Download (2016) Novel constructs for efficient cloning

Plant Cell Rep (2016) 35:2137–2150
DOI 10.1007/s00299-016-2024-9
ORIGINAL ARTICLE
Novel constructs for efficient cloning of sRNA-encoding DNA
and uniform silencing of plant genes employing artificial transacting small interfering RNA
Ulku Baykal1 • Hua Liu1 • Xinlu Chen1,2 • Henry T. Nguyen1 • Zhanyuan J. Zhang1
Received: 11 May 2016 / Accepted: 3 July 2016 / Published online: 14 July 2016
Ó Springer-Verlag Berlin Heidelberg 2016
Abstract
Key message TAS atasiRNA-producing region swapping used one-step, high efficiency, and high fidelity
directional TC-cloning. Uniform silencing was achieved
without lethality using miRNA trigger-TAS overexpression fusion cassettes to generate 21-nt atasiRNA.
Abstract Plant transgenic technologies are very important
for basic plant research and biotechnology. Artificial transacting small interfering RNA (atasiRNA) represents an
attractive platform with certain advantages over other
silencing approaches, such as hairpin RNA, artificial
microRNA (amiRNA), and virus-induced gene silencing
(VIGS). In this study, we developed two types of constructs
for atasiRNA-mediated gene silencing in plants. To functionally validate our constructs, we chose TAS1a as a test
model. Type 1 constructs had miR173-precursor sequence
fused with TAS1a locus driven by single promoter–terminator cassette, which simplified the expression cassette and
resulted in uniform gene silencing. Type 2 constructs
contained two separate cassettes for miR173 and TAS1a co-expression. The constructs in each type were
Electronic supplementary material The online version of this
article (doi:10.1007/s00299-016-2024-9) contains supplementary
material, which is available to authorized users.
Communicated by Z.-Y. Wang.
& Zhanyuan J. Zhang
[email protected]
1
Plant Transformation Core Facility, Division of Plant
Sciences, University of Missouri, 1-33 Agriculture Building,
Columbia, MO 65211, USA
2
Present Address: Department of Plant Sciences, University of
Tennessee, 347/359 Plant Biotech, Knoxville, TX 37996,
USA
further improved by deploying the XcmI-based TC-cloning
system for highly efficient directional cloning of short
DNA fragments encoding atasiRNAs into TAS1a locus.
The effectiveness of the constructs was demonstrated by
cloning an atasiRNA DNA into the TC site of engineered
TAS1a and silencing of CHLORINA 42 (CH42) gene in
Arabidopsis. Our results show that the directional TCcloning of the atasiRNA DNA into the engineered TAS1a is
highly efficient and the miR173–TAS1a fusion system
provides an attractive alternative to achieve moderate but
more uniform gene silencing without lethality, as compared
to conventional two separate cassettes for miR173 and TAS
locus co-expression system. The design principles described here should be applicable to other TAS loci such as
TAS1b, TAS1c, TAS2, or TAS3, and cloning of amiRNA
into amiRNA stem-loop.
Keywords TC-cloning XcmI TAS1a TasiRNA Two
T-DNA
Abbreviations
amiRNA
Artificial microRNA
atasiRNA Artificial trans-acting small interfering RNA
DCL
Dicer-like protein
dsRNA
Double-stranded RNA
sRNA
Small RNA
siRNA
Small interfering RNA
TAS
Trans-acting siRNA locus
Introduction
RNA interference (RNAi) exists in many organisms and
involves a multi-step process including siRNA biogenesis
and its binding to the target for gene silencing (Zamore et al.
123
2138
2000; Brodersen and Voinnet 2006; Sashital and Doudna
2010; Axtell 2013). RNAi is a sequence-specific gene regulation through targeted transcript degradation, which provides a valuable tool in functional genomics and metabolic
engineering of plants (Travella et al. 2006; Baykal and Zhang
2010). RNAi in a plant cell can be induced by expressing
300–1200 bp gene-specific sequence tag (GST) that makes
long dsRNA, which is processed by Dicer-like (DCL)
enzymes to generate siRNAs (Wesley et al. 2001; Hilson
et al. 2004; Watson et al. 2005). However, siRNAs generated
from GST can be a pool of mixed small RNAs, which can
cause an ‘‘off-target’’ effect (Schwab et al. 2005; SenthilKumar and Mysore 2011).
Trans-acting small interfering RNAs (tasiRNAs), which
were discovered in plants, play a very important role in the
regulation of gene expression (Chapman and Carrington,
2007; Allen and Howell 2010). TasiRNAs are short noncoding regulatory RNAs and generated from tasiRNA loci
(TAS). Of these, TAS1 and TAS2 transcripts have a miR173
target site, from which the production of phased 21-nt
siRNAs is initiated. Felippes and Weigel (2009) have
employed miR173-triggered atasiRNA from TAS1a and
showed that a single 21-atasiRNA species was sufficient
enough to silence a target plant gene.
Employing atasiRNAs in gene silencing is very advantageous (Zhang 2014). TAS locus can be engineered to
carry multiple 21-nt atasiRNAs, which could silence several different target genes simultaneously from a single
expression cassette. They also can be designed with 30 -end
mismatch (1–3 nt) to minimize the transitive silencing by
avoiding RNA-dependent RNA polymerase (RDR) activity
(Baulcombe 2007; Voinnet 2008). These advantages will
enable functional tests of target genes by highly transcriptspecific knockdown and reduce lethality in RNAi lines. In
these instances, the atasiRNA share advantages with artificial miRNA (amiRNA). The atasiRNA platform is also
advantageous over virus-induced gene silencing (VIGS),
which is subject to plant host range and environmental
influence and may interfere with host plant immune system, and to environmental influence (Purkayastha and
Dasgupta 2009; Ramegowda et al. 2014).
Most recently, genome editing technologies particularly
CRISPR/Cas [clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas)] as
a gene knock-out or knock-in platform has become widely
used, greatly enhancing plant biology study and crop genetic
improvements. However, atasiRNA (also amiRNA) technology is a very different platform. In numerous applications
such as verification of gene functions, only gene silencing
instead of gene knockout is necessary, saving time and effort.
In addition, some studies require inducible or tissue-specific
inactivation of target genes that is very difficult for CRISPR/
Cas to achieve. Moreover, all these genome editing
123
Plant Cell Rep (2016) 35:2137–2150
platforms necessitate in vitro validation of candidate guide
RNAs (gRNAs). Finally, knockout of multiple plant genes
simultaneously by genome editing technology is still in its
infancy, in contrast to atasiRNA or amiRNA platform, which
is much easier to implement, particularly when only silencing is sufficient.
