agar plates under the conditions appropriate for selection against the respective donor strain with or without tetracycline to determine the ratio in percent between the total number of recipient strains and recipient strains containing the pLAFR3 plasmid. Selection against E. coli S17lpir Pseudomonads were plated on AB minimal medium containing the antibiotic tetracycline and glucose as single carbon source. They were incubated under aerobic conditions for 2 days. Rhodobacter strains were plated on LB medium with 0.2% DMSO and tetracycline and were incubated anaerobically for 5 days until the first colonies were visible. Growth of the precultures and mating We used the broad-host-range plasmid pLAFR3 for determination of the mating efficiency. This vector carries a tetracycline resistance cassette and was introduced into the donor strain FEMS Microbiol Lett 294 (2009) 127–132 Selection against E. coli ST18 Because of its deleted hemA gene, E. coli ST18 requires ALA for growth and is unable to grow on LB medium. Therefore, 2009 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c 130 optimal growth media can be selected for the recipient strains, with the appropriate antibiotic used to isolate those recipients that contain the transferred plasmid. Here we used LB medium containing tetracycline. Pseudomonads have to be incubated for 1 day and Rhodobacter species for 2 days under aerobic conditions. All determined mating efficiencies are the results of three independent mating procedures per strain. To verify the successful mating, tetracycline-resistant pseudomonads and Rhodobacter strains were cultivated and the plasmid pLAFR3 was recovered using plasmid preparation. Transposon mutagenesis The two donor strains E. coli S17lpir and E. coli ST18 containing pBT20 (Kulasekara et al., 2005) and the recipient P. aeruginosa were scraped from overnight plates and suspended in 500-mL LB broth. The OD578 nm was adjusted to 40 for the donor strains and to 20 for the recipient strain using LB medium. A 550-mL aliquot of each donor was mixed with 550 mL of the recipient, spotted onto dry LB agar plates and incubated for 2 h. The matings were scraped off and resuspended in 2 mL LB. The number of mutants was determined by plating on LB agar supplemented with gentamicin (E. coli ST18), and chloramphenicol was also added for selection against E. coli S17lpir. Approximately 1000 clones were screened for each donor to identify auxotrophic mutants by replica plating from LB plates to plates containing AB minimal medium, both supplemented with gentamicin. Results and discussion Phenotypic characterization of the hemA mutant The E. coli DhemA mutant ST18 requires ALA for growth. Initial experiments verified that LB medium alone did not support any growth (data not shown). We also did not observe any spontaneous suppressor mutants. Growth of an E. coli hemA deletion mutant on LB can be complemented by addition of 50 mg mL1 ALA, as described by others (Li et al., 1989; Chen et al., 1994). We compared the growth phenotypes of E. coli ST18 with its parent strain E. coli S17lpir (Fig. 1). Escherichia coli S17lpir grew with a generation time of 29 min up to an OD578 nm of 4.4. The DhemA mutant complemented with ALA grew with a generation time of 47 min to an OD578 nm of 4.24, in accordance with previous publications (Li et al., 1989; Chen et al., 1994). Mating efficiency The mating efficiency is defined as the ratio in percent of plasmid harboring recipient cells to all recipients. To deter2009 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c S. Thoma & M. Schobert Fig. 1. Growth curve of Escherichia coli S17lpir (’) and the hemAmutant E. coli ST18 (m) in LB medium and E. coli ST18 (&) in LB medium supplemented with 50 mg mL1 ALA at 37 1C with shaking at 200 r.p.m. under oxic conditions. mine the mating efficiency of E. coli S17lpir and ST18, the RK2-based broad-host-range plasmid pLAFR3 was introduced into both E. coli ST18 and the parent strain E. coli S17lpir. Mobilization of pLAFR3 from E. coli to several Pseudomonas and Rhodobacter strains was achieved as described in Materials and methods. Mating efficiencies in the range of 104–101% were obtained (Table 2). As expected, the mating efficiency depends primarily on the recipient strain, as described by others (Potter, 1988; Wirth et al., 1989; Glenn et al., 1992). The mating efficiency for P. fluorescens ranged from 3.43% (E. coli ST18) to 4.69% (E. coli S17lpir). Pseudomonas putida showed slightly lower mating efficiencies varying from 0.3% (E. coli ST18) to 0.56% (E. coli S17lpir). Rhodobacter strains displayed mating efficiencies in a similar range. For R. capsulatus a mating efficiency of 5.38% (E. coli ST18) and 6.36% (E. coli S17lpir) was determined