Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
International Journal of Engineering & Technology IJET-IJENS Vol:15 No:04 1 A New DNA-Based S-Box Auday H. Al-Wattar, Ramlan Mahmod , Zuriati Ahmad Zukarnain, and Nur Izura Udzir, Faculty of Computer Science and Information Technology, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor. Abstract— Recently, many scholars have tried to design new security methods inspired by biological techniques, as DNA, Some of which are in the domains of cryptography and steganography. In this article, a new DNA-based S-Box was designed inspired by biology DNA techniques to be used for SPN symmetric block ciphers. The new DNA-base S-Box is used in order to reduce the calculations process in addition to make use of the unknown randomness of DNA bases in creating the S-box. This article uses the new DNA-based S-Box within the AES (Advanced Encryption Standard). The Encryption Standard).The S-Box testing criteria were performed to assess the security of the new S-Box. The National Institute of Standard and Technology (NIST) tests have been used to test the cipher which uses this new DNA based S-Box. The outcome of the tests shows that proposed S-box has good security, as well as it is passed all the randomness tests. Index Term— cryptography algorithm, block cipher, DNA, AES, S-Box, randomness, state. I. INTRODUCTION In the field of cryptography and for any symmetric encryption algorithm, the S-Box (substitution box) is the only nonlinear unit of the symmetric encryption algorithms which performs substitution [1].Usually, Usually, the cipher uses the S-box to build the association of the key and the cryptosystem, which is called confusion as Shannon [2]. Since the security of the entire encryption system depends on the S-box, the better the design of the S-box will result in the most secure encryption system as a whole [3-5]. Based on this concept can be considered one of the most important for the design, modification or work with the cipher S-box is to improve the entire cipher and make it completely immune and safe. There are many approaches used by researchers in the design and modification of the S-boxes, as in [6], [7], [8], [9], [10] . Some researchers explored the use of a dynamic and Key-depend-S-Box to enhance the security of block ciphers, as in [11] [12] [1] [13] [14] and [15]. The using of DNA as a form of cryptography is still in the preliminary stage. One of the most important reasons is the need for a high-tech laboratory, and a method that obviates the highly labor intensive means of extrapolation. However, this challenge has led researchers to find an alternative process to the use of cryptography DNA using DNA digital cryptography or pseudo DNA cryptography. This type of cryptography is inspired by the process of real DNA. A number of studies have been conducted in the context of DNA cryptography,[16] proposed DNA One-Time Pad, that hides information in DNA strands as a steganography, and [17] proposed a virtual DNA major cryptographic method employed initiatives central dogma of molecular biology. In addition to [18] which launched a new cryptographic technique which depends on the central dogma of molecular biology. Many others have adopted the proposition of different new cryptographic techniques that are inspired by actual DNA techniques such as [19] [20] [21] [22, 23], Another group of researchers specialized in the design of DNA-based algorithms, that provide security for images and videos[24-31]. Although all previous works on DNA have concentrated on proposing a cryptographic method inspired from the real DNA, no one has proposed or suggested an S-box that is designed or created using DNA structure and bio-inspired techniques. This paper proposes a novel technique for gaining a powerful (8 × 8) S-Box based on operations that have been inspired from really biological DNA structure and processes. Subsequently, it tests the new S-Box using the SBox testing criteria and the NIST randomness tests for the cryptosystem that used the DNA-based S-box. II. CRYPTOSYSTEM Cryptosystem is a technique that allows some parties to communicate securely. Generally the cryptosystem consists of a number of elements: plaintext P , key K as input, and t ciphertext C as output. The encryption and decryption t methods as E , and D respectively. k k The mathematic represent of the cryprosystem is as follows: ∀ k ∈ K ∃ 𝐸𝑘 and 𝐷𝑘 : 𝐷𝑘 (𝐸𝑘 (𝑠)) = s ∀ s ∈ 𝑃t . A. Substitution Box (S-Box) S-box is the main non-linear transformation of an encryption algorithm which replaces a set of input bits with a different set of bits known as its output bits. If S-Box denoted by: 𝜋𝑠 then: 𝜋𝑠 : {0,1}𝑛 ⟶ {0,1}𝑛 where n represent the number of input and out bits for S-box. 150204-7373-IJET-IJENS © August 2015 IJENS IJENS International Journal of Engineering & Technology IJET-IJENS Vol:15 No:04 B. AES block cipher In October 2000, NIST declared that Rijndael had been chosen as the intended AES. It is an iterated symmetric block cipher cryptosystem follows the formation of the Substitution-Permutation Network (SPN) [32-35], where it is works on segments of data with fixed-length called blocks, that affect the identical transformation of every block. The AES rounds are approximately equal, but the first and last rounds are a slight specialty. For complete encryption, the data passes Nr