The atasiRNA silencing platform would have even
greater utility if a short atasiRNA-producing DNA could be
effectively cloned into the TAS locus with ease. Conventional approach to achieve this is through overlapping PCR
or biosynthesis of the entire TAS locus. In addition, deployment of atasiRNA requires co-expression of miRNA precursor and an additional transgene expression cassette in the
recipient plant genome. Use of extra miRNA expression
cassette also further limits the choice of promoters and
necessitates additional steps in cloning. This can potentially
add to the regulatory cost during the de-regulation of an
engineered crop. All these make the deployment of atasiRNA neither straightforward nor cost-effective.
TA-cloning, which was developed in early 1990’s
(Kovalic et al. 1991; Mead et al. 1991) could be exploited
for cloning atasiRNA-producing DNA. The method utilizes
single nucleotide ‘‘T’’ and ‘‘A’’ at both 30 -protruding ends
of opposing DNA strands but not directional, which cannot
satisfy the needs of atasiRNA directionality in TAS locus.
Here, we describe novel constructs developed for efficient
cloning of short DNA sequences encoding small RNAs and
uniform gene silencing employing atasiRNA silencing
platform in plants. One type of constructs utilized XcmIbased directional TC-cloning for highly efficient, one-step
cloning of short DNA fragment encoding atasiRNAs;
whereas, another type of constructs employed the miR173–
TAS fusion system that allow reproducible uniform gene
silencing avoiding high transgenic lethality. In addition,
these expression cassettes are built into pMU2T, a two
T-DNA binary system, making it possible not only to further
ease cloning of atasiRNA-generating fragments into the TAS
locus within the binary vector, but also to obtain marker-free
transgenic progeny lines. These constructs should be beneficial to simultaneous silencing of multiple genes in plant
biology studies or genetic improvement of crops.
Materials and methods
Vector constructions
The components of vector cassettes, such as promoter and
terminator as well as engineered TAS1a locus with appropriate flanking restriction enzymes, were either synthesized
by GenScript (Piscataway, NJ) or PCR-amplified and
subsequently cloned into pUC57 (GenScript) or pGEM-T
Easy (Promega).
Plant Cell Rep (2016) 35:2137–2150
2139
TC-cloning vector
The design and screening principles of TC-cloning are
illustrated in Fig. 1. To construct the modified TAS1a
(mTAS1a) locus enabling directional cloning of atasiRNAproducing DNA sequence, two engineered XcmI recognition sites were introduced to the original TAS1a locus
between D1(?) and D8(?) register positions (Fig. 2a, b).
The designed mTAS1a (Fig. S1a) was synthesized and
subsequently cloned into pUC57 cloning vector at XbaI
and BamHI sites by GenScript. The resulting construct was
named pUB52. Then, a double (2X) CaMV35S promoter
was released as an EcoRI-SpeI fragment from pUB12 (see
below) and cloned into pUB52 to make pUB70. Soybean
vegetative storage protein gene terminator (Tvsp) sequence
was amplified from pZY102 (Zeng et al. 2004) and cloned
into pGEM-T easy vector, generating pUB13 (not shown).
Then, Tvsp terminator was cloned into pUB70 at BamHI
and PstI sites to make pUB72 (Fig. 2c).
The miR173 precursor sequence was synthesized with
flanking 50 XbaI and 30 BamHI restriction enzyme sites and
cloned into pUC57 by GenScript, resulting in construct
pUB1 (not shown). The 2XCaMV35S promoter was
amplified from pCAMBIA3300 by PCR and cloned into
pGEM-T Easy vector, producing construct pUB12. The
pUB1 was cut with EcoRI and XbaI restriction enzymes to
receive the incoming 2XCaMV35S sequence, which was
released from pUB12 as EcoRI and SpeI fragment to make
pUB15. Then, the Tvsp was released as a BglII–PstI
fragment from pUB13 and cloned into BamHI and PstI
sites of pUB15 to generate pUB25 carrying the miR173
expression cassette (Fig. 2d).
The engineered mTAS1a-SUL, 162-bp atasiRNA-producing DNA fragment for silencing Arabidopsis CH42
with 50 - and 30 -end flanking XcmI sites (Fig. S1b), was
synthesized and cloned into pUC57 by GenScript to yield
pUB77. This fragment was then cut by XcmI from pUB77
and released 153-bp fragment was cloned into pUB72. The
resulting vector was pUB81 (Fig. 3a).
To test the cloning efficiency of the new atasiRNAproducing cassette for making silencing constructs, the
atasiRNA-producing region with 153-bp was released by
XcmI digestion from the vector pUB77. To optimize efficiency of cloning, pUB52 and the atasiRNA-producing
fragment from pUB77 were cut with XcmI at 37 °C for 1 h.
Both vector and the fragment were isolated from agarose
A
+398/388
+427/549
TCCCATGGNNNNNCCATGTCG
modified TAS1a locus
GGTTGGAAGGGTACCNNNNNGGTACAGCACTCACC
XcmI
XcmI
XcmI digestion
B
T
GGTTGGA
+
CACTCACC
modified TAS1a locus
TC-ligation
C
T
GGTTGGAANNNNNNNNNNNNNNNNNNNNCACTCACC
XcmI
XcmI
modified TAS1a locus
E. coli transformation
Pick clone
from the petri plate
Fig. 1 XcmI-based TC-cloning process. a Modified TAS1a locus
(mTAS1a) that contains two XcmI sites is first digested with XcmI.
Note that starting nucleotide locations of two XcmI sites relative to the
first nucleotide of mTAS1a are marked and each dominator marks the
location relative to the first nucleotide of primary TAS1a. b A 21-nt
atasiRNA-generating DNA was ligated into the digested and purified
mTAS1a harboring cloning vector. c Ligated vector containing the
atasiRNA is used to transform E. coli, which is then selected on
antibiotic selection medium to obtain positive clones. The bold letters
T and C indicate 30 -protruding nucleotides to receive complementary
50 -protruding A and G of incoming atasiRNA DNA strands for
directional cloning. Ns indicates arbitrary nucleotides in the spacer
sequence between two consecutive XcmI sites or in the atasiRNA
DNA sequence to be synthesized and annealed from two complementary single-strands
123
Plant Cell Rep (2016) 35:2137–2150
D3
D4
D5
D6
2X35S
XcmI
XcmI
SpeI / XbaI (scar)
EcoRI
D7 D8
Tvsp
mTAS1a
pUB72
B
SpeI / XbaI (scar)
miR173
mTAS1a
pUB52
EcoRI
BamHI
XcmI
XcmI
XbaI
D
2X35S
miR173
PstI
D2
BamHI / BglII (scar)
D1
XcmI
XcmI
C
PstI
A
BamHI / BglII (scar)
2140
Tvsp
pUB25
Fig. 2 Schematic representation of constructs pUB52, pUB72, and
pUB25. a and b Arabidopsis TAS1a locus was first engineered by
replacing sequences between D(?)1 and D(?)8 of tasiRNA DNA
with two consecutive XcmI recognition sites and cloned into XbaI and
BamHI sites of pUC57. Dashed brackets indicate register positions
along the TAS1a locus. Partial sequences of D(?)1 and D(?)8 as well
as complete sequences from D(?)2 to D(?)7 were removed as a
result of XcmI-based cloning. miR173 (gray bar) indicates mature
miR173; c Introduction of 2XCaMV35S and Tvsp to pUB52,
producing pUB72; d Arabidopsis miRNA173 precursor sequence
was synthesized and cloned into pUC57 followed by cloning of
2XCaVM35S promoter and Tvsp, yielding pUB25. 2XCaMV35S,
duplicated cauliflower mosaic virus 35S promoter; Tvsp, soybean
vegetative seed storage protein gene terminator; miR173, miR173
precursor sequence; mTAS1a, engineered TAS1a locus containing
XcmI sites for TC-cloning
gel and ligated in the presence of T4 ligase at 4 °C overnight. The cloning product was transformed into E. coli
DH5a cells and transformants were selected on LB plates
containing ampicillin and tested for the presence of 153-bp
fragment on agarose gel (Fig. 3b).