and R. sphaeroides showed mating efficiencies of 0.79% (E. coli ST18) up to 2.12% (E. coli S17lpir). In contrast, we observed mating efficiencies of only 104% for P. aeruginosa, which might be due to the presence of restriction systems. There were only marginal differences in mating efficiencies between E. coli S17lpir and E. coli ST18, with the latter showing slightly lower efficiencies, for example 73% of the E. coli S17lpir mating efficiency with P. fluorescens or 37% with R. sphaeroides. However, the time requirements for the different mating procedures are notable. If a plasmid is transferred from E. coli S17lpir, plasmidharboring Pseudomonas recipient strains can be isolated after a period of 24 h. In contrast, plasmid-carrying strains can be isolated after 12 h if a plasmid has been transferred from the E. coli ST18 donor. Even more impressive is the time difference during the mating procedure with Rhodobacter strains. Plasmid-carrying strains can be isolated after 5 days when mating is carried out with E. coli S17lpir compared with only 2 days when E. coli ST18 is used. We also compared both E. coli donor strains during a transposon mutagenesis experiment. E. coli S17lpir and E. coli ST18 were transformed with the pBT20 suicide FEMS Microbiol Lett 294 (2009) 127–132 131 An improved donor strain for diparental mating Table 2. Mating efficiencies (in %) of Pseudomonas and Rhodobacter spp. with Escherichia coli S17lpir and E. coli ST18 donor strains transferring the pLAFR3 vector Donors Recipients Pseudomonas aeruginosa PAO1 Pseudomonas fluorescens Pseudomonas putida KT2440 Rhodobacter capsulatus Rhodobacter sphaeroides 2.4.1 Escherichia coli S17lpir 4 ST18 (Escherichia coli S17lpirDhemA) 4 1.95 104 1.60 105 3.43 0.72 0.30 0.10 5.38 0.49 0.79 0.15 8.12 10 1.66 10 4.69 0.93 0.56 0.24 6.36 0.74 2.12 0.19 The counterselections differ between Escherichia coli S17lpir and E. coli S17lpir ST18 as noted in Materials and methods. plasmid containing the Mariner transposon. Transposon mutagenesis was carried out as described in Materials and methods. We determined identical ratios in percent of transposon mutants of 2.0 106 and obtained about 30 000 mutants per mating experiment with P. aeruginosa. Moreover, we identified the number of auxotrophic mutants. We screened 1039 P. aeruginosa PAO1 transposon mutants generated via diparental mating with E. coli ST18 harboring pBT20 and identified 97 auxotrophic mutants (0.91%). After transposon mutagenesis with E. coli S17lpir, 909 mutants were screened and 0.89% auxotrophic mutants were identified, in accordance with values in the literature (Rella et al., 1985). Therefore, E. coli ST18 is also suitable for transposon mutagenesis with the advantage that no additional antibiotic such as chloramphenicol is needed for counterselection of the E. coli donor strain. Conclusion The hemA mutant strain E. coli ST18 requires 5-ALA for growth and therefore cannot grow on rich medium such as LB. When used as a conjugal donor, counterselection is not necessary and consequently the recipient strain can grow under optimal conditions. This advantage is significant, especially for slow-growing bacteria, as recipients can be recovered in a significantly shorter time. The method is also applicable for generation of transposon mutants. Acknowledgement S.T. was supported by funds of the Mukoviszidose e.V. References Bagdasarian M, Lurz R, Ruckert B, Franklin FC, Bagdasarian MM, Frey J & Timmis KN (1981) Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number, RSF1010-derived vectors, and a host–vector system for gene cloning in Pseudomonas. Gene 16: 237–247. FEMS Microbiol Lett 294 (2009) 127–132 Chen W, Russell CS, Murooka Y & Cosloy SD (1994) 5Aminolevulinic acid synthesis in Escherichia coli requires expression of hemA. J Bacteriol 176: 2743–2746. Cherepanov PP & Wackernagel W (1995) Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158: 9–14. Choi KH, Kumar A & Schweizer HP (2006) A 10-min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer between chromosomes and plasmid transformation. J Microbiol Meth 64: 391–397. Cox MM (1983) The FLP protein of the yeast 2-microns plasmid: expression of a eukaryotic genetic recombination system in Escherichia coli. P Natl Acad Sci USA 80: 4223–4227. Datsenko KA & Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. P Natl Acad Sci USA 97: 6640–6645. Diver JM, Bryan LE & Sokol PA (1990) Transformation of Pseudomonas aeruginosa by electroporation. Anal Biochem 189: 75–79. Donohue TJ & Kaplan S (1991) Genetic techniques in rhodospirillaceae. Method Enzymol 204: 459–485. Dunn NW & Holloway BW (1971) Pleiotrophy of p-fluorophenylalanine-resistant and antibiotic hypersensitive mutants of Pseudomonas aeruginosa. Genet Res 18: 