rounds (Nr: = 10, 12, and 14), with key size 128,194 and 256 respectively.Regardless the number of rounds for the algorithm, each round is made up of four transformations, as follows: [32]. --First, ShiftRow transformation. --Second, MixColumn transformation. --Third, Round Key addition. --Fourth, ByteSub transformation 2 algorithm It is one of the security testing tools that are used to evaluate the confusion and diffusion properties for the new encryption system, according to [39] and [40]..The test judges if the production of convincing algorithms under test conditions shows features that suggest that the outputs are randomly generated. The NIST test suite consists of 15 tests [41], The guidelines issued by NIST reports these tests and their related aims as: --Frequency (Monobit) Test This is the most important part of the NIST test in which all subsequent tests are based on passing this test. The intent of this test is to determine whether the appearance of ones and zeros in a sequence is as identical as would be expected for a truly random sequence. The test assesses the vicinity of the portion of ½. --Frequency Test within a Block The idea of this assay is to determine whether the frequency of a block of fixed size is around the (block size) / 2, as anticipated in the case assuming randomness. III. DNA BACKGROUND DNA (nucleic acid Deoxyribo) is considered to be the genetic pattern of existing creatures. All the individual cells in the body have a full set of DNA. It is a polymer made from monomers named deoxyribo nucleotides. A single-strand of DNA is composed of a sequence of molecules named bases, which stick out from a sugarphosphate backbone, the bases are defined as four characters {A, C, G, and T}[36, 37]. One of the most basic features of the DNA strand sequence is that it is oriented; accordingly, TTCA is distinct from ACTT. Typically the DNA strands exist as paired, reverse complementary words or strands: The Watson-Crick Double helix, with its four letters, A, C, G and T paired via A¯ = T and C¯ = G. Corresponding DNA codes could involve the insertion-deletion metric — with bounded similarity between two strands [38]. The graphics will stay in the “second” column, but you can drag them to the first column. Make the graphic wider to push out any text that may try to fill in next to the graphic. Central dogma is one of the most important processes for biological molecules. It is includes some processes of DNA, such as replication, transcription and translation, As in Fig. 1, Fig. 1. Central dogma process. One of biological DNA process which is consists of a number of methods that are used as inspiration for design the new S-box. IV. THE NIST SUITE RANDOMNESS TEST The NIST Test Suite is a set of statistical tests for randomness used by NIST to evaluate cryptographic --Runs Test It is concerned with the complete number of runs in the sequence. A run is a continuous sequence of the same bits. The aim of this test is to settle if the amount of runs of ones and zeros of different sizes is as predictable for a random sequence. --Test for the Longest Run of Ones in a Block It is concerned with the test of the longest run of ones within fixed bit length blocks. The objective of this test is to determine whether the length of the longest run of ones of the tested sequence is homogeneous with that which would be predictable in a random sequence. --Binary Matrix Rank Test This test is concerned with the rank of disjoint submatrices of the entire sequence. The objective of this test is to confirm the linear reliance among fixed size substrings of the genuine sequence. --Discrete Fourier Transform (Spectral) Test It is concerned with the peak heights in the Discrete Fourier Transform of the sequence. The objective of this test is to discover periodic features in the checked sequence that would specify an aberration from the randomness supposition; however, the main aim is to see if the amount of peaks surpassing the 95 % threshold is extensively more diverse than 5 %. --Non-overlapping Template Matching Test It is concerned with the amount of happenings of a predetermined target series. The objective of this test is to reveal generators that create too much happening of a specified non-episodic model. --Overlapping Template Matching Test It is same as the Non-Overlapping Template Matching 150204-7373-IJET-IJENS © August 2015 IJENS IJENS International Journal of Engineering & Technology IJET-IJENS Vol:15 No:04 Test; the only difference between them is that in this test when the pattern is detected or found, the window slides just a bit before seeking continues. --Maurer’s “Universal Statistical” Test It is concerned with the number of bits between (matching) identical patterns. The objective of this test is to discover whether or not the sequence can be significantly compressed without loss of information. A considerably compressible sequence is believed to be non-random. --Linear Complexity Test It is concerned with the size of a linear feedback shift register (LFSR). The objective this test is to decide whether or not the sequence is complex enough to be considered random and has the required complexity. --Serial Test It is concerned with the frequency of all likely overlapping k-bit patterns throughout the whole sequence. The objective of this test is to decide whether the amount of happenings of the 