the template to create two right T-DNA borders. Primers
L-TDNA F1 (50 -GCGGACGTCGGCGCGCCACTAGTG
CACCATGGAG GCGGTT TGCGTATTGGCTAG-30 )
and L-TDNA R1 (50 -GCAGCATGCCGAGTGGTGATTT
TGTGCCGAGC-30 ), and the same template were amplified
for one left border. After amplification, both PCR products
were cloned into pGEM-T Easy (Promega, Madison,
USA). After they were sequenced, two right borders from
pGEM-T Easy were digested using PstI and SphI, and
ligated into PstI and SphI sites of pPZP201. Then the left
border in pGEM-T Easy was digested using AatII and SphI,
and further cloned into the vector with the two right borders. This two T-DNA vector was designated as pMU-2T
(Fig. S2a).
For the construction of pUB14 binary vector carrying 2
T-DNA regions with bar gene selection marker, the whole
sequence of 2XCaMV35S plus bar was first amplified by
PCR from pCAMBIA3300 and cloned into pGEM-T Easy
vector to make pUB11. Then, 2XCaMV35S-bar sequence
was released as an XbaI–BamHI digested fragment from
pUB11 for cloning into pMU-2T vector. pUB13 vector was
Construction of binary vectors for gene silencing
in Arabidopsis
Fused or separate expression strategies of miR173 precursor and TAS1a were used for the tasiRNA-based gene
silencing approach. At first, a 2 T-DNA binary vector was
constructed for the cloning of expression cassettes. The
strategy of creating 2 T-DNA vector was to amplify
T-DNA borders using PCR and clone them into the binary
vector pPZP201. To this end, two PCR reactions were done
to amplify the borders using Primers T-DNA F1 (50 CTGCTGCAGAAT CTCGAGCACTGGCCGTCGTTTTA
CAAC-30 ) and T-DNA R1 (50 -GCGCATGCGACGTCATT
TAAATTGACAGGATATATTGGCGGGTAAACCAAA
TGGACGAACGGATAAACC-30 ). pPZP201 was used as
123
Plant Cell Rep (2016) 35:2137–2150
153-bp TAS1a-SUL was cloned
into pUB72 XcmI sites
B
1
2
3
4
5
M
6
7
8
9
10
Linearized
XcmI-based
TC-cloning construct
PstI
XcmI
BamHI / BglII (scar)
SpeI / XbaI (scar)
XcmI
EcoRI
A
2141
atasiSUL
2X35S
mTAS1a
Tvsp
153-bp XcmI
released fragment
pUB81
C
RB
XcmI
LB
XcmI
D
1.2
atasiRNA
2X35S
mTAS1a
T35S
2X35S
miR173
T35S
pZY101mTAS
XcmI
XcmI
Replicon
1
Relative Expression
bar
2X35S
Tvsp
0.8
0.6
0.4
0.2
atasiRNA validation by co-infiltration with cDNA construct into tobacco leaves
atasi RNA/
FAD2-1B
Stable plant transformation
FAD2-1B
0
Fig. 3 Efficient directional TC-cloning of atasiRNA DNA into
cloning or binary construct and validation of TC-cloning for silencing
effectiveness. a Schematic representation of construct pUB81. The
atasiSUL, 162-bp atasiRNA DNA with 50 - and 30 -end flanking XcmI
sites, was cut by XcmI from pUB77 and released 153-bp fragment was
cloned into pUB72, resulting in pUB81. b Gel electrophoresis result
showing the optimum digestion time for preparation of XcmI-based
TC-cloning construct using pUB52 as an example. The optimal
digestion time was determined as 1 h for efficient cloning of the
artificial tasiRNA producing synthetic part. c Binary construct
pZY101mTAS for highly efficient, directional, and one-step TCcloning of 21-nt atasiRNA to the TAS locus. Two XcmI sites near
replicon were removed but the function of pVS1-Sta were retained.
d Tobacco leaf co-infiltration assays to validate the silencing caused
by 21-nt atasiRNA after TC-cloning. Y-axis indicates transcript levels
caused by atasiRNA relative to CaMV35S-overexpressed GmFAD21B cDNA level (set to 1) as determined by real-time PCR in three
biological replicates. Bars are standard deviations of three biological
replicates
digested with BglII and NcoI to clone the Tvsp terminator
fragment into pMU-2T. pMU-2T was digested with SpeI
and NcoI restriction enzymes to clone 2XCaMV35S-bar
and Tvsp sequences together into pMU-2T to make pUB14
(Fig. 2b).
