Download An improved Escherichia coli donor strain for diparental mating

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Human microbiota wikipedia , lookup

Traveler's diarrhea wikipedia , lookup

Gene nomenclature wikipedia , lookup

Quorum sensing wikipedia , lookup

Triclocarban wikipedia , lookup

Community fingerprinting wikipedia , lookup

Carbapenem-resistant enterobacteriaceae wikipedia , lookup

Saccharomyces cerevisiae wikipedia , lookup

Bacterial morphological plasticity wikipedia , lookup

Horizontal gene transfer wikipedia , lookup

Transcript
RESEARCH LETTER
An improved Escherichia coli donor strain for diparental mating
Sabrina Thoma & Max Schobert
Institute of Microbiology, Technische Universität Braunschweig, Braunschweig, Germany
Correspondence: Max Schobert, Institute of
Microbiology, Technische Universität
Braunschweig, Spielmannstr. 7, D-38106
Braunschweig, Germany. Tel.: 149 531 391
5857; fax: 149 531 391 5854; e-mail:
[email protected]
Received 16 September 2008; accepted 13
February 2009.
First published online 23 March 2009.
Abstract
We present a new method for diparental mating with the outstanding advantage
that counterselection of the Escherichia coli donor strain is not required. This
improved method uses a new donor strain, E. coli ST18, a hemA deletion mutant
defective in tetrapyrrole biosynthesis. The hemA mutation can be complemented
by addition of 5-aminolevulinic acid. Therefore, counterselection is carried out
only using standard media and growth conditions optimal for the recipient strain.
Consequently, recipient strains are isolated in a significantly shorter period.
DOI:10.1111/j.1574-6968.2009.01556.x
Editor: Wilfrid Mitchell
Keywords
diparental mating; Escherichia coli; hemA;
heme biosynthesis.
Introduction
Introduction of DNA into prokaryotes is an essential step
for generating genetically modified organisms. Different
methods were developed during the last few decades based
on conjugation, transduction and transformation (Miller,
1992). The most common method for introduction of DNA
into Escherichia coli is transformation of competent cells
using heat shock or electroporation (Sambrook et al., 1989).
Efficient transformation protocols for other bacteria have
also been published (Potter, 1988; Wirth et al., 1989; Glenn
et al., 1992; Choi et al., 2006). However, as transformation
protocols are not available for all bacteria and as transformation efficiency decreases with increasing plasmid size,
conjugation is still a method of choice to transfer DNA.
Usually bacterial conjugation is carried out in mating
experiments involving a donor and a recipient strain (Miller,
1992).
The transfer of a conjugative plasmid requires an oriT
(origin of transfer) and the gene products of the tra
(transfer) and mob (mobilization) gene clusters (Firth
et al., 1996; Lanka & Pansegrau, 1999). The E. coli S17lpir
strain (Simon et al., 1983) is often used as donor for
diparental matings with various gram-negative recipient
strains such as Yersinia pseudotuberculosis (Rosqvist et al.,
FEMS Microbiol Lett 294 (2009) 127–132
1990), Salmonella dublin (Galyov et al., 1997), Burkholderia
pseudomallei (Stevens et al., 2002), Caulobacter crescentus
(Skerker & Shapiro, 2000) and gram-positive coryneform
bacteria (Schäfer et al., 1990) and the actinobacterium
Streptomyces toyocaensis (Solenberg et al., 1997). Escherichia
coli S17lpir carries the transfer genes of the broadhost-range INcP-type plasmid RP4 integrated into the
chromosome. Several methods for counterselection of the
auxotroph E. coli S17lpir exist. One obvious possibility is
counterselection using a minimal medium without proline
and a carbon source that cannot be utilized by E. coli, for
example minimal medium with 0.3% citrate (Hoang et al.,
1998). One drawback of a minimal medium might be slower
growth of the recipient strains, and it is clearly not applicable for auxotrophic recipient strains. Another possibility is
the use of antibiotic-resistant recipient strains, and spontaneous rifampicin- or nalidixic acid-resistant recipients are
often used (Nunn & Lidstrom, 1986; Miller, 1992). Some
recipient strains such as Pseudomonas aeruginosa have a high
intrinsic resistance to antibiotics, for example to chloramphenicol, a property that can be used for counterselection
(Nehme & Poole, 2005). However, counterselection using
antibiotics can result in physiological changes of the recipient strain during the mating procedure, for example, induction of efflux pumps (Teran et al., 2003). Moreover, isolation
2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
128
and use of, for example, spontaneous rifampicin-resistant
recipient strains is sometimes problematic as these resistant
mutants have additional unwanted phenotypes (Jin &
Gross, 1988).