2kk-bit overlapping patterns is just about alike as would be supposed for a random sequence. --Approximate Entropy Test It is concerned with the frequency of all possible overlapping k-bit patterns throughout the whole sequence. The objective of this test is the comparison of the overlapping block frequency for two consecutive/adjacent lengths (k and k+1) against the expected result in a random sequence. --Cumulative Sums (Cusum) Test It is concerned with the highest jaunt (from zero) of the random step, which is defined by the accruing sum of amended (-1, +1) digits in the sequence. The objective of this test is to decide whether the cumulative sum of the partial sequences happening in the tested sequence is very great or tiny in size, in respect of the guessed action of that cumulative sum of random sequences. --Random Excursions Test It is concerned with the amount of cycles having accurate K trips in a cumulative sum random walk. The objective of this test is to see if the amount of visits to a specific state in a cycle deviates from what one would expected for a random sequence. --Random Excursions Variant Test It concerned with the entire amount of times that a specific state is happening in a cumulative sum random walk. The objective of this test is to see the differences from the anticipated amount of visits to a variety of states in the random walk. This test is actually a series of eighteen tests. V. S-BOX TESTS CRITERIA There are a number of criteria that S-boxes must meet to be considered a good S-Box. --Balanced If the S-Box has the same number of one’s and zeroes, it 3 indicates that they are balanced, which is one of most important characteristics of an S-box. --Completeness The S-boxes are complete if every output bit depends on all of the input bits [37]. The function Y is considered complete if there is at least one pair of plaintext vectors (z and zi ), such that: (z and zi ) are n bit vectors that vary in just one bit i , and,Y(z)and Y( zi ) vary at least in bit h, for all {i, h ∶ 1 ≤ i, h ≤ n} --Avalanche criterion The avalanche effect is an extremely eligible feature of block ciphers accompanying the computing of diffusion. Usually, a block cipher is considered to reveal the avalanche effect if for a single change in a single bit of the input, the output varies drastically [37, 42, 43]. These relations could be described by certain terms: Cu A Vector, where, all its bits are (0s), except the bit (i), which is (1) AV Cu Avalanche vector represents the difference in the output string as a result of the changing of bit (i) at the input string: 𝑐𝑢 AV Cu = 𝑌(𝑥) ⊕ 𝑌(𝑥 ⊕ 𝑐𝑖 ) = 𝑎𝑣1𝑐𝑢 𝑎𝑣2𝑐𝑢 𝑎𝑣3𝑐𝑢 … 𝑎𝑣𝑚 Formally, the avalanche criterion can (1) be represented as: 𝑆 ∶ {0,1}𝑚 → {0,1}𝑚 A function It meets the Avalanche criterion if one input bit is complementing, usually, half of the output bits alter. For a square m X m S-Box, S is said to satisfy the avalanche criterion if for every u ∈ (1, . . , 2m ): 1 2𝑛 𝑛 𝑐 ∑ 𝑊( 𝑎𝑣𝑣 𝑢 ) = 𝑣=1 𝑛 2 (2) Where (u, v) are the inputs and outputs bits, respectively, such that𝑢, 𝑣 ∈ (1, . . , 2𝑛 ), and: ∑ 𝑐 (𝑎𝑣𝑣 𝑢 ) (3) 𝑎𝑙𝑙 𝑥∈{0,1}𝑛 Avalanche Effect = 1 𝑚2𝑚 𝑐𝑢 ∑𝑚 𝑣=1 𝑊( 𝑎𝑣𝑣 ) = 1 2 (4) The avalanche value should be within the range [0, 1]. The ideal value for avalanche is 0.5, which indicates that the S-Box satisfies the avalanche criterion. However, it is preferred to take the error interval {- A,+ ∈A} into account for the experimental results [44]. Also, the avalanche of the transformation function (SBox) can be obtained by using the following equation [45]: 𝐴𝑣𝑎𝑙𝑎𝑛𝑐ℎ𝑒 𝐸𝑓𝑓𝑒𝑐𝑡 = 𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑓𝑙𝑖𝑝𝑝𝑒𝑑 𝑏𝑖𝑡𝑠 𝑖𝑛 (𝑜𝑢𝑡𝑝𝑢𝑡)𝑐𝑖𝑝ℎ𝑒𝑟𝑡𝑒𝑥𝑡 𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝐴𝑙𝑙 𝑏𝑖𝑡𝑠 𝑖𝑛 𝑡ℎ𝑒 (𝑜𝑢𝑡𝑝𝑢𝑡)𝑐𝑖𝑝ℎ𝑒𝑟𝑡𝑒𝑥𝑡 --Strict Avalanche (SAC) According to A. Webster and S. E. Tavares in [37] the 150204-7373-IJET-IJENS © August 2015 IJENS IJENS International Journal of Engineering & Technology IJET-IJENS Vol:15 No:04 transformation function (S-Box) satisfies the strict avalanche criterion if each bit of its output bits is changed by a probability of one half when a single bit of its outputs is complemented. This criterion merges both the completeness and avalanche criteria. A function S ∶ {0,1}m → {0,1}m for all u, v ∈ (1,2, … . m), is said to satisfy the SAC If complementing one input bit u alters the output bit v by the chance of precisely one half[37]. For 1 2m c W(avvu ) = 1 (5) 2 --Non-Linearity The nonlinearity of a Boolean function is the distance between the function and the set of all affine functions, or it is the distance between the function in issue and the nextdoor linear function [37, 46-48]. According to [49] the Boolean function can be represented as: f(v) = n ⊕ δ . (∏ vizi ) z ∈ F2n z i=1 (6) As F2n represents the set of all n-totals of elements in the Galois Field, and, BFn represents the set of all n variables in the Boolean function. Where z= (z1, z2,…,zn) and F2 Let u= (u1, u2,…, un) and v=(v1,v2,…,vn) ∈ F2n The inner product for two vectors u & v will be ∑i uivi As (u1*v1⊕u2*v2⊕ … ⊕un*vn) can be declared as [u,v]. The nonlinearity for a function F: F2n → F2m , such that F: {0,1}n → {0,1} named S: The Walsh transformation of a Boolean function s (u) ∈ BFn over F2n can be expressed as: ws (u) = ∑ (−1)f(u)⊕[u,v] (7) u ∈ Fn 2 n−1 NL(S) = 2 − 1 2 Max |Ws(u)| u ∈ F2n∗ For all u, v, l ∈ (1,2, … . m), such as v ≠ l, a function f ∶ {0,1}m → {0,1}m satisfies the bit independence criterion if complementing input bit u makes the output bits v and l to alter independently. The Bit Independence requires a correlation coefficient between the u and v bits of the Avalanche vector AV cu 𝐵𝐼𝐶(𝑆) = 𝒎𝒂𝒙 1≤𝑢≤𝑚 n For the S which is a (n,m) S-Box, the nonlinearity can be known as the minimum amount of the nonlinearities for the entire nonzero linear combinations of the constituent functions, as in 10. NL([z, F] (9) 𝐵𝐼𝐶(𝑎𝑢, 𝑎𝑙) (11) -- Differential Uniformity The differential Uniformity δ(S) for a function S(x) is defined as [51]: 𝛿(𝑆) = 𝑚𝑎𝑥𝑛 |{𝑥|𝑆(𝑥) + 𝑆(𝑥 + 𝛼) = 𝛽| (12) 𝛼∈𝐹2 𝛽∈𝐹2𝑛 𝛼≠0 Where: S(x) = (s1 (x), … , sn (x)) is a multiple output Boolean function fromF2n → F2n . The minimum value for δ(S) = 1, and its value for AES S-box = 4, the low value of differential uniformity means it is resistant to differential attack [52]. --Invertability Any n x n S-box satisfy the conditions for invertability, if S ( x1 ) = S ( x2 ) in case that x1 = x2 for all inputs x1 , and x2 . VI. THE PROPOSED METHOD The DNA strand has four bases (a, c, g, and t) so: F(X): X → Y, where X = {a, c, g, t} and Y = {00, 01, 10, 11}. This can be expressed in table I as below: TABLE I TABLE (1): DNA BASE CODING DNA base Binary code (8) 22 −1 as maximum nonlinearity [49, 50]. Max z∈Fm 2 /{0} (10) Commonly the values of BIC range between 0 and 1 as: 1: means the worse state is completely dependent on the relation between v and l bits. 0: means the ideal state is completely independent in the relation between v and l bits. a c g t So, NL(S) in (10) , represents the nonlinearity of the function s(u) ∈ BFn by using the Walsh transformation ,and, since n is even then the function f(u) will get 2n−1 − NL(S) = min 𝒎𝒂𝒙 |𝐶𝑜𝑟𝑟(𝑎𝑣𝑒𝑢 , 𝑎𝑙𝑒𝑢 )| 1≤𝑢≤𝑚 So, for the S-Box the Bit independence can be represented as: all u, v Strict Avalanche Effect = Another criterion called Bit Independence (BIT) was declared by A. Webster and S. E. Tavares as one of the criteria used to check the security of the designed S-Boxes. 𝐵𝐼𝐶(𝑎𝑣 , 𝑎𝑙 ) = The S-Box assures this criterion in case: 4 00 01 10 11 According to the DNA base binary coding, every two bit is considered as one DNA base. Since a byte consists of eight bits, so, each byte represents four bases, for example, 01101100 will be as cgta. The proposed method of generating the new S-boxes is depending on using two random DNA segments (DNAS1 and DNAS2), that can be obtained from the GenBank [53] or by using one of unique pseudo DNA generating methods . The new S-boxes are inspired by DNA transcription process --Bit Independence (BIC) 150204-7373-IJET-IJENS © August 2015 IJENS IJENS International Journal of Engineering & Technology IJET-IJENS Vol:15 No:04 as one of Central Dogma method which converts the mRNA to protein. Each four bases of the first DNA-segment (DNAS1) would be taken as one byte, and that will repeated until obtain 256 unique bytes. These bytes will be allocated in two dimensions (16×16) matrix; every element of this matrix is belonging to 𝐹28 . This matrix is called Initial S-box (Init-S-box). The first element of Init-S-box is consisting of four DNA bases and the second byte will consist of the next four DNA bases and so on. The second DNA segment (DNAS2) will be used to reallocate the S-box elements into another (16×16) matrix that called DNA-based S-box, which forms the final S-box. A. The Creation of the DNA-Based S-Boxes The following steps stand for creating the proposed Sbox: --First: Obtaining the Init-S-box. 1) Get two DNA segments DNAS1 and DNAS2, where each of them are consist of 1024 DNA bases, every four successive DNA bases are unique that form one byte, for example (ctga) 01111000. DNAS1 1024 DNA bases 256 bytes. DNAS2 1024 DNA bases, 256 bytes. 2) Place the 256 bytes obtained from the DNAS1 into 16X16 matrix called Initial S-Box (Init-S-box), as in Fig.2, DNAS1 ctagagtctgcagccttacgaactctagtacgactgccc tatcgggcatgtgtatacctagatcttaaatcggggaatt cgtgtaagatgaggctc………ctggcaagtaaacgatg ctaaaacacgtgtacctgatatcgcatctgagcatactgt acatatcagaatcc Bytes ctag agtc tgca gcct … gtac (4 bases) … Sequenc 1 2 3 4 … 253 … es … … … … 0 1 2 3 4 B ….. … gatc 0 ctag agtc tgca gcct actg ….. 1 gtgt aaga caca tgag gctc … . F ctgg caag taaa cgat gcta ….. acgt atat caga atcc 254 255 256 C D E 5 B. Obtaining the DNA-based S-box The second DNA-segment DNAS2 used to obtain the DNA-based S-box, where the structure and size of the DNAS2 is same as DNSA1, but, with different DNA-bases, each four DNA bases are considered as one value (one byte). These values will be taken one by one to be used as locater for the New S-box, according to the following procedures:1) The values of DNAS2 will be taken sequentially from 1, 256. Note that (each value is consist of 4 successive DNA bases). 2) The values of Init-S-box will be obtained sequentially one by one and located into the DNAbased-S-box matrix according the DNAS2 values. 