For construction of pUB121-fused control vector,
2XCaMV35 sequence was released as an EcoRI–SpeI
fragment from pUB12 and cloned into corresponding
EcoRI and XbaI sites of pUB1 to produce pUB15. The
pUB80 was produced by placing the whole cassette of
123
2142
Plant Cell Rep (2016) 35:2137–2150
2X35S
miR173
mTAS1a-SUL
bar
LB1
NcoI
SpeI / XbaI (scar)
SpeI
PstI
RB2
RB1
EcoRI
2X35S
Tvsp
Tvsp
2X35S
Tvsp
mTAS1a-SUL
2X35S
miR173
2X35S
Tvsp
NcoI
LB1
BamHI / BglII (scar)
SpeI / XbaI (scar)
SpeI
PstI
RB2
RB1
EcoRI
BamHI / BglII (scar)
SpeI / XbaI (scar)
SpeI / XbaI (scar)
LB2
EcoRI
XbaI
SpeI / XbaI (scar)
B
BamHI /BglII (scar)
pUB121
Tvsp
bar
miR173
2X35S
Tvsp
mTAS1a
bar
NcoI
LB1
BamHI /BglII (scar)
SpeI
PstI
RB2
RB1
SpeI / XbaI (scar)
153-bp
atasiSUL
Tvsp
XcmI
XcmI
2X35S
SalI / XhoI (scar)
LB2
EcoRI
XbaI
SpeI / XbaI (scar)
C
BamHI /BglII (scar)
pUB122
XcmI
mTAS1a
Tvsp
2X35S
miR173
pUB124
Tvsp
2X35S
bar
NcoI
LB1
BamHI / BglII (scar)
SpeI
PstI
RB2
RB1
SpeI / XbaI (scar)
BamHI /BglII (scar)
SpeI / XbaI (scar)
SpeI / XbaI (scar)
BamHI / BglII (scar)
153-bp
atasiSUL
XcmI
D
SpeI / XbaI (scar)
pUB123
2X35S
123
BamHI /BglII (scar)
SaII / XhoI (scar)
LB2
EcoRI
XbaI
SpeI / XbaI (scar)
A
LB2
EcoRI
XbaI
Fig. 4 Diagrams of binary
constructs carrying fused (Type
1) or separate (Type 2) tasiRNA
expression unit. a pUB121 for
atasiRNA-mediated gene
silencing of CH42 by a direct
fusion of miR173 precursor
with TAS1a locus carrying 21-nt
atasiSUL. The cassette is driven
by 2XCaMV35S and terminated
by Tvsp terminator. b pUB122
for atasiRNA-mediated gene
silencing of CH42 using two
separate cassettes, one for
miR173 and the other for TAS1a
locus carrying 21-nt atasiSUL.
Each cassette is driven by
2XCaMV35S and terminated by
Tvsp. c pUB123 has the same
construction as pUB121 except
that XcmI site is introduced into
the TAS1a locus, allowing TCcloning of 21-nt atasiSUL DNA
between the two XcmI sites.
d pUB124 has the same
construction strategy as
pUB122 except that XcmI site is
introduced into the TAS1a locus,
allowing TC-cloning of 21-nt
atasiSUL DNA between the two
XcmI sites. Note: LB1 and RB1
as well as LB2 and RB2: left
border and right border of
T-DNA regions 1 and 2,
respectively; 2XCaMV35S,
miR173, mTAS1a (harboring
atasiSUL), bar and Tvsp:
duplicated CaVM35S promoter,
miR173 precursor, engineered
TAS1a carrying 21-nt atasiSUL
DNA, bar gene, and soybean
vegetative storage protein gene
terminator, respectively
BamHI /BglII (scar)
vector (Fig. 4b). The pUB15 was digested by EcoRI and
SalI whereas pUB81 was digested by XhoI and PstI. The
above two fragments were cloned into EcoRI and PstI sites
of pUB14, generating the pUB123-fused construct
(Fig. 4c). Then, pUB81 was digested with EcoRI and SpeI
while pUB25 was digested with XbaI and PstI. The
expression cassettes obtained from pUB81 and pUB25
were ligated together into EcoRI and PstI sites of pUB14,
resulting in a pUB124-separate construct (Fig. 4d).
CaMV35S ? TAS1a-SUL ? Tvsp into pUC57. pUB15
vector was then digested by EcoRI and SalI while pUB80
was digested by XhoI and PstI. The fragments from the
above two digests were simultaneously cloned into EcoRI
and PstI sites of pUB14, generating pUB121 (Fig. 4a). The
pUB80 was digested with EcoRI and SpeI. pUB25 was
digested with XbaI and PstI. The fragments from the above
two digests were ligated into EcoRI and PstI sites of
pUB14 (Fig. S2b), yielding pUB122-separate control
Tvsp
Plant Cell Rep (2016) 35:2137–2150
2143
All plasmids were transformed into E. coli and plated on
LB agar plates supplemented with the antibiotics corresponding to the vector resistance marker. Primers used
throughout the study were purchased from Integrated DNA
Technology (IDT), USA.
real-time PCR cycle included 10 s denature at 95 °C, 30 s
annealing at 56 °C, 40 cycles, and 55 °C to 95 °C for
melting curve.
Generation of short atasiRNAs
Arabidopsis ecotype (Col-0) was transformed with pUB14,
pUB121, pUB122, pUB123, or pUB124 using floral dip
method (Clough and Bent 1998). A transformant screen
was performed on agar plates containing 4.3 g/L MS
medium (Murashige and Skoog 1962), 0.5 g/L MES, pH
5.7 (adjusted with KOH), 1 % (w/v) sucrose, 0.8 % (w/v)
agar, 100 mg/L spectinomycin, 100 mg/L streptinomycin,
100 mg/L cefotaxime, and 5 mg/L glufosinate.
Each 21-nt atasiRNA candidate was designed using
WMD3—Web MicroRNA Designer (http://wmd3.weigel
world.org/cgi-bin/webapp.cgi), a free online design program employing design principles developed by Schwab
et al. (2006). Top ranked candidates were then chosen from
the candidate list of this program. Sense (with 30 -protruding
G nucleotide) and antisense (with 30 -protruding A nucleotide) strands of each 21-nt atasiRNA-generating DNA were
synthesized (GenScript or IDT, USA). The two strands
were dissolved in a Duplex Buffer (IDT, USA) and heated
at 95 °C for 3 min, followed by strand annealing by
allowing the reaction to gradually reach to room temperature (24 °C). Annealed double-stranded atasiRNA DNA
with 30 -protruding G/A ends were then ligated into corresponding 30 TC-protruding ends, generated by XcmI digest
of mTAS1a locus (Fig. 1). The XcmI digestion took 1 h in
30–50 ml volume in eppendorf tube at 37 °C. At this stage
it is important to use less enzymatic units in a larger
reaction volume to minimize potential star activity of XcmI
to improve digestion fidelity.
Tobacco leaf co-infiltration assays
Agrobacterium tumefaciens strain EHA101 containing
T-DNA binary vectors were grown in YEP liquid medium
with the appropriate antibiotics (kanamycin 50 mg/L;
streptomycin 100 mg/L; spectinomycin 100 mg/L) overnight at 28 °C with shaking (200 rpm) until saturation.
After resuspended in infiltration buffer (10 mM MgCl2,
10 mM MES, pH 5.6, and 150 lM acetosyringone), the
bacteria (A600 = 0.6) were infiltrated into intact 30-day-old
Nicotiana benthamiana leaves as described (Park et al.