Pseudomonas aeruginosa clinical isolates from patients
with cystic fibrosis are often auxotrophic and are not always
accessible to electroporation (Diver et al., 1990). Diparental
mating with E. coli as donor strain is problematic because
the use of minimal medium for E. coli counterselection is
not possible. Because of the possibility of secondary mutations or the induction of efflux pumps, the use of rifampicin-resistant clones or chloramphenicol is not appropriate.
To avoid difficulties with counterselection of the donor
strain, we generated an E. coli hemA knockout mutant
(E. coli ST18), which requires 5-aminolevulinic acid (ALA)
for growth. The hemA gene encodes a glutamyl-tRNA reductase, which catalyzes the first step of heme biosynthesis.
Hemes are essential cofactors for energy conserving, electron
transport complexes and for various enzymes and receptor
proteins. In E. coli, ALA is synthesized by the C5-pathway
from the five-carbon skeleton of glutamate in three enzymecatalyzed steps. If the glutamyl-tRNA reductase (HemA) is
missing, E. coli is no longer able to synthesize tetrapyrroles
for growth (Li et al., 1989; Chen et al., 1994). This mutation
can be complemented by external addition of ALA, which
allows growth to occur on rich medium.
Here we show that the hemA deletion mutant of E. coli
S17lpir (E. coli ST18) is a suitable donor strain for
P. aeruginosa, Pseudomonas putida and Pseudomonas fluorescens. Furthermore, E. coli ST18 can also be used as a donor
strain for the generation of P. aeruginosa transposon mutants using the Mariner transposon on a mobilizable suicide
plasmid (Kulasekara et al., 2005). In addition, the Alphaproteobacteria, Rhodobacter capsulatus and Rhodobacter sphaeroides, which are popular model organisms for studies of the
photochemical reaction center and nitrogen fixation, were
successfully used as recipients. As no special medium,
antibiotic or growth conditions are necessary to restrict
growth of the E. coli donor strain, the recipient strain is
obtained under optimal growth conditions in a significantly
shorter time.
Materials and methods
Media and growth conditions
For the selection of E. coli mutants and transformants,
Luria–Bertani (LB) medium supplemented with kanamycin
(25 mg mL1), ampicillin (10 mg mL1), chloramphenicol
(34 mg mL1) or tetracycline (10 mg mL1) was used. Selection
of transformed pseudomonads was achieved using LB or
modified AB minimal medium (Heydorn et al., 2000; Schreiber et al., 2006) supplemented with 100 mg mL1 tetracycline
2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S. Thoma & M. Schobert
or 80 mg mL1 gentamicin. Rhodobacter strains were incubated aerobically in LB. After the mating with E. coli S17lpir,
Rhodobacter transformants were selected under anaerobic
conditions on LB medium supplemented with 0.2% (v/v)
dimethyl sulfoxide (DMSO) as terminal electron acceptor
(Donohue & Kaplan, 1991) and 1 mg mL1 tetracycline.
For complementation of the E. coli hemA knockout
mutant, a 50 mg mL1 stock solution of ALA in water was
prepared. The final concentration of ALA in the growth
medium was 50 mg mL1.
Escherichia coli and P. aeruginosa were incubated at 37 1C.
Pseudomonas fluorescens, P. putida and the Rhodobacter
strains were incubated at 30 1C. The OD was measured at
578 nm.
Bacteria and plasmids
The strains and plasmids used in this study are shown in
Table 1. For mating experiments two, E. coli donor strains
were tested, E. coli S17lpir DhemA (ST18) and its parent
strain, E. coli S17lpir (Simon et al., 1983).
Growth conditions
For growth experiments the wild-type E. coli S17lpir and
the mutant E. coli ST18 were precultured overnight in 5 mL
LB broth. The main culture (200 mL LB) was started by
diluting the preculture of up to 4000-fold to a calculated
OD578 nm of 0.001 and was incubated aerobically. The E. coli
ST18 cultures were supplemented with 50 mg mL1 ALA as
indicated.