3) Each element of the DNAS2 value which consist of 4 DNA bases would be used to specify the location of the elements within the New-S-box as the left two DNA-bases of value would specify the row, while the right two DNA-bases, would specify the column. The process of allocating the elements of the DNA-based-S-box can be summarized within this pseudo code: For i =1 to 256 Begin Four-bases = DNAS2 (i) //where “Four—DNA-bases = (b4b3b1b1), & b∈ {a ,c ,g, t} Split (Four-DNA-bases) to: (Left- Two- DNA-bases) + (Right-Two-DNA-bases) Left-Two-DNA-bases = b4b3, Right-Two-DNA bases = b2b1 Row = Left-Two-DNA-bases Col = Right-Two-DNA bases DNA-based-S-box [row, col] =Initial S-Box[i] End The stage of generating the DNA-based S-box can be shown in Fig.4 F ttaa atcg ggga attc tacg atat caga atcc Fig. 2. Constructing of Init S-box matrix.The DNA segment is placed in (16×16) matrix named Init-S-boxm where each cell of this matrix contain 4 DNA bases (1 byte). The binary representing of Init S-box matrix can be shown in Fig.3, according to DNA bases coding Fig. 4, Constructing of DNA-based S-box matrix The results will be the DNA-based S-box, which is obtained by the inspiration of the DNA processes. The randomness of the DNA segments will guarantee the randomness of the generating S-box. Fig. 3, Binary representation of Init S-box matrix 150204-7373-IJET-IJENS © August 2015 IJENS IJENS International Journal of Engineering & Technology IJET-IJENS Vol:15 No:04 C. Additional transformations It also could add other transformations for the resulted New S-box to increase the randomness and the complexity of the resulted S-box. These transformations are inspired from DNA processes as follow: --Reverse process This transformation can be achieved on the whole New Sbox bases by apply the reverse process as in Fig.5, Fig. 5, Apply Reverse process over DNA-based S-box elements --Recode process Each DNA base can be coded in more than one binary code as in Table II: TABLE II DNA BASE MULTI CODING DNA base Code1 Code2 a c g t 00 01 10 11 01 00 11 10 Code3 10 11 00 01 Fig.6, shows the applying of recoding DNA-base over the DNA-based S-box elements. 6 1,044,096 bits per sequence in length, which were tested and plotted in the laboratory experiments' action as a random plaintext with random keys of 128 bits.The tested ciphertext for the experiments is the output of round (3) of the AES algorithm with DNA-based S-box. The entire randomness testing relied upon the use of the NIST Statistical Test Suite, which comprises 15 tests that, under special factor put ins, can be observed as 188 statistical tests [40].The majority of the 15 tests have a one p-value; nevertheless, some of the tests have more than one P-value Table III. Every P-value matches to the function of a random statistical test on a distinct block, this block is a binary sequence [54]. The significant level α used for analysis of its value = 0.01, as proposed by NIST, for the study of P-values gained from a variety of statistical tests. Depending on the p-value the following states can be concluded: 1) The sequence is shown to be completely nonrandom if a (p-value = 0). 2) 2. The sequence is shown to be non-random if a (pvalue <0.01). 3) 3. The sequence is shown to be random if a (pvalue ≥0.01). 4) 4. The sequence is shown to be perfect-random if a (p-value =1). The proportion of sequences that passed a specific statistical test should lie above the proportion value p’ described in the following equation: 𝑝′ = Fig. 6, Apply Re-code process over DNA-based S-box elements − + ∝ (1−∝) 3√ 𝑚 (14). Where m = the number of tested sequences. VII. METHODOLOGY A number of experiments were conducted 1) Experiments measure the security of the algorithm that used the DNA-based S-box by using the statistical NIST Suite Randomness test. 2) Experiments measure the security DNA-based Sbox, using S-box test criteria. 3) Experiment to measure key sensitivity. 4) Experiment to analysis the information entropy. . For the NIST Suite Randomness test all the data for the 128-byte block of plain-text and 16-byte key was generated and evaluated off-line. The data included a random plaintext with random 128 bit keys. This works only deals with the situation where the block ciphers run in ECB mode, where the plaintext is divided into blocks, and each block is encrypted separately using the same secret key. The values of the key were based on data generated using the Blum-Blum-Shub (BBS) pseudo-random bit generator, while the plaintext was different file types, image, video and text. Many images, videos and text files were chosen. According to [39], as a minimum, 128 sequences with 1,000,000 bits for each sequence should be used for an NIST test suite. This paper uses 128 sequences of length VIII. RESULTS AND DISCUSSION A. Cryptanalysis and security analysis The process of generating the DNA-based S-box does not used the mathematical operations that were employed in generating the original AES S-box, including the inverse multiplication and all operations related to it. Also the use of DNA segments makes the attempts to attack the S-box and cipher look like a hard job or infeasible for the cryptanalyzer, since it is difficult for him to recognize or anticipate the DNA segments and their construction and structures. B. Randomness test This section evaluates and analyses the randomness of the AES algorithm used New S-box. A number of experiments were performed using the NIST Test Suite randomness test function. It is concerned with proving the success of the encryption algorithm that used the proposed S-Box by showing that this cipher has successfully passed all 15 NIST Statistical Test Suite randomness tests for some chosen sequences. In reference to Table III, Random Excursion Test is a chain of eight tests and conclusions, single test and conclusion for each of the states: -4,-3,-2,-1 and +1, +2, +3+4. 