2014). To improve precision on comparing silencing efficiency and minimize variation between the leaves, we used
split leaf test in which one half of the leaf was infiltrated
with EHA101 strain harboring binary construct for overexpressing cDNA and the other half of the leaf was coinfiltrated with a mix of the above strain and the EHA101
strain carrying binary construct pZY101mTAS for generating atasiRNA.
One to two days after co-infiltration, real-time PCR was
performed to determine the transcript levels of the cDNA.
Forward and reverse primers for real-time PCR of FAD21B were F (50 TGCATTCTTACTGGCGTGTG 30 ) and R
(50 TGAACGGTCAAACCCACAAC 30 ), respectively. The
Arabidopsis floral dip transformation
Genomic DNA analysis
Genomic DNA from leaves of one-month-old plants was
extracted. Transgene screening by PCR was performed
using Extract-N-Amp plant PCR Kits (Sigma-Aldrich, St.
Louis, MO) according to manufacturer’s protocol using:
sense primer 35S-SUL-1F: 50 -GATTGATGTGATATCTC
CACTGAGG-30 , which corresponded to the downstream
sequence of CaMV35S promoter and antisense primer
SUL-R:
50 -GGATTTCCGTGACACTTAATAATTT-30 ,
which corresponded to the downstream sequence of
mTAS1a-SUL for pUB123; sense primer miR173F: 50 -CAC
TGGAAAGTATCTCATTAGGGTA-30 , which corresponded to the downstream sequence of miR173 and
antisense primer SUL-R: 50 -GGGATTTCCGTGACACTT
AATAATTT-30 , which corresponded to the upstream
sequence of for TAS1a in pUB124.
qRT-PCR analysis of expressed transgenes
Total RNA was extracted from 10-days- or 4-weeks-old
Arabidopsis plants using Trizol Reagent (Life Technologies, NY) according to the manufacturer’s protocol. Each
experiment was repeated three times. Total volume used
for qRT-PCR was 20 ll. Prior to cDNA synthesis total
RNA was treated with 1 U/ll amplification grade DNase I
(Life Technologies, NY) to remove DNA contamination
according to the manufacturer’s protocol. First-strand
cDNA was synthesized using 1 lg of total RNA using
iScript Reverse Transcription Supermix for qRT-PCR from
BioRad. Quantitative RT-PCR was performed with SsoFast
EvaGreen Supermix (BioRad, Hercules, CA) kit according
to manufacturer’s protocol. Primers that anneal outside of
the target region for silencing were designed using IDT’s
primer design program. CH42 mRNA level was analyzed
using CH42-F: 50 -TCTGCAATCTGGGCTTCTCCTTC
A-30 and CH42-R: 50 -ACGAGACCTGTTCTTCTTTGGC
CT-30 primers. The product size was 141-bp. b-Tubulin-2
123
2144
gene was used as internal control by employing forward bTUBULIN-2, 50 -GAGCC TTACAACGCTACTCTGTCTG
TC-30 and reverse b-TUBULIN-2, 50 -ACACCAGACAT
AG TAGCAGAAATCAAG-30 primers (the product size:
166-bp). Amplification was carried out for 35 cycles consisting of 3 min at 94 °C, 20 s at 52 °C, and 20 s at 72 °C;
an additional extension step of 10 min at 72 °C was added
at the end of 35 cycles. CH42 mRNA levels were normalized against b-TUBULIN2 mRNA levels.
Primer extension analysis to detect siRNAs
Primer extension was done using the same RNA preparations used for quantitative RT-PCR. The oligonucleotides
used in primer extension assays were as follows: 50 AGGGATTTCCGTGACAC-30 for atasiSUL detection; 50 GTGATTTCTCTCTGCAAG-30 for guide strand of
miR173; 50 -ACCCTGGATGTGAAGAATCTC-30 for
40-bp fragment amplification from 50 -end of b-TUBULIN2;
50 -AGGGATTTCCGTGACACTTAA-30 for 21-bp size
marker; and 50 -GTGATTTCTCTCTGCAAGCGAA-30 for
22-bp size marker. Oligonucleotide DNA sequences were
labeled at the 5’ ends with [c-32P] ATP using 10 U T4
polynucleotide kinase (NEB, Ipswich, MA) for 1 h and
purified on a G25-column (GE-healthcare, Missouri City,
TX). Primer extension reactions were performed using
20 U SuperScript III reverse transcriptase (Life Technologies, NY) per reaction. Labeled oligonucleotides and
RNA were denatured at 70 °C for 10 min, chilled on ice for
5 min, and then extended at 50 °C for *30 min. Products
were analyzed by electrophoresis on 7 M urea/10 %
polyacrylamide gel after denaturation at 80 °C for 5 min.
The sequencing gel was dried and exposed to a phosphorimager cassette for further scanning.
Results
Plant Cell Rep (2016) 35:2137–2150
Second, this locus has not been found in other plant species
except for Arabidopsis and therefore overexpression of
TAS1a could have minimal disruption of developmental
pathways in recipient plants. Third, co-expression of
miR173 precursor and modified TAS1a would generate
atasiRNAs leading to target gene silencing in plant species
other than Arabidopsis because plants may share common
components for the tasiRNA pathway.
We engineered the TAS1a locus with TC-cloning sites
by replacing sequences between D1(?) and D8(?) with
two XcmI restriction sites in frame with 21-nt register
positions (Figs. 1, 2; Fig. S1a). The presence of versatile
nucleotides in XcmI restriction site is the key for the generation of protruding T and C nucleotides from the 30 end
of each opposing strand for directional TC-cloning. Figure 1 illustrates the design principle of this cloning
approach. We constructed an intermediate vector, pUB52,
and its derivative, pUB72, to overexpress a modified
TAS1a carrying two XcmI sites to subclone atasiRNA
(Fig. 2a–c). We also made a co-expression construct for
overexpressing miR173 as trigger for tobacco leaf co-infiltration assays (Fig. 2d). To test the effectiveness of these
engineered XcmI sites for directional cloning, we first made
a synthetic DNA fragment containing 21-nt atasiSUL DNA
sequence (Fig. S1b) for silencing of the CHLORINA42
(CH42) gene (Felippes and Weigel 2009) and cloned it into
the XcmI sites of pUB72, resulting in pUB81 (Fig. 3a, b).
The cloning efficiency from all three independent experiments was 100 %. Subsequent sequencing results confirmed the directional orientation in all the clones analyzed.
The cloning efficiency was similar to pGEM-T easy system
(Table 1).
TC-cloning of short atasiRNA-producing DNA
into engineered TAS1a locus in binary construct
It is highly desirable to be able to clone short atasiRNAproducing DNA efficiently into the TC-cloning site of an
Design of TC-cloning approach
Conventional construction of a modified TAS1c locus carrying a sequence coding for atasiRNA is achieved through
either overlapping PCR (de la Luz Gutiérrez-Nava et al.