Construction of the hemA knockout in
E. coli S17kpir
For the generation of the E. coli S17lpir DhemA (ST18)
knockout mutant, we used the method developed by Datsenko & Wanner (2000) to disrupt chromosomal genes in
E. coli by replacing the gene of interest with a kanamycin
resistance (kan) gene via recombination by the phage l Red
recombinase system. Plasmid pKD13 carries a kan gene
flanked by Flp recombination targets (FRT) sites, which
are 65-nt recognition target sites for the site-specific Flp
recombinase. This enzyme promotes recombination at a 13bp sequence within the 65-nt FRT site (Cox, 1983). After
successful mutagenesis via the phage l Red recombinase
system, the Flp recombinase eliminates the kan gene, thereby
generating an unmarked mutant strain. The kan gene of
pKD13 was amplified using primers homologous to the
flanking sites of the plasmid pKD13, which in addition
carried extensions homologous to the chromosomal regions
adjacent to the hemA gene (pKD13hemA-fwd: 5 0 -AACG
TTGGTATTATTTCCCGCAGACATGACCCTTTTAGCAAT
TCCGGGGATCCGTCGACC-3 0 and pKD13hemA-rev:
FEMS Microbiol Lett 294 (2009) 127–132
129
An improved donor strain for diparental mating
Table 1. Strains and plasmids used in this study
Bacterial strains or plasmids
Genotypes or phenotypes
Sources or References
Pseudomonas aeruginosa PAO1
Pseudomonas putida KT2440 (ATCC 47054)
Rhodobacter capsulatus ZY5
Rhodobacter sphaeroides 2.4.1 (ATCC 17023)
Escherichia coli
S17 lpir
ST18
Plasmids
pKD13
Wild type
Wild type
Wild type
Wild type
Dunn & Holloway (1971)
Bagdasarian et al. (1981)
Yang & Bauer (1990)
ATCC
pro thi hsdR1 Tpr Smr; chromosome::RP4-2 Tc::Mu-Kan::Tn7/lpir
S17 lpir DhemA
Simon et al. (1983)
This study (DSM 22074)
ApR KanR gene disruption system, carries kanamycin resistance gene
flanked by FRT (FLP recognition target) sites
ApR gene disruption system, carries genes for l Red recombinase
system (a, b, exo) under control of an arabinose inducible promoter,
temperature-sensitive replicon
ApR, source of FLP recombinase
TcR, cosmid cloning vector
Mini-TnM delivery vector, ApR GmR
Datsenko & Wanner (2000)
pKD42
pFLP2
pLAFR3
pBT20
Datsenko & Wanner (2000)
Hoang et al. (1998)
Staskawicz et al. (1987)
Kulasekara et al. (2005)
Ap, ampicillin; Kan, kanamycin; Tc, tetracycline; Sm, streptomycin, Gm, gentamicin; Tp, trimethoprim.
5 0 -AAAAAGAAAATGATGTACTGCTACTCCAGCCCGAG
GCTGTGTGTAGGCTGGAGCTGCTGCTTC-3 0 ). A PCR
product was generated that consisted of the kan gene flanked
by 40- and 43-bp sequences homologous to the regions
adjacent to the hemA gene of E. coli.
The plasmid pKD42 (Datsenko & Wanner, 2000) contains
the genes of the phage l Red protein recombination
machinery, consisting of three proteins: Gam, encoded by
g, which inhibits the host RecBCD exonuclease V, as well as
Bet (b) and Exo (exo), promoting recombination of the
homologous DNA ends of the PCR product. This system
was used to silence the E. coli S17lpir rec system, which is
involved in exonuclease V-mediated degradation of linear
DNA fragments, and thus results in better transformation
and recombination rates. Kanamycin-resistant clones were
selected on LB supplemented with 50 mg mL1 ALA and
successful recombination was verified by PCR amplification
of new junction fragments. The kanamycin-resistance cassette was then eliminated using the helper plasmid pFLP2
encoding the Flp recombinase. This recombinase promotes
recombination of Flp FRT sites, which flank the antibiotic
cassette, and thereby excises the cassette from the chromosome (Cherepanov & Wackernagel, 1995). The unmarked
mutant was named E. coli ST18 and was used for diparental
mating. ST18 is deposited at the German collection of
microorganisms and cell cultures DSMZ (DSMZ 22074).