150204-7373-IJET-IJENS © August 2015 IJENS IJENS International Journal of Engineering & Technology IJET-IJENS Vol:15 No:04 7 TABLE III BREAKDOWN OF 15 STATISTICAL TESTS APPLIED DURING EXPERIMENTATION Test ID Number NIST Statistical Test Number of p-value 1 2 3 4 5 6 Frequency Frequency-Within-Block Runs Longest Runs of Ones Binary Matrix Rank Discrete Fourier Transformation Non-Over Lapping Template Matching Overlapping Template Matching Test Maurer’s Universal Linear Complexity Serial Approximating Entropy Cumulative Sums (Cusums) Random Excursions Random Excursions Variant 1 1 1 1 1 1 7 8 9 10 11-12 13 14-15 16-23 24-41 1 1 1 1 2 1 2 8 18 Random Excursions Variant Test is a chain of eighteen tests and conclusions, single test and conclusion for each of the states:-9,-8,…,-1 and +1,+2,… , +9. State +1 from Random Excursions Test (test ID number = 20) and state -1 from Random Excursions Variant Test (test ID number =32) were selected to register in this experiment, Fig.7, demonstrates the p-values for 15 NIST at round 3 of the block cipher used the DNA-based S-box. Fig.7, Randomness Test for the block cipher used the DNA-based S-box. The p-values of all the tests are more than 0.01 for the output of round 3. The result includes State +1 from Random Excursions Test (test ID number = 20) and state -1 from Random Excursions Variant Test (test ID number =32). C. The proportion The proportion of the sequences that exceeded a particular statistical test must be greater than the proportion value p′ . As defined in (14) and for the 128 sequences the proportion value of these sequences is: 0.01(1 − 0.01) 𝑝′ = (1 − 0.01) − 3√ = 0.96361 128 Figure 8 shows the randomness test for 15 statistical tests for rounds 3 of block block cipher that used the DNA-based S-box. From this figure, at the end of the third round, all of the 41 statistical tests fall over 96.36%, which is evident that the output from the algorithm is random. Fig.8, Proportion for block cipher using the DNA-based S-box. The proportion of the 42 tests are more than 0.963616.This indicates that all the statistical tests have at least 124 of 128 sequences with p-value more than 0.01. The results show that, the block cipher with DNA-based S-box has a good randomness, which proves the security of the system, since the randomness is consider as one of the most important factors in the evaluation of ciphers security. D. S-box test criteria --Balanced The new DNA-based S-box, which is generated using the proposed method, is balanced since it has equal numbers of both 0’s and 1’s. --Completeness The new generated DNA based S-box has the completeness criteria since each bit of the new S-Box is dependent on all of the input bits. For the DNA-based SBox, it is clear that if there is at least one pair of 8-bit input vectors, Z and Zi that are differ in only one bit (i), then the output f(z) and f(zi) are differ at least in bit j. --Non-Linearity The experiment shows that the non-linearity for the S-box is 114, and, by examining a number of generated DNAbased S-boxes using our proposed method it appears that the values of non-linearity range between 112 and 118. This means that they have good nonlinearity since the ideal nonlinearity value for n=8 is 120, and as long as the value of nonlinearity is more than 100 it mean it has good results [55, 56]. --Avalanche A number of DNA-based S-boxes were tested to get their avalanche values. The experiments show that the avalanche values of the new S-Boxes range between 0.4689 and 0.51. --Strict Avalanche (SAC) The Strict Avalanche criterion for the DNA based S-Box is satisfying 5, where the whole values are ranging between 130 and 142. --Bit independence The experiments show that the bit independence value for the new DNA-based S-Box does not exceed 0.07. --Differential Uniformity 150204-7373-IJET-IJENS © August 2015 IJENS IJENS International Journal of Engineering & Technology IJET-IJENS Vol:15 No:04 The experiments results show that differential uniformity of the new-DNA base S-boxes is range between (4 and 6).So The resistance against differential cryptanalysis is measured by the Differential Uniformity, so the new S-boxes generated by the proposed method have good resistant against differential attacks[51]. --Invertability Any n x n S-box satisfy the conditions for invertability, if S ( x1 ) = S ( x2 ) in case that x1 = x2 for all inputsx1 , and x2. The results of the NIST suite randomness test besides the S-box criteria tests prove that the new DNA based S-box have a strong security since they are bijective, balanced and complete; furthermore, they have perfect avalanche, strict avalanche, good independence and differential uniformity. Based on all of the foregoing reasons, and supported by the simple processes used in the generation of these S-boxes, it can be deduced that this technique is successful. E. Key sensitivity analysis This test is to identify the rate if a bit changes between the original ciphertext and the changing ciphertext with one digit key difference. 