2008) or biosynthesis of entire modified TAS locus (unpublished). Such practices could be technically challenging
and cost-ineffective. To overcome these limitations, we
developed a ‘‘TC-cloning’’ approach in TAS1a as a test
model to ascertain the effectiveness of this cloning system
and its possible impact on gene silencing. TAS1a was
chosen as our preferred test system, because of the three
reasons. First, this locus displayed efficient silencing of its
target gene as previously illustrated (Allen et al. 2005;
Montgomery et al. 2008; Felippes and Weigel 2009).
123
Table 1 Comparisons of cloning efficiencies between pGEM-T Easy
and TC-cloning
Replicates
pGEM-T Easy
TC-cloning (pUB52*)
1st 10 clones
7 positive clones
10 positive clones
2nd 10 clones
3rd 10 clones
10 positive clones
10 positive clones
10 positive clones
10 positive clones
Efficiency (%)
90
100
* pUB52 is a pUC57-derived cloning vector harboring modified
TAS1a with the introduction of two consecutive XcmI sites at D1(?)
and D8(?) positions by removing partial sequences of D(?)1 and
D(?)8 as well as complete sequences from D(?)2 to D(?)7. Student’s t test revealed no significant differences between T- and TCcloning (P [ 0.05)
Plant Cell Rep (2016) 35:2137–2150
2145
engineered TAS1a locus within a binary plant transformation vector. To accomplish this, we first removed the two
XcmI sites, one of which was within the pVS1-Sta site of
the binary vector pZY101 while retaining the pVS1-Sta
open-reading frame and function. Then, two expression
cassettes for overexpressing miR173 and engineered
TAS1a locus carrying the two XcmI sites were cloned into
the MCS of pZY101, resulting in binary construct
pZY101mTAS1 (Fig. 3c). This construct was then tested
for one-step, directional cloning of 21-nt atasiRNA-producing DNA into the TAS1a locus for subsequent in vitro
validation of 21-nt atasiRNAs. The optimal cloning conditions are outlined in ‘‘Materials and methods’’ section. We determined the cloning efficiency and fidelity in
three cloning efforts. The results showed that TC-cloning
of 21-nt tasiRNA DNA into the XcmI sites of the binary
construct was highly efficient with overall above 86 %
cloning efficiency and 96.7 % fidelity (Table 2).
Next, we verified the effectiveness of TC-cloning in
validating atasiRNA candidates. To do this, we co-infiltrated tobacco leaves with two Agrobacterium tumefaciens
inoculums: one strain harboring a binary construct for
overexpressing cDNA of a target gene and the other carrying binary construct pZY101mTAS for generating atasiRNA for silencing the cDNA transcript. Thus, the
silencing efficiency of the atasiRNA generated from
pZY101mTAS could be evaluated by the relative expression of atasiRNA-silenced transcript level divided by
cDNA transcript level. Here, we chose a member of Glycine max omega 6 fatty acid desaturase 2 (FAD2-1B)
transcript as a target. This gene is responsible for the
biosynthesis of linoleic acid in soybean and silencing of
this gene will lead to a reduction of linoleic (18:2) and alinolenic acid (18:3) contents while accumulating oleic
acids (18:1), improving soybean seed oil stability and
quality (Pham et al. 2010). The construct for overexpressing FAD2-1B cDNA alone was used as a negative
control. Thus, the atasiRNA-induced percent reduction of
cDNA transcript relative to cDNA alone was determined
by real-time PCR. Three leaves from three different plants
were separately co-infiltrated with two Agrobacterium
strains, with one harboring atasiRNA-containing binary
construct or empty control construct and the other
Table 2 TC-cloning of 21-atasiRNA DNA into XcmI site of mTAS1a
in pZY101mTAS
Replicates
Number of clones
sequenced
Number of correct
clones
Fidelity (%)
1
10
10
100
2
10
10
100
3
10
9
90
Total
30
29
96.7
harboring FAD2-1B cDNA overexpressing binary construct. One or two days after co-infiltration, total RNAs
were extracted from the co-infiltrated leaves and RNA
samples were analyzed by real-time PCR. The results
showed that the atasiRNA-mediated silencing of Glycine
max FAD2-1B transcript was efficient, suggesting that TCcloning does not interfere the silencing of atasiRNA
(Fig. 3d).
miR173–mTAS1a fusion cassette and a set of binary
vectors
Next, we simplified the atasiRNA expression system by
fusing the miR173 precursor sequence directly upstream
with the engineered TAS1a (mTAS1a) locus. The mTAS1a
locus contains atasiSUL cloned into between D1(?) and
D8(?) registers directly or flanked by XcmI sites (Fig. 4).
The resulting fusion cassette was then driven by a single
CaMV35S promoter (Fig. 4a, c). As a comparison, a control construct was made in which the miR173 precursor and
mTAS1a locus were expressed from two separate cassettes
driven by two promoter–terminator cassettes (Fig. 4b, d).
The binary vector pMU2T (Fig. S2a) was used to make the
binary vector pUB14 (Fig. S2b) by inserting bar cassette
into the first T-DNA region of pMU2T. Then above cassettes was cloned into pUB14. Subsequently, the resulting
vectors were used to transform Arabidopsis.
These new vectors allow the regulation of gene silencing
levels and contain two multiple cloning sites (MCS) located in two separate T-DNA regions. One T-DNA region,
delimited by the first set of left and right borders, bears the
bar gene while the second T-DNA, delimited by the second
set of left and right borders, contains the mTAS1a featuring
the silencing unit for the target gene and miR173. Two
types of binary constructs were made for silencing. In Type
1 constructs, i.e., pUB121 and pUB123 (Fig. 4a, c),
miR173 and mTAS1a sequences were fused and expressed
as one cassette from the same CaMV35S promoter. In Type
2 constructs, i.e., pUB122 and pUB124 (Fig. 4b, d),
miR173 and mTAS1a locus, each was driven by its own
promoter-terminator cassette. In both types, miR173 guides
cleavage of the transcript and sets registers for production
of 21-nt atasiRNAs. The constructs pUB121 and pUB122
contain the TAS1a locus, in which the sequence between
D1(?) and D8(?) tasiRNA was replaced by atasiSULproducing fragment with no XcmI sites whereas pUB123
and pUB124 carry XcmI sites for TC-cloning. We chose
atasiSUL for silencing screen because atasiSUL could
silence CH42, causing bleached leaf phenotype (Felippes
and Weigel 2009). Subsequently, constructs reflecting
these two strategies were compared for their silencing
efficiencies. The pUB123 and pUB124 were used to test if
XcmI-based TC-cloning affects silencing efficiency.
