Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Design of Genetic Sequences Encoding MMP-degradable Synthetic Recombinant Protein Final Report RET Summer 2010 Prepared by Kristen Kopf Science Teacher, Elk Grove High School Research Mentor: Richard Gemeinhart, PhD University of Illinois at Chicago ____________________ Kristen Kopf RET Fellow ____________________ Dr. Richard Gemeinhart RET Mentor University of Illinois at Chicago, Chicago, IL. Research Experience for Teachers NSF CBET EEC-0743068 August 6, 2010 Table of Contents Abstract ………………………………………………………………………………….... 3 Introduction ……………………………………………………………………………….. 4 Materials and Methods ……………………………………………………………………. 5 - 8 Results and Discussion ……………………………………………………………………. 8 – 9 Conclusions ……………………………………………………………………………….. 10 Future Work ………………………………………………………………………………. 10 References ………………………………………………………………………………… 10 Acknowledgements ………………………………………………………………….......... 10 - 11 Abstract Protein-engineered biomaterials have the potential for drug targeted therapy against highly invasive and common primary brain tumors, such as glioblastoma multiforme. The repeating units of target recombinant protein polymers contain a binding and cleavage site for metalloproteinases (MMPs), which are excreted by tumor cells in tissue remodeling and angiogenesis. Polymer protein contact with MMPs will result in the degradation of the protein and the release of chemotherapeutic agents contained within the scaffold. The polymer protein was formed via primer-extension PCR, then ligated into a plasmid cloning vector, and transformed into E. coli. This method allows for the creation of polymer proteins consisting of varying monomer repeats. The pool of technologies utilized here represents a promising approach for the development of protein-engineered biomaterials tailored for specific medical applications. 3 Introduction Glioblastoma multiforme (GBM) is a highly advanced and invasive brain tumor that currently lacks adequate treatment1. The blood brain barrier impedes intravenous chemotherapy delivery and GBM’s invasive nature makes surgery impractical. Therefore, better treatments are needed. The angiogenic behavior of GBM and its subsequent over-activation of matrix metalloprotease-2 (MMP-2) can be used to create a biogel delivery system that can control the release of drugs based on the activity of MMP-22,3. The biogel, shown in Figure 1, would be composed of MMP-2 cleavable peptides that encase a chemotherapeutic agent. Upon contact with MMP-2 the scaffold would be degraded and the chemotherapy released. MMP-2 cleavable peptide Chemotherapeutic agent Tumor cells releasing MMP-2 Figure 1. MMP-2 cleavable biogel with embedded chemotherapeutic agent Polymer protein biogel composed of MMP-2 cleavable peptides will be degraded upon contact with tumor cell over-activating MMP-2. The chemotherapeutic agent will then be released. Primer-extension PCR has shown to be a more promising approach to our gene creation than traditional cloning methods involving continual ligation of MMP-2 cleavable peptide sequences into vectors. In our experience, the traditional cloning method was not only time and labor intensive, but failed to produce a viable dimer peptide. Therefore, our investigation focuses on the use of PCR to create a DNA sequence to encode an MMP-2 cleavable peptide. 4 Materials and Methods DNA Design Double-stranded oligonucleotides (51 bp) representing the MMP-2 cleavage site and flanking restriction enzymes sites were designed and chemically synthesized by Integrated DNA Technologies. As shown in Figure 2, the MMP-2 cleavage sequence was flanked upstream by XhoI and BgLII restriction sites, respectively, and downstream by a BamHI restriction site. A B 5’ XhoI-BglII-GPLGVRG-BamHI 3’ CTCGAGAGATCTGGTCCGCTGGGCGTTCGTGGTGGATCC GAGCTCTCTAGACCAGGCGACCCGCAAGCACCACCTAGG Figure 2. MMP-2 Cleavable Sequence (A) Amino acid sequence of MMP-2 cleavable peptide flanked by two restriction sites. One letter amino acid code: (G) glycine, (P) proline, (L) leucine, (V) valine, (R) arginine. (B) DNA sequence for MMP-2 cleavable monomer sequence flanked by two restriction sites. One letter base code (A) adenine, (T) thymine, (G) guanine, (C) cytosine. DNA Synthesis for Monomeric Polypeptide Genes encoding the monomeric polypeptide were assembled by primer-extension polymerase chain reaction (PCR). The purpose of this technique is to elongate the purchased MMP-2 sequence to create monomer repeats that will later be used in the production of a protein biogel. The protocol requires subsequent reactions where the first products are used in the second reaction, the second products are used in the third, and so on. As illustrated in Figure 3, the first reaction adds onto the template and creates an incomplete product, which is used in the second reaction. After the second reaction the monomeric sequence has been copied one time and a dimer formed. Thus, after every even-numbered reaction, a viable product containing full 5 monomer repeats is generated. The power of the technique lies in its ability to quickly generate sequences of varying monomer repeat lengths. This is used as template for the next reaction KEY - Template & - Primers - Added nucleotides Figure 3. Primer-Extension PCR Model Subsequent PCR reactions create a DNA sequence of repeating MMP-2 cleavable sequences. “A” represents base pairs GGT CCG CTG, encoding GPL. “B” represents GGC GTT CGT GGT, encoding GVRG. The desired products are AB repeats. Only the sense strand is shown. The PCR was conducted in conditions depicted in Table 1. A Component GC Phusion DMSO Primer 1 Primer 2 DNA Template Amount (L) 10 1 0.5 0.5 0.5 B Thermal cycler regimen Degrees Time in Celsius Seconds 98 30 98 15 65 15 72 120 Table 1. PCR conditions for creation of MMP-2 cleavable DNA sequence (A) PCR reaction components. (B) PCR thermal cycler regimen for denaturing DNA, annealing primers, and extending sequence. 