128 data sets were tested each of them consists of 32 sequences (128 bits per sequence). The result of the test is in Figure 9, which is a plot of difference between the point location of key changed and bit error rate for one data set. It shows that the values of bit differ between two ciphertexts of every sequence of key lie within range of 0.5. The result indicates that a single bit change on input causes changes on approximately half of the output bits. It justifies the high sensitivity of ciphertext to the key. theoretical entropy value H(m) is 8. The experiment results for the proposed algorithm showed that all the entropies values are within the range of 7.975 to 7.977. The values are extremely close to the ideal value IX. CONCLUSION This paper proposed a new method to generate new Sboxes inspired by real biological techniques, specifically DNA. The proposed method tried to take advantage of the DNA properties in generating a new S-Box that satisfies the security criterion with simple and less mathematical operations. It proves that real biology techniques could be used as the inspiration to build the main components used in the encryption algorithms like the S-box. The generated Sbox can be used within SPN symmetric block cipher as AES cipher. The data used for testing the proposed algorithm were Image, Video, Text, and BBS, which are considered as being among the most difficult and important data types in terms of encryption. The security of the new S-boxes were analyzed and tested using a number of security measurement and tests as NIST test Suite, S-box test criteria, entropy information analysis, key sensitivity. The results of the experiments and tests show that both the new DNA-based SBox and the cipher used have strong security. For future work, some modifications could be made for the proposed generating method to build a dynamic DNA-based S-box, in which the whole cipher completely depends on or is inspired by DNA techniques. Finally, this work opens the door wide to capitalize on the numerous features available in DNA and adopting them within the encryption field. [1] [2] [3] [4] [5] [6] Fig. 9, Key sensitivity analysis. F. Analysis of information entropy This section is concerned with the calculation and analysis of the entropy for the generated S-Boxes (DNAbased S-Box).It is known that the entropy of a message source can be computed according to the equation 15 2𝑁 −1 𝐻(𝑚) = ∑ 𝑃(𝑚𝑗 )𝑙𝑜𝑔 𝑗=0 1 𝑃(𝑚𝑗 ) 𝑏𝑖𝑡𝑠 (15) [7] [8] [9] [10] H(m) represents the entropy of the message m, 𝑃(𝑚𝑗 ) symbolizes the probability of happening of symbol 𝑚𝑗 and finally, the log corresponds to the base 2 logarithm in order that the entropy is stated by bits. For totally random source producing 28 symbols, the 8 [11] [12] [13] REFERENCES K. Kazlauskas and J. Kazlauskas, "Key-dependent S-box generation in AES block cipher system," Informatica, vol. 20, pp. 23-34, 2009. A. Braeken, "Cryptographic properties of Boolean functions and S-boxes," phd thesis-2006, 2006. J. Detombe and S. Tavares, "Constructing large cryptographically strong S-boxes," in Advances in Cryptology— AUSCRYPT'92, 1993, pp. 165-181. G. Leander and A. Poschmann, "On the Classification of 4 Bit S-boxes," in Arithmetic of Finite Fields, ed: Springer, 2007, pp. 159-176. C. Adams and S. Tavares, "Good S-boxes are easy to find," in Advances in Cryptology—CRYPTO’89 Proceedings, 1990, pp. 612-615. J. A. Clark, et al., "The design of S-boxes by simulated annealing," New Generation Computing, vol. 23, pp. 219-231, 2005. G. Tang, et al., "A novel method for designing S-boxes based on chaotic maps," Chaos, Solitons & Fractals, vol. 23, pp. 413419, 2005. M. T. Tran, et al., "Gray S-box for advanced encryption standard," in Computational Intelligence and Security, 2008. CIS'08. International Conference on, 2008, pp. 253-258. D. Canright and L. Batina, "A very compact “perfectly masked” S-box for AES," in Applied Cryptography and Network Security, 2008, pp. 446-459. G. Chen, "A novel heuristic method for obtaining< i> S</i>boxes," Chaos, Solitons & Fractals, vol. 36, pp. 1028-1036, 2008. G. Krishnamurthy and V. Ramaswamy, "Making AES stronger: AES with key dependent S-box," IJCSNS International Journal of Computer Science and Network Security, vol. 8, pp. 388-398, 2008. H. M. El-Sheikh, et al., "A New Approach for Designing KeyDependent S-Box Defined over GF (2 4) in AES." A. Janadi and D. Anas Tarah, "AES immunity Enhancement against algebraic attacks by using dynamic S-Boxes," in 150204-7373-IJET-IJENS © August 2015 IJENS IJENS International Journal of Engineering & Technology IJET-IJENS Vol:15 No:04 [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] Information and Communication Technologies: From Theory to Applications, 2008. ICTTA 2008. 3rd International Conference on, 2008, pp. 1-6. G. Zaibi, et al., "A new design of dynamic S-Box based on two chaotic maps," in Computer Systems and Applications (AICCSA), 2010 IEEE/ACS International Conference on, 2010, pp. 1-6. J. Juremi, et al., "A proposal for improving AES S-box with rotation and key-dependent," in Cyber Security, Cyber Warfare and Digital Forensic (CyberSec), 2012 International Conference on, 2012, pp. 38-42. A. Gehani, et al., "DNA-based cryptography," in 5th DIMACS workshop on DNA Based Computers, MIT, 1999. S. T. Amin, et al., "A DNA-based Implementation of YAEA Encryption Algorithm," in IASTED International Conference on Computational Intelligence, San Francisco, 2006, pp. 120-125. K. Ning, "A pseudo DNA cryptography method," arXiv preprint arXiv:0903.2693, 2009. A. Leier, et al., "Cryptography with DNA binary strands," BioSystems, vol. 57, pp. 13-22, 2000. Q. Zhang, et