123
2146
Plant Cell Rep (2016) 35:2137–2150
Silencing of CH42
Arabidopsis (Col-0) was transformed by floral dip using A.
tumefaciens strain AGL1 that harbors various recombinant
binary vectors (Fig. 4a–d). T1 CH42-silenced transgenic
lines were screened on selection medium containing herbicide glufosinate-ammonium. After the herbicide resistance screening, genomic DNA from the leaves of
1-month-old Arabidopsis plants was PCR-analyzed using
primer pair specific to atasiSUL. Most of the plants yielded
600 bp PCR product for pUB123 and 700 bp PCR product
for pUB124 as expected (Fig. S3). The results showed that
the silencing cassettes atasiSUL had been integrated into
the Arabidopsis genome.
The fusion cassette, which allows the expression of
miR173 and mTAS1a under the control of the same promoter, exhibited a uniform silencing phenotype across T1
lines [pUB121 (control) and pUB123 (XcmI-TC cloning);
Table 3]. By contrast, binary vectors constructed using
separate expression cassettes showed variation in the level
of silencing [pUB122 (control) and pUB124 (XcmI-TC
cloning; Table 3) (Fig. 5)]. Some of pUB122- or pUB124transgenic lines carrying separate miR173 and mTAS1a
cassettes displaying a strong silencing phenotype did not
survive due to lethality. Intriguingly, the percent transgenic
plants displaying strong silencing phenotypes in separate
expression cassettes (pUB122 and pUB124) reduced to
zero in fusion constructs (pUB121 and pUB123) whereas
the percent transgenic plants showing weak-moderate
silencing phenotype increased in the fusion constructs,
contributing to the more uniform gene silencing (in weakmoderate silencing category) (Table 3; Fig. 5). Notably,
the degree of silencing of CH42 in pUB121- and pUB123transgenic lines containing the fusion cassettes were both
high and uniform at 10-day seedling stage. As the plants
Table 3 Silencing of CH42 in
T1 transgenic Arabidopsis lines
further developed, the degree of silencing declined, but
remained uniform across the plant and the different lines
compared to pUB122- and pUB124-transgenic lines as
exemplified in Fig. 5. As a result, all lines carrying the
fusion cassette and displaying silencing phenotypes survived, resulting in no lethality. Student’s t test was
employed to compare TC-cloning as oppose to non-TCcloning on silencing efficiency. There was not a statistically significant difference (P [ 0.05) in silencing phenotypes between TC-cloning [pUB123 (fused) or pUB124
(separate)] and non-TC-cloning cassettes [pUB121 (fused)
or pUB122 (separate)] for atasiSUL (Table 3), suggesting
that TC-cloning does not reduce silencing efficiency.
qRT-PCR was performed to determine the transcript
level of CH42 in transgenic Arabidopsis plants relative to
the empty vector (pUB14) control plants at 10-day- or
1-month-old stage. The transcript level of CH42 was substantially reduced in silenced plants compared to the empty
control (Fig. 6). Although different bleaching phenotypes
were observed for 1-month-old plants (Fig. 6a), the similar
amount of reduction was detected in the mRNA levels of
10-days-old seedlings (Fig. 6b) with the binary vectors
containing fusion or separate expression cassettes for atasiRNA silencing.
Verification of CH42-silencing by primer extension
analysis
Severe pUB124-transgenic Arabidopsis phenotypes suggested sufficiently high levels of atasiSUL RNAs. To test
this, 21-nt atasiSUL RNAs were detected by primer
extension analysis. This method allowed us to use smaller
amounts of total RNA than the conventional methods for
detecting small RNAs. The effectiveness of the method
was demonstrated in Fig. 6c–e. Since this atasiRNA was
Construct
N
Silencing phenotypes
None (%)
Weak-moderate (%)
Strong
Type 1
pUB121:35S:TAS1aSUL(942)D6-miR173
21
7 (33)
14 (67)
0
pUB123:35S:TAS1aSUL(162)D6-miR173
151
65 (43)
86 (57)
0
pUB122:35S:TAS1aSUL(942)D6::35S:miR173
70
26 (37)
29 (41)
15 (22)
pUB124:35S:TAS1aSUL(162)D6::35S:miR173
49
15 (31)
22 (45)
12 (24)
Type 2
The percent plants exhibiting photobleaching as a result of CH42 silencing are shown. pUB123 and
pUB124 carry XcmI-based cloning sites whereas Type 1 and Type 2 are fused and separate cassettes,
respectively. N: the number of T1 transgenic Arabidopsis lines analyzed. Percent (%) silencing phenotypes
in each pairwise comparison in each column indicated insignificant difference (P [ 0.05) as detected by
Student’s t test
123
Plant Cell Rep (2016) 35:2137–2150
2147
TYPE 1
WT
pUB123:
(35S:mTAS1-SUL-miR173)
TYPE 2
pUB124:
(35S:mTAS1-SUL::35SmiR173)
Early
Middle
Late
Weak-moderate
Strong
Fig. 5 Representative phenotypes of Arabidopsis plants transformed with two types of silencing vectors. Early, middle, and late means three
developmental stages of Arabidopsis plants
processed from the synthetic mTAS1-SUL locus to target
the CH42 transcript, the level of atasiSUL detected by
primer extension (Fig. 6c) was also correlated with the
levels of CH42 mRNA as detected by qRT-PCR (Fig. 6a).
Clearly, the increased atasiSUL transcript level resulted in
the reduced CH42 mRNA level. As a comparison,
miR173 expression from the transgene was also confirmed by primer extension (Fig. 6d). The 22-nt miR173
levels were elevated in transgenic lines as opposed to the
pUB14 control. The reduced level of miR173 (Fig. 6d)
was observed in different events when atasiSUL was
expressed at high quantity (Fig. 6c). These results
demonstrated that reduced 22-bp miR173 level was highly
correlated with the increased atasiSUL level. These data
also suggested that as the amount of atasiSUL increases a
proportional reduction from the miR173 pool could be
clearly observed.
Discussion
We have developed a set of constructs for effective directional cloning of short DNA encoding small RNAs and gene
silencing by employing atasiRNA. The TC-cloning allows
highly efficient cloning of various sizes of atasiRNAs into
the mTAS1a locus with high fidelity and reproducibility.
Figure S4 outlines a work flow chart to facilitate the utilization of TC-cloning for employing atasiRNA technology.
Although there are other cloning methods such as Gibson
Assembly (NEB, USA) that can provide high efficiency
directional cloning, they require expensive T5 exonuclease,
Phusion polymerase, and Taq ligase cocktail, and DNA
fragments less than 250 bp in length are not preferred.