Mating procedure
E. coli ST18 and its parent strain E. coli S17lpir using calcium
chloride competent cells (Sambrook et al., 1989). Separate
cultures of donor and recipient were incubated aerobically
overnight at 30 or 37 1C with shaking at 200 r.p.m in LB broth
containing tetracycline or ALA if necessary. After incubation,
the OD578 nm of the cultures was measured and adjusted to 6.0
with LB by dilution or concentration. Then 2 mL of the donor
strain and 200 mL of the recipient were centrifuged for 1 min at
16 000 g. Pellets were resuspended in 50 mL LB broth and
mixed. The suspension was dropped onto a dry agar plate and
incubated for 6 h at 30 or 37 1C for pseudomonads, while
matings with Rhodobacter strains were incubated aerobically
for 72 h at 30 1C. After incubation, the cells were scraped off the
agar plate and suspended in 1 mL LB broth.
For determination of the mating efficiency, serial dilutions
of a mating experiment were plated on agar plates under the
conditions appropriate for selection against the respective
donor strain with or without tetracycline to determine the
ratio in percent between the total number of recipient strains
and recipient strains containing the pLAFR3 plasmid.
Selection against E. coli S17lpir
Pseudomonads were plated on AB minimal medium containing the antibiotic tetracycline and glucose as single carbon
source. They were incubated under aerobic conditions for
2 days. Rhodobacter strains were plated on LB medium with
0.2% DMSO and tetracycline and were incubated anaerobically for 5 days until the first colonies were visible.
Growth of the precultures and mating
We used the broad-host-range plasmid pLAFR3 for determination of the mating efficiency. This vector carries a tetracycline
resistance cassette and was introduced into the donor strain
FEMS Microbiol Lett 294 (2009) 127–132
Selection against E. coli ST18
Because of its deleted hemA gene, E. coli ST18 requires ALA
for growth and is unable to grow on LB medium. Therefore,
2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
130
optimal growth media can be selected for the recipient
strains, with the appropriate antibiotic used to isolate those
recipients that contain the transferred plasmid. Here we
used LB medium containing tetracycline. Pseudomonads
have to be incubated for 1 day and Rhodobacter species for
2 days under aerobic conditions.
All determined mating efficiencies are the results of three
independent mating procedures per strain. To verify the
successful mating, tetracycline-resistant pseudomonads and
Rhodobacter strains were cultivated and the plasmid pLAFR3
was recovered using plasmid preparation.
Transposon mutagenesis
The two donor strains E. coli S17lpir and E. coli ST18
containing pBT20 (Kulasekara et al., 2005) and the recipient
P. aeruginosa were scraped from overnight plates and suspended in 500-mL LB broth. The OD578 nm was adjusted to 40
for the donor strains and to 20 for the recipient strain using
LB medium. A 550-mL aliquot of each donor was mixed with
550 mL of the recipient, spotted onto dry LB agar plates and
incubated for 2 h. The matings were scraped off and resuspended in 2 mL LB. The number of mutants was determined
by plating on LB agar supplemented with gentamicin (E. coli
ST18), and chloramphenicol was also added for selection
against E. coli S17lpir. Approximately 1000 clones were
screened for each donor to identify auxotrophic mutants by
replica plating from LB plates to plates containing AB
minimal medium, both supplemented with gentamicin.
Results and discussion
Phenotypic characterization of the hemA
mutant
The E. coli DhemA mutant ST18 requires ALA for growth.
Initial experiments verified that LB medium alone did not
support any growth (data not shown). We also did not
observe any spontaneous suppressor mutants. Growth of an
E. coli hemA deletion mutant on LB can be complemented
by addition of 50 mg mL1 ALA, as described by others
(Li et al., 1989; Chen et al., 1994). We compared the growth
phenotypes of E. coli ST18 with its parent strain E. coli
S17lpir (Fig. 1). Escherichia coli S17lpir grew with a
generation time of 29 min up to an OD578 nm of 4.4. The
DhemA mutant complemented with ALA grew with a
generation time of 47 min to an OD578 nm of 4.24, in
accordance with previous publications (Li et al., 1989; Chen
et al., 1994).
Mating efficiency
The mating efficiency is defined as the ratio in percent of
plasmid harboring recipient cells to all recipients. To deter2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S. Thoma & M. Schobert
Fig. 1. Growth curve of Escherichia coli S17lpir (’) and the hemAmutant E. coli ST18 (m) in LB medium and E. coli ST18 (&) in LB medium
supplemented with 50 mg mL1 ALA at 37 1C with shaking at 200 r.p.m.
under oxic conditions.
mine the mating efficiency of E. coli S17lpir and ST18, the
RK2-based broad-host-range plasmid pLAFR3 was introduced into both E. coli ST18 and the parent strain E. coli
S17lpir. Mobilization of pLAFR3 from E. coli to several
Pseudomonas and Rhodobacter strains was achieved as described in Materials and methods. Mating efficiencies in the
range of 104–101% were obtained (Table 2). As expected,
the mating efficiency depends primarily on the recipient
strain, as described by others (Potter, 1988; Wirth et al.,
1989; Glenn et al., 1992). The mating efficiency for
P. fluorescens ranged from 3.43% (E. coli ST18) to 4.69%
(E. coli S17lpir). Pseudomonas putida showed slightly lower
mating efficiencies varying from 0.3% (E. coli ST18) to
0.56% (E. coli S17lpir). Rhodobacter strains displayed mating efficiencies in a similar range. For R. capsulatus a mating
efficiency of 5.38% (E. coli ST18) and 6.36% (E. coli S17lpir)
was determined and R. sphaeroides showed mating efficiencies of 0.79% (E. coli ST18) up to 2.12% (E. coli S17lpir). In
contrast, we observed mating efficiencies of only 104% for
P. aeruginosa, which might be due to the presence of
restriction systems. There were only marginal differences in
mating efficiencies between E. coli S17lpir and E. coli ST18,
with the latter showing slightly lower efficiencies, for example 73% of the E. coli S17lpir mating efficiency with
P. fluorescens or 37% with R. sphaeroides. However, the time
requirements for the different mating procedures are notable. If a plasmid is transferred from E. coli S17lpir, plasmidharboring Pseudomonas recipient strains can be isolated
after a period of 24 h. In contrast, plasmid-carrying strains
can be isolated after 12 h if a plasmid has been transferred
from the E. coli ST18 donor. Even more impressive is the
time difference during the mating procedure with Rhodobacter strains. Plasmid-carrying strains can be isolated after
5 days when mating is carried out with E. coli S17lpir
compared with only 2 days when E. coli ST18 is used.
We also compared both E. coli donor strains during a
transposon mutagenesis experiment. E. coli S17lpir and
E. coli ST18 were transformed with the pBT20 suicide
FEMS Microbiol Lett 294 (2009) 127–132
131
An improved donor strain for diparental mating
Table 2. Mating efficiencies (in %) of Pseudomonas and Rhodobacter spp. with Escherichia coli S17lpir and E. coli ST18 donor strains transferring the
pLAFR3 vector
Donors
Recipients
Pseudomonas aeruginosa PAO1
Pseudomonas fluorescens
Pseudomonas putida KT2440
Rhodobacter capsulatus
Rhodobacter sphaeroides 2.4.1
Escherichia coli S17lpir
4
ST18 (Escherichia coli S17lpirDhemA)
4
1.95 104 1.60 105
3.43 0.72
0.30 0.10
5.38 0.49
0.79 0.15
8.12 10 1.66 10
4.69 0.93
0.56 0.24
6.36 0.74
2.12 0.19
The counterselections differ between Escherichia coli S17lpir and E. coli S17lpir ST18 as noted in Materials and methods.
plasmid containing the Mariner transposon. Transposon
mutagenesis was carried out as described in Materials and
methods. We determined identical ratios in percent of
transposon mutants of 2.0 106 and obtained about
30 000 mutants per mating experiment with P. aeruginosa.
Moreover, we identified the number of auxotrophic mutants. We screened 1039 P. aeruginosa PAO1 transposon
mutants generated via diparental mating with E. coli ST18
harboring pBT20 and identified 97 auxotrophic mutants
(0.91%). After transposon mutagenesis with E. coli S17lpir,
909 mutants were screened and 0.89% auxotrophic mutants
were identified, in accordance with values in the literature
(Rella et al., 1985). Therefore, E. coli ST18 is also suitable for
transposon mutagenesis with the advantage that no additional antibiotic such as chloramphenicol is needed for
counterselection of the E. coli donor strain.