al., "An image encryption algorithm based on DNA sequence addition operation," in Bio-Inspired Computing, 2009. BIC-TA'09. Fourth International Conference on, 2009, pp. 1-5. O. Tornea and M. Borda, "DNA Cryptographic Algorithms," in International Conference on Advancements of Medicine and Health Care through Technology, 2009, pp. 223-226. S. Sadeg, et al., "An encryption algorithm inspired from DNA," in Machine and Web Intelligence (ICMWI), 2010 International Conference on, 2010, pp. 344-349. M. Sabry, et al., "Three Reversible Data Encoding Algorithms based on DNA and Amino Acids' Structure," International Journal of Computer Applications, vol. 54, 2012. T. Mandge and V. Choudhary, "A DNA encryption technique based on matrix manipulation and secure key generation scheme," in Information Communication and Embedded Systems (ICICES), 2013 International Conference on, 2013, pp. 47-52. Q. Zhang and L. Liu, "DNA Coding and Chaos-Based Image Encryption Algorithm," Journal of Computational and Theoretical Nanoscience, vol. 10, pp. 341-346, 2013. G. Jacob and A. Murugan, "An Encryption Scheme with DNA Technology and JPEG Zigzag Coding for Secure Transmission of Images," arXiv preprint arXiv:1305.1270, 2013. M. Babaei, "A novel text and image encryption method based on chaos theory and DNA computing," Natural computing, pp. 1-7, 2013. Q. Zhang, et al., "A novel image fusion encryption algorithm based on DNA sequence operation and hyper-chaotic system," Optik-International Journal for Light and Electron Optics, 2013. L. Liu, et al., "A RGB image encryption algorithm based on DNA encoding and chaos map," Computers & Electrical Engineering, vol. 38, pp. 1240-1248, 2012. X. Wei, et al., "A novel color image encryption algorithm based on DNA sequence operation and hyper-chaotic system," Journal of Systems and Software, vol. 85, pp. 290-299, 2012. Q. Zhang, et al., "A Novel Image Encryption Algorithm Based on DNA Subsequence Operation," The Scientific World Journal, vol. 2012, 2012. J. Daemen and V. Rijmen, "The block cipher Rijndael," in Smart Card Research and Applications, 2000, pp. 277-284. J. Daemen and V. Rijmen, The design of Rijndael: AES-the advanced encryption standard: Springer, 2002. J. Daemen and V. Rijmen, "AES proposal: Rijndael," in First Advanced Encryption Standard (AES) Conference, 1998. N. F. Pub, "197: Advanced Encryption Standard (AES), Federal Information Processing Standards Publication 197, US Department of Commerce/NIST, November 26, 2001. Available from the NIST website," ed. M. Zhang, et al., "A mathematical formulation of DNA computation," NanoBioscience, IEEE Transactions on, vol. 5, pp. 32-40, 2006. A. Webster and S. E. Tavares, "On the design of S-boxes," in Advances in Cryptology—CRYPTO’85 Proceedings, 1986, pp. 523-534. G. I. Bell and D. C. Torney, "Repetitive DNA sequences: some considerations for simple sequence repeats," Computers & chemistry, vol. 17, pp. 185-190, 1993. [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55] [56] 9 J. Soto and L. Bassham, "Randomness testing of the advanced encryption standard finalist candidates," DTIC Document2000. V. Katos, "A randomness test for block ciphers," Applied mathematics and computation, vol. 162, pp. 29-35, 2005. L. E. Bassham III, et al., "SP 800-22 Rev. 1a. A Statistical Test Suite for Random and Pseudorandom Number Generators for Cryptographic Applications," 2010. H. Feistel, "Cryptography and computer privacy," Scientific american, vol. 228, pp. 15-23, 1973. H. Feistel, et al., "Some cryptographic techniques for machineto-machine data communications," Proceedings of the IEEE, vol. 63, pp. 1545-1554, 1975. I. Vergili and M. Yücel, "Avalanche and Bit Independence Properties for the Ensembles of Randomly Chosen× S-Boxes," Turk J Elec Engin, vol. 9, pp. 137-145, 2001. S. Ramanujam and M. Karuppiah, "Designing an algorithm with high avalanche effect," IJCSNS, vol. 11, p. 106, 2011. A. Canteaut and M. Videau, "Symmetric boolean functions," Information Theory, IEEE Transactions on, vol. 51, pp. 27912811, 2005. W. Meier and O. Staffelbach, "Nonlinearity criteria for cryptographic functions," in Advances in Cryptology— EUROCRYPT’89, 1990, pp. 549-562. J. Pieprzyk and G. Finkelstein, "Towards effective nonlinear cryptosystem design," Computers and Digital Techniques, IEE Proceedings E, vol. 135, pp. 325-335, 1988. S. Gao, et al., "Nonlinearity Profile Test for an S-Box," in Future Wireless Networks and Information Systems, ed: Springer, 2012, pp. 639-644. C. Carlet and C. Ding, "Nonlinearities of S-boxes," Finite Fields and Their Applications, vol. 13, pp. 121-135, 2007. J. Cui, et al., "An improved AES S-Box and its performance analysis," International Journal of Innovative Computing, Information and Control, vol. 7, 2011. G. Gong, et al., "Enhanced Criteria on Differential Uniformity and Nonlinearity of Cryptographically Significant Functions." D. A. Benson, et al., "GenBank," Nucleic acids research, p. gks1195, 2012. A. Rukhin, et al., "A statistical test suite for random and pseudorandom number generators for cryptographic applications," DTIC Document2001. O. Kazymyrov, et al., "A Method For Generation Of HighNonlinear S-Boxes Based On Gradient Descent." I. Hussain, et al., "Construction of cryptographically strong 8× 8 S-boxes," World Appl. Sci. J, vol. 13, pp. 2389-2395, 2011. 150204-7373-IJET-IJENS © August 2015 IJENS IJENS