Therefore, our TC-cloning system will significantly facilitate in vitro validation of candidate atasiRNA, especially
when coupled with annealing short atasiRNA sequences,
123
2148
B
A
1.2
Fold-change in CH42 mRNA levels against -TUBULIN
1.2
1
0.8
0.6
0.4
0.2
0.8
0.6
0.4
0.2
D
22 bp
pUB124-3
pUB124-2
pUB124-1
Arabidopsis
transgenics
(10 days-old seedling)
pUB123-3
pUB123-2
pUB123-1
WT
21 bp
124
vector
124-3
124-2
124-1
123-3
123-2
123-1
vector
size marker
Arabidopsis transgenics
(1 month-old plants)
123
0
0
C
1
probe alone
Fold Change in CH42 mRNA levels aginst -TUBULIN
Fig. 6 Analysis of transgenic
Arabidopsis plants expressing
silencing cassettes. a Real-time
PCR analysis of CH42 mRNA
level were performed in
Arabidopsis transgenics. Total
RNA samples were extracted
from 10-day- or b one-monthold seedlings after seeds were
sown on germination media.
Seedlings from each sample
were pooled before RNA
extraction. The mRNA levels
for the transgenics were
normalized to b-tubulin mRNA
using the DDCT method. 123
and 124 mean pUB123 and
pUB124, respectively. The
numbers following 123 or 124
are the different T1 lines from
which multiple T2 samples were
pooled. Bars are standard
deviations of three biological
replicates. c Primer extension
analysis were carried out to
confirm the production of
miRNA173 and atasiSUL. Total
RNA was isolated from wild
type Arabidopsis (ecotype
Columbia) or Arabidopsis
transgenic plants UB123-1,
UB123-2, UB123-3, UB124-1,
UB124-2, UB124-3. Four lg of
RNA was used for primer
extension to detect miRNA173
or d atasiSUL1. For each
miRNA or atasiSUL1 free probe
with no RNA is shown as a
negative control. e Primer
extension of b-tubulin is shown
as loading control
Plant Cell Rep (2016) 35:2137–2150
atasiSUL
probe
miRNA173
probe
E
-Tubulin
avoiding overlapping PCR or synthesis of the entire TAS
locus. The design principle and methodology described here
could be also applied to amiRNA cloning, avoiding
123
overlapping PCR or synthesis of whole amiRNA stem-loop.
In particular, recently, Li et al. (2013) reported comprehensive protein-based screens to validate miRNAs. The screen
Plant Cell Rep (2016) 35:2137–2150
requires co-transformation of the construct carrying the
candidate miRNA into the protoplasts. The XcmI-based TCcloning system described here and Li’s screening approach
could be taken advantage of each other, making it possible to
validate a large number of candidate miRNAs or atasiRNAs
at minimal cost and effort. For transient assays to validate
very short candidate atasiRNAs, use of cloning vector
pUB72 will be simple and sufficient. In this case, vector
pUB72 carrying atasiRNA expression cassette can be cointroduced, together with pUB25 containing miR173 overexpression cassette as well as a construct containing the
expression cassette of target gene cDNA, into plant cells
through a transient transformation system such as PEGmediated protoplast transformation. The atasiRNA-containing cassette carried by pUB72 can be also excised and
cloned into a binary plant transformation vector carrying
miR173 overexpression cassette for either Agrobacteriummediated leaf-infiltration assay to validate atasiRNAs or for
stable transformation.
Introduction of XcmI-based TC-cloning design directly
into binary constructs is highly desirable to achieve singlestep cloning of atasiRNA DNA into the atasiRNA expression
cassette to ease the validation of a large number of 21-nt
atasiRNA candidates. However, construction of such a system has proven to be challenging. This is because all existing
binary constructs publicly available contain XcmI sites, and
one is within the pVS1-Sta site of the binary backbone
region. As a result, extra cloning was required and subsequently accomplished to remove the two XcmI sites including the one from the pVS1-Sta of the binary construct
pZY101, making it possible to introduce and utilize XcmI in
the TAS locus of binary constructs. A similar engineering
approach could be applied to remove XcmI sites from other
binary constructs to introduce and utilize the XcmI-based
TC-cloning in the TAS locus. Very recently, an alternative
one-step, directional cloning was achieved employing multiple nucleotide protruding ends of restriction sites BsaI
(Carbonell et al. 2014). We noticed that our TC-cloning is
more efficient than that described in that report. It is possible
that the single nucleotide protruding ends employed in our
TC-cloning system enables more efficient cloning.
The atasiRNA-binary constructs for plant transformation
are composed of two types. One type utilizes a fusion of
miR173 and TAS1a locus whereas another type of constructs carries separate mTAS1a and miR173 expression
cassettes. We observed that at a later developmental stage
there was no strong silencing phenotype in the fusion
construct (Type 1) (Table 3) whereas certain percent strong
silencing phenotype occurred for the construct carrying the
separate cassettes (Type 2) (Table 3). The reason for this
difference is not clear. It is possible that some transcripts
were not separated from the fusion cassette, reducing the
titer of siRNA species. On the other hand, although the
2149
silencing efficiency of our fusion construct was compromised to some degree at a late developmental stage, it is
often desirable to achieve a moderate level of silencing,
avoiding lethality by an extreme high degree of silencing.
Interestingly, the fusion of miR173 with mTAS1a locus
caused uniform gene silencing of CH42. The mechanism
underlying this silencing result remains unclear. It is also
unknown whether similar uniform gene silencing could be
achieved if other miRNA precursor trigger sequences are
fused with their corresponding TAS loci.
The efficiency and specificity of atasiRNA as a tool for
silencing plant genes make this the method of choice over
other means such as hairpin RNA. The effective and
directional cloning of the synthetic short atasiRNA DNA
sequences into the TAS1a make it suitable for the
automation required for large-scale projects. The pUB
binary vector systems developed here could be readily used
not only for silencing target genes but also for obtaining
marker-free transgenic plants, which can be used for retransformation to stack additional genes of interest. Furthermore, the vector construction strategy described here
gives the flexibility to swap the cassette components based
on specific applications. Finally, the two constructs made
for the expression of miR173 and mTAS1a allow regulation of gene silencing by two strategies (fused and separate
control of TAS1a and miRNA173) employed in silencing
vector construction depending on the degree of silencing
requirement. We were successful in generating atasiSULproducing transgenic lines with reduced transcript level of
the endogenous CH42. This atypical RNAi, which is capable of controlling gene expression without lethal phenotype provided controlled expression of atasiRNA. This
characteristic of our method makes it another case to
contrast CRISPR/Cas which provides gene knockdown,
causing lethality under certain conditions. We suggest that
the fused construct used for atasiRNA-based gene silencing
technology might be more appropriate than the separate
construct to study functions of plant genes that plays role in
early stages of plant development.
Author contribution statement UB and ZZ designed
research; UB, HL, and XC performed research; UB, HL,
and ZZ analyzed the data; UB and ZZ wrