Download Kopf RET Final Report - University of Illinois at Chicago

Design of Genetic Sequences
Encoding MMP-degradable Synthetic
Recombinant Protein
Final Report
RET Summer 2010
Prepared by
Kristen Kopf
Science Teacher, Elk Grove High School
Research Mentor: Richard Gemeinhart, PhD
University of Illinois at Chicago
____________________
Kristen Kopf
RET Fellow
____________________
Dr. Richard Gemeinhart
RET Mentor
University of Illinois at Chicago, Chicago, IL.
Research Experience for Teachers
NSF CBET EEC-0743068
August 6, 2010
Table of Contents
Abstract ………………………………………………………………………………….... 3
Introduction ……………………………………………………………………………….. 4
Materials and Methods ……………………………………………………………………. 5 - 8
Results and Discussion ……………………………………………………………………. 8 – 9
Conclusions ……………………………………………………………………………….. 10
Future Work ………………………………………………………………………………. 10
References ………………………………………………………………………………… 10
Acknowledgements ………………………………………………………………….......... 10 - 11
Abstract
Protein-engineered biomaterials have the potential for drug targeted therapy against
highly invasive and common primary brain tumors, such as glioblastoma multiforme. The
repeating units of target recombinant protein polymers contain a binding and cleavage site for
metalloproteinases (MMPs), which are excreted by tumor cells in tissue remodeling and
angiogenesis. Polymer protein contact with MMPs will result in the degradation of the protein
and the release of chemotherapeutic agents contained within the scaffold. The polymer protein
was formed via primer-extension PCR, then ligated into a plasmid cloning vector, and
transformed into E. coli. This method allows for the creation of polymer proteins consisting of
varying monomer repeats. The pool of technologies utilized here represents a promising
approach for the development of protein-engineered biomaterials tailored for specific medical
applications.
3
Introduction
Glioblastoma multiforme (GBM) is a highly advanced and invasive brain tumor that
currently lacks adequate treatment1. The blood brain barrier impedes intravenous chemotherapy
delivery and GBM’s invasive nature makes surgery impractical. Therefore, better treatments are
needed. The angiogenic behavior of GBM and its subsequent over-activation of matrix
metalloprotease-2 (MMP-2) can be used to create a biogel delivery system that can control the
release of drugs based on the activity of MMP-22,3. The biogel, shown in Figure 1, would be
composed of MMP-2 cleavable peptides that encase a chemotherapeutic agent. Upon contact
with MMP-2 the scaffold would be degraded and the chemotherapy released.
MMP-2 cleavable peptide
Chemotherapeutic agent
Tumor cells releasing MMP-2
Figure 1. MMP-2 cleavable biogel with embedded chemotherapeutic agent
Polymer protein biogel composed of MMP-2 cleavable peptides will be degraded upon
contact with tumor cell over-activating MMP-2. The chemotherapeutic agent will then be
released.
Primer-extension PCR has shown to be a more promising approach to our gene creation
than traditional cloning methods involving continual ligation of MMP-2 cleavable peptide
sequences into vectors. In our experience, the traditional cloning method was not only time and
labor intensive, but failed to produce a viable dimer peptide. Therefore, our investigation focuses
on the use of PCR to create a DNA sequence to encode an MMP-2 cleavable peptide.
4
Materials and Methods
DNA Design
Double-stranded oligonucleotides (51 bp) representing the MMP-2 cleavage site and
flanking restriction enzymes sites were designed and chemically synthesized by Integrated DNA
Technologies. As shown in Figure 2, the MMP-2 cleavage sequence was flanked upstream by
XhoI and BgLII restriction sites, respectively, and downstream by a BamHI restriction site.
A
B
5’ XhoI-BglII-GPLGVRG-BamHI 3’
CTCGAGAGATCTGGTCCGCTGGGCGTTCGTGGTGGATCC
GAGCTCTCTAGACCAGGCGACCCGCAAGCACCACCTAGG
Figure 2. MMP-2 Cleavable Sequence
(A) Amino acid sequence of MMP-2 cleavable peptide flanked by two restriction sites.
One letter amino acid code: (G) glycine, (P) proline, (L) leucine, (V) valine, (R) arginine.
(B) DNA sequence for MMP-2 cleavable monomer sequence flanked by two restriction
sites. One letter base code (A) adenine, (T) thymine, (G) guanine, (C) cytosine.
DNA Synthesis for Monomeric Polypeptide
Genes encoding the monomeric polypeptide were assembled by primer-extension
polymerase chain reaction (PCR). The purpose of this technique is to elongate the purchased
MMP-2 sequence to create monomer repeats that will later be used in the production of a protein
biogel. The protocol requires subsequent reactions where the first products are used in the second
reaction, the second products are used in the third, and so on. As illustrated in Figure 3, the first
reaction adds onto the template and creates an incomplete product, which is used in the second
reaction. After the second reaction the monomeric sequence has been copied one time and a
dimer formed. Thus, after every even-numbered reaction, a viable product containing full
5
monomer repeats is generated. The power of the technique lies in its ability to quickly generate
sequences of varying monomer repeat lengths.
This is used as template
for the next reaction
KEY
- Template
&
- Primers
- Added nucleotides
Figure 3. Primer-Extension PCR Model
Subsequent PCR reactions create a DNA sequence of repeating MMP-2 cleavable
sequences. “A” represents base pairs GGT CCG CTG, encoding GPL. “B” represents
GGC GTT CGT GGT, encoding GVRG. The desired products are AB repeats. Only the
sense strand is shown.
The PCR was conducted in conditions depicted in Table 1.