Conclusion
The hemA mutant strain E. coli ST18 requires 5-ALA for
growth and therefore cannot grow on rich medium such as
LB. When used as a conjugal donor, counterselection is not
necessary and consequently the recipient strain can grow
under optimal conditions. This advantage is significant,
especially for slow-growing bacteria, as recipients can be
recovered in a significantly shorter time. The method is also
applicable for generation of transposon mutants.
Acknowledgement
S.T. was supported by funds of the Mukoviszidose e.V.
References
Bagdasarian M, Lurz R, Ruckert B, Franklin FC, Bagdasarian
MM, Frey J & Timmis KN (1981) Specific-purpose plasmid
cloning vectors. II. Broad host range, high copy number,
RSF1010-derived vectors, and a host–vector system for gene
cloning in Pseudomonas. Gene 16: 237–247.
FEMS Microbiol Lett 294 (2009) 127–132
Chen W, Russell CS, Murooka Y & Cosloy SD (1994) 5Aminolevulinic acid synthesis in Escherichia coli requires
expression of hemA. J Bacteriol 176: 2743–2746.
Cherepanov PP & Wackernagel W (1995) Gene disruption in
Escherichia coli: TcR and KmR cassettes with the option of
Flp-catalyzed excision of the antibiotic-resistance
determinant. Gene 158: 9–14.
Choi KH, Kumar A & Schweizer HP (2006) A 10-min method for
preparation of highly electrocompetent Pseudomonas
aeruginosa cells: application for DNA fragment transfer
between chromosomes and plasmid transformation. J
Microbiol Meth 64: 391–397.
Cox MM (1983) The FLP protein of the yeast 2-microns plasmid:
expression of a eukaryotic genetic recombination system in
Escherichia coli. P Natl Acad Sci USA 80: 4223–4227.
Datsenko KA & Wanner BL (2000) One-step inactivation of
chromosomal genes in Escherichia coli K-12 using PCR
products. P Natl Acad Sci USA 97: 6640–6645.
Diver JM, Bryan LE & Sokol PA (1990) Transformation of
Pseudomonas aeruginosa by electroporation. Anal Biochem
189: 75–79.
Donohue TJ & Kaplan S (1991) Genetic techniques in
rhodospirillaceae. Method Enzymol 204: 459–485.
Dunn NW & Holloway BW (1971) Pleiotrophy of
p-fluorophenylalanine-resistant and antibiotic hypersensitive
mutants of Pseudomonas aeruginosa. Genet Res 18: 185–197.
Firth N, Ippen-Ihler K & Skurray RA (1996) Structure and
function of the F factor and mechanism of conjugation.
Escherichia coli and Salmonella, Cellular and Molecular Biology,
Vol. II (Neidhardt FC et al., eds), pp. 2377–2401. ASM Press,
Washington, DC.
Galyov EE, Wood MW, Rosqvist R, Mullan PB, Watson PR,
Hedges S & Wallis TS (1997) A secreted effector protein of
Salmonella dublin is translocated into eukaryotic cells and
mediates inflammation and fluid secretion in infected ileal
mucosa. Mol Microbiol 25: 903–912.
Glenn AW, Roberto FF & Ward TE (1992) Transformation of
Acidiphilium by electroporation and conjugation. Can J
Microbiol 38: 387–393.
Heydorn A, Ersboll BK, Hentzer M, Parsek MR, Givskov M &
Molin S (2000) Experimental reproducibility in flow-chamber
biofilms. Microbiology 146: 2409–2415.
2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
132
Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ & Schweizer HP
(1998) A broad-host-range Flp-FRT recombination system for
site-specific excision of chromosomally-located DNA
sequences: application for isolation of unmarked Pseudomonas
aeruginosa mutants. Gene 212: 77–86.
Jin DJ & Gross CA (1988) Mapping and sequencing of mutations
in the Escherichia coli rpoB gene that lead to rifampicin
resistance. J Mol Biol 202: 45–58.
Kulasekara HD, Ventre I, Kulasekara BR, Lazdunski A, Filloux A
& Lory S (2005) A novel two-component system controls the
expression of Pseudomonas aeruginosa fimbrial cup genes. Mol
Microbiol 55: 368–380.