185–197. Firth N, Ippen-Ihler K & Skurray RA (1996) Structure and function of the F factor and mechanism of conjugation. Escherichia coli and Salmonella, Cellular and Molecular Biology, Vol. II (Neidhardt FC et al., eds), pp. 2377–2401. ASM Press, Washington, DC. Galyov EE, Wood MW, Rosqvist R, Mullan PB, Watson PR, Hedges S & Wallis TS (1997) A secreted effector protein of Salmonella dublin is translocated into eukaryotic cells and mediates inflammation and fluid secretion in infected ileal mucosa. Mol Microbiol 25: 903–912. Glenn AW, Roberto FF & Ward TE (1992) Transformation of Acidiphilium by electroporation and conjugation. Can J Microbiol 38: 387–393. Heydorn A, Ersboll BK, Hentzer M, Parsek MR, Givskov M & Molin S (2000) Experimental reproducibility in flow-chamber biofilms. Microbiology 146: 2409–2415. 2009 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c 132 Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ & Schweizer HP (1998) A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212: 77–86. Jin DJ & Gross CA (1988) Mapping and sequencing of mutations in the Escherichia coli rpoB gene that lead to rifampicin resistance. J Mol Biol 202: 45–58. Kulasekara HD, Ventre I, Kulasekara BR, Lazdunski A, Filloux A & Lory S (2005) A novel two-component system controls the expression of Pseudomonas aeruginosa fimbrial cup genes. Mol Microbiol 55: 368–380. Lanka E & Pansegrau W (1999) Genetic exchange between microorganisms. Biology of Prokaryotes (Lengeler JW, Drews G & Schlegel HG, eds), pp. 386–415. Thieme, Stuttgardt. Li JM, Brathwaite O, Cosloy SD & Russell CS (1989) 5Aminolevulinic acid synthesis in Escherichia coli. J Bacteriol 171: 2547–2552. Miller JM (1992) A Short Course in Bacterial Genetics. A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Nehme D & Poole K (2005) Interaction of the MexA and MexB components of the MexAB-OprM multidrug efflux system of Pseudomonas aeruginosa: identification of MexA extragenic suppressors of a T578I mutation in MexB. Antimicrob Agents Ch 49: 4375–4378. Nunn DN & Lidstrom ME (1986) Isolation and complementation analysis of 10 methanol oxidation mutant classes and identification of the methanol dehydrogenase structural gene of Methylobacterium sp. strain AM1. J Bacteriol 166: 581–590. Potter H (1988) Electroporation in biology: methods, applications, and instrumentation. Anal Biochem 174: 361–373. Rella M, Mercenier A & Haas D (1985) Transposon insertion mutagenesis of Pseudomonas aeruginosa with a Tn5 derivative: application to physical mapping of the arc gene cluster. Gene 33: 293–303. Rosqvist R, Forsberg A, Rimpilainen M, Bergman T & Wolf-Watz H (1990) The cytotoxic protein YopE of Yersinia obstructs the primary host defence. Mol Microbiol 4: 657–667. 2009 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c S. Thoma & M. Schobert Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schäfer A, Kalinowski J, Simon R, Seep-Feldhaus AH & Puhler A (1990) High-frequency conjugal plasmid transfer from gramnegative Escherichia coli to various gram-positive coryneform bacteria. J Bacteriol 172: 1663–1666. Schreiber K, Boes N, Eschbach M, Jaensch L, Wehland J, Bjarnsholt T, Givskov M, Hentzer M & Schobert M (2006) Anaerobic survival of Pseudomonas aeruginosa by pyruvate fermentation requires an Usp-type stress protein. J Bacteriol 188: 659–668. Simon R, Priefer U & Pühler A (1983) A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology 1: 784–791. Skerker JM & Shapiro L (2000) Identification and cell cycle control of a novel pilus system in Caulobacter crescentus. EMBO J 19: 3223–3234. Solenberg PJ, Matsushima P, Stack DR, Wilkie SC, Thompson RC & Baltz RH (1997) Production of hybrid glycopeptide antibiotics in vitro and in Streptomyces toyocaensis. Chem Biol 4: 195–202. Staskawicz B, Dahlbeck D, Keen N & Napoli C (1987) Molecular characterization of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv. glycinea. J Bacteriol 169: 5789–5794. Stevens MP, Wood MW, Taylor LA et al. (2002) An Inv/Mxi-Spalike type III protein secretion system in Burkholderia pseudomallei modulates intracellular behaviour of the pathogen. Mol Microbiol 46: 649–659. Teran W, Felipe A, Segura A, Rojas A, Ramos JL & Gallegos MT (2003) Antibiotic-dependent induction of Pseudomonas putida DOT-T1E TtgABC efflux pump is mediated by the drug binding repressor TtgR. Antimicrob Agents Ch 47: 3067–3072. Wirth R, Friesenegger A & Fiedler S (1989) Transformation of various species of gram-negative bacteria belonging to 11 different genera by electroporation. Mol Gen Genet 216: 175–177. Yang ZM & Bauer CE (1990) Rhodobacter capsulatus genes involved in early steps of the bacteriochlorophyll biosynthetic pathway. J Bacteriol 172: 5001–5010. FEMS Microbiol Lett 294 (2009) 127–132