6 Amplification of Second PCR Reaction Template from the second PCR reaction was taken and repeated with the same primers in order to minimize incomplete ends. This increased the amount of complete monomer repeats produced. Ligation into pUC19c Vector The products produced after the amplification of the second PCR regimen were ligated into the multiple cloning region of a pUC19c vector, shown in Figure 4, using a restriction enzyme digest with SmaI. The restriction enzyme produced blunt ends on the vector, which was then ligated with the insert. The ligation was conducted in the presence of SmaI in order to minimize re-ligation of the vector to itself. The products were transformed into E. coli and grown for 24 hours. SmaI amp R pUC19c 2686 bp Multiple Cloning Region lacZ Figure 4. pUC19c vector Vector is double-stranded with ampicillin resistance and lacZ genes. The restriction site for SmaI exists within the multiple cloning region of the lacZ gene Blue/white Screen for Transformed Colonies The lacZ gene on the pUC19c vector can be used to select for transformed colonies in a technique called blue/white screening. lacZ encodes for the enzyme -galactosidase, which 7 cleaves X-gal, eventually yielding an insoluble blue product. If our insert properly ligated into the multiple cloning region, it should disrupt the lacZ gene and hence produce white colonies. We did not, however, get completely white colonies but rather varying shades of blue. We selected for the lighter blue assuming that the insert properly ligated but was not large enough to completely disrupt the lacZ function. Primers Designed to Amplify Insertion Site In order to ensure proper ligation into pUC19c, colony PCR was performed to amplify the insert. Primers were designed 139bp downstream and 135bp upstream of the insertion site. PCR was performed in the same conditions described in Table 1. Gel Isolation of Insert Product The products from the PCR reaction prior to amplification were run on a 10% acrylamide gel in order to see proper resolution of bands. After amplification using designed primers, however, the products were run on a 2.5% agarose gel. Results and Discussion PCR Primer Extension Products After the second PCR primer extension reaction, the products were run on a 10% acrylamide gel, alongside a control sample that only contained primers used for the reaction (Figure 5). Bands at roughly 25 and 50 base pairs (marked by blue arrows) can be seen in the lane containing the second PCR product. They represent the 1x insert, which is 21 base pairs in length, and the 2x insert, which is 42 base pairs long. The smear visible in the primers only lane resulted from primers annealing to each other, creating inserts of varying lengths. In Figure 6, the second reaction was further amplified. 8 Figure 5. PCR primer extension products The top blue arrow indicates a 2x insertion (42bp), while the lower blue arrow indicates a 1x insertion (21bp). Figure 6. Amplification of second PCR reaction The template from Figure 5 was amplified in order to maximize complete repeat inserts. Insert Isolation After Ligation into pUC19c After ligation into pUC19c, the insertion site was amplified using designed primers and the products run on an agarose gel (Figure 7). The area of amplification, without any inserts, was 220 base pairs long. Bands boxed in blue, which ran at about 300-350 base pairs long, represent 3-6 repeats of the MMP-2 cleavable peptide insert. Sequencing was then performed and confirmed that we generated up to 5 repeats of the MMP-2 cleavable sequence. 9 Figure 7. PCR amplification of ligation into pUC19c vector Bands boxed in blue indicate 3-6 repeats of MMP-2 cleavable peptide inserts. Conclusions The use of primer-extension PCR to create a repeating DNA sequence for MMP-2 cleavable peptides has proved successful. We have generated sequences consisting of one to five monomer repeats. Moreover, this was done using a quick and inexpensive method. This is a powerful tool that can later be used to generate protein polymers of varying sizes, in hopes that a certain length will be optimal for gel formation. Future Work Varying insert sizes have been generated but need to be inserted into pET15b expression vectors in order to produce protein. Furthermore, the protein needs to be purified and induced to gel. References 1) Uddin, S., & Jarmi, T. (2010). “Glioblastoma multiforme.” Retrieved 7/30/09, 2009. 2) Dai, B., Kang, S. H., Gong, W., Liu, M., Aldape, K. D., Sawaya, R., & Huang, S. (2007). Aberrant FoxM1B expression increases matrix metalloproteinase-2 transcription and enhances the invasion of glioma cells. Oncogene 6(42): 6212 - 6219. 3) Tauro, J. R., & Gemeinhart, R. A. (2005). Matrix metalloprotease triggered local delivery of cancer chemotherapeutics from hydrogel matrixes. Bioconjugate Chemistry 16(5): 1133-1139. doi:10.1021/bc0501303 Acknowledgements The IMSA and RET research was made possible by RET 2010 Program NSF Grant #CBET EEC-0743068, NIH R01 NS055095, and R03 EY014357 (RAG). This investigation was conducted in a facility constructed with support from Research Facilities Improvement Program Grant Number C06 RR15482 from the National Center for Research Resources, NIH. 10 I would also like to thank Dr. Richard Gemeinhart, faculty research mentor, for graciously allowing me to join his lab, and Dr. Andreas Linninger, RET program director, for providing the RET experience. Also, thank you to Mary Tang, PhD Candidate, who initially set up the cloning techniques. I would like to extend a special thanks to Jason Buhrman, MD/PhD UIC candidate, for his creation of the primer-extension PCR technique used, and his continual guidance and support. 11