Lanka E & Pansegrau W (1999) Genetic exchange between
microorganisms. Biology of Prokaryotes (Lengeler JW, Drews G
& Schlegel HG, eds), pp. 386–415. Thieme, Stuttgardt.
Li JM, Brathwaite O, Cosloy SD & Russell CS (1989) 5Aminolevulinic acid synthesis in Escherichia coli. J Bacteriol
171: 2547–2552.
Miller JM (1992) A Short Course in Bacterial Genetics. A
Laboratory Manual and Handbook for Escherichia coli and
Related Bacteria. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY.
Nehme D & Poole K (2005) Interaction of the MexA and MexB
components of the MexAB-OprM multidrug efflux system of
Pseudomonas aeruginosa: identification of MexA extragenic
suppressors of a T578I mutation in MexB. Antimicrob Agents
Ch 49: 4375–4378.
Nunn DN & Lidstrom ME (1986) Isolation and
complementation analysis of 10 methanol oxidation mutant
classes and identification of the methanol dehydrogenase
structural gene of Methylobacterium sp. strain AM1. J Bacteriol
166: 581–590.
Potter H (1988) Electroporation in biology: methods,
applications, and instrumentation. Anal Biochem 174:
361–373.
Rella M, Mercenier A & Haas D (1985) Transposon insertion
mutagenesis of Pseudomonas aeruginosa with a Tn5 derivative:
application to physical mapping of the arc gene cluster. Gene
33: 293–303.
Rosqvist R, Forsberg A, Rimpilainen M, Bergman T & Wolf-Watz
H (1990) The cytotoxic protein YopE of Yersinia obstructs the
primary host defence. Mol Microbiol 4: 657–667.
2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S. Thoma & M. Schobert
Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY.
Schäfer A, Kalinowski J, Simon R, Seep-Feldhaus AH & Puhler A
(1990) High-frequency conjugal plasmid transfer from gramnegative Escherichia coli to various gram-positive coryneform
bacteria. J Bacteriol 172: 1663–1666.
Schreiber K, Boes N, Eschbach M, Jaensch L, Wehland J,
Bjarnsholt T, Givskov M, Hentzer M & Schobert M (2006)
Anaerobic survival of Pseudomonas aeruginosa by pyruvate
fermentation requires an Usp-type stress protein. J Bacteriol
188: 659–668.
Simon R, Priefer U & Pühler A (1983) A broad host range
mobilization system for in vivo genetic engineering:
transposon mutagenesis in gram negative bacteria.
Biotechnology 1: 784–791.
Skerker JM & Shapiro L (2000) Identification and cell cycle
control of a novel pilus system in Caulobacter crescentus.
EMBO J 19: 3223–3234.
Solenberg PJ, Matsushima P, Stack DR, Wilkie SC, Thompson RC
& Baltz RH (1997) Production of hybrid glycopeptide
antibiotics in vitro and in Streptomyces toyocaensis. Chem Biol
4: 195–202.
Staskawicz B, Dahlbeck D, Keen N & Napoli C (1987) Molecular
characterization of cloned avirulence genes from race 0 and
race 1 of Pseudomonas syringae pv. glycinea. J Bacteriol 169:
5789–5794.
Stevens MP, Wood MW, Taylor LA et al. (2002) An Inv/Mxi-Spalike type III protein secretion system in Burkholderia
pseudomallei modulates intracellular behaviour of the
pathogen. Mol Microbiol 46: 649–659.
Teran W, Felipe A, Segura A, Rojas A, Ramos JL & Gallegos MT
(2003) Antibiotic-dependent induction of Pseudomonas
putida DOT-T1E TtgABC efflux pump is mediated by the drug
binding repressor TtgR. Antimicrob Agents Ch 47: 3067–3072.
Wirth R, Friesenegger A & Fiedler S (1989) Transformation of
various species of gram-negative bacteria belonging to 11
different genera by electroporation. Mol Gen Genet 216:
175–177.
Yang ZM & Bauer CE (1990) Rhodobacter capsulatus genes
involved in early steps of the bacteriochlorophyll biosynthetic
pathway. J Bacteriol 172: 5001–5010.
FEMS Microbiol Lett 294 (2009) 127–132