A
Component
GC Phusion
DMSO
Primer 1
Primer 2
DNA
Template
Amount (L)
10
1
0.5
0.5
0.5
B
Thermal cycler regimen
Degrees
Time in
Celsius
Seconds
98
30
98
15
65
15
72
120
Table 1. PCR conditions for creation of MMP-2 cleavable DNA sequence
(A) PCR reaction components. (B) PCR thermal cycler regimen for denaturing DNA,
annealing primers, and extending sequence.
6
Amplification of Second PCR Reaction
Template from the second PCR reaction was taken and repeated with the same primers in
order to minimize incomplete ends. This increased the amount of complete monomer repeats
produced.
Ligation into pUC19c Vector
The products produced after the amplification of the second PCR regimen were ligated
into the multiple cloning region of a pUC19c vector, shown in Figure 4, using a restriction
enzyme digest with SmaI. The restriction enzyme produced blunt ends on the vector, which was
then ligated with the insert. The ligation was conducted in the presence of SmaI in order to
minimize re-ligation of the vector to itself. The products were transformed into E. coli and grown
for 24 hours.
SmaI
amp R
pUC19c
2686 bp
Multiple Cloning Region
lacZ
Figure 4. pUC19c vector
Vector is double-stranded with ampicillin resistance and lacZ genes. The restriction site
for SmaI exists within the multiple cloning region of the lacZ gene
Blue/white Screen for Transformed Colonies
The lacZ gene on the pUC19c vector can be used to select for transformed colonies in a
technique called blue/white screening. lacZ encodes for the enzyme -galactosidase, which
7
cleaves X-gal, eventually yielding an insoluble blue product. If our insert properly ligated into
the multiple cloning region, it should disrupt the lacZ gene and hence produce white colonies.
We did not, however, get completely white colonies but rather varying shades of blue. We
selected for the lighter blue assuming that the insert properly ligated but was not large enough to
completely disrupt the lacZ function.
Primers Designed to Amplify Insertion Site
In order to ensure proper ligation into pUC19c, colony PCR was performed to amplify
the insert. Primers were designed 139bp downstream and 135bp upstream of the insertion site.
PCR was performed in the same conditions described in Table 1.
Gel Isolation of Insert Product
The products from the PCR reaction prior to amplification were run on a 10% acrylamide
gel in order to see proper resolution of bands. After amplification using designed primers,
however, the products were run on a 2.5% agarose gel.
Results and Discussion
PCR Primer Extension Products
After the second PCR primer extension reaction, the products were run on a 10%
acrylamide gel, alongside a control sample that only contained primers used for the reaction
(Figure 5). Bands at roughly 25 and 50 base pairs (marked by blue arrows) can be seen in the
lane containing the second PCR product. They represent the 1x insert, which is 21 base pairs in
length, and the 2x insert, which is 42 base pairs long. The smear visible in the primers only lane
resulted from primers annealing to each other, creating inserts of varying lengths. In Figure 6, the
second reaction was further amplified.
8
Figure 5. PCR primer extension products
The top blue arrow indicates a 2x insertion
(42bp), while the lower blue arrow indicates a
1x insertion (21bp).
Figure 6. Amplification of second PCR reaction
The template from Figure 5 was amplified in order
to maximize complete repeat inserts.
Insert Isolation After Ligation into pUC19c
After ligation into pUC19c, the insertion site was amplified using designed primers and
the products run on an agarose gel (Figure 7). The area of amplification, without any inserts, was
220 base pairs long. Bands boxed in blue, which ran at about 300-350 base pairs long, represent
3-6 repeats of the MMP-2 cleavable peptide insert. Sequencing was then performed and
confirmed that we generated up to 5 repeats of the MMP-2 cleavable sequence.
9
Figure 7. PCR amplification of ligation into pUC19c vector
Bands boxed in blue indicate 3-6 repeats of MMP-2 cleavable peptide inserts.
Conclusions
The use of primer-extension PCR to create a repeating DNA sequence for MMP-2
cleavable peptides has proved successful. We have generated sequences consisting of one to five
monomer repeats. Moreover, this was done using a quick and inexpensive method. This is a
powerful tool that can later be used to generate protein polymers of varying sizes, in hopes that a
certain length will be optimal for gel formation.
Future Work
Varying insert sizes have been generated but need to be inserted into pET15b expression
vectors in order to produce protein. Furthermore, the protein needs to be purified and induced to
gel.
References
1) Uddin, S., & Jarmi, T. (2010). “Glioblastoma multiforme.” Retrieved 7/30/09, 2009.
2) Dai, B., Kang, S. H., Gong, W., Liu, M., Aldape, K. D., Sawaya, R., & Huang, S. (2007).
Aberrant FoxM1B expression increases matrix metalloproteinase-2 transcription and
enhances the invasion of glioma cells. Oncogene 6(42): 6212 - 6219.
3) Tauro, J. R., & Gemeinhart, R. A. (2005). Matrix metalloprotease triggered local delivery
of cancer chemotherapeutics from hydrogel matrixes. Bioconjugate Chemistry 16(5):
1133-1139. doi:10.1021/bc0501303
Acknowledgements
The IMSA and RET research was made possible by RET 2010 Program NSF Grant
#CBET EEC-0743068, NIH R01 NS055095, and R03 EY014357 (RAG). This investigation was
conducted in a facility constructed with support from Research Facilities Improvement
Program Grant Number C06 RR15482 from the National Center for Research Resources,
NIH.
10
I would also like to thank Dr. Richard Gemeinhart, faculty research mentor, for
graciously allowing me to join his lab, and Dr. Andreas Linninger, RET program director, for
providing the RET experience. Also, thank you to Mary Tang, PhD Candidate, who initially set
up the cloning techniques. I would like to extend a special thanks to Jason Buhrman, MD/PhD
UIC candidate, for his creation of the primer-extension PCR technique used, and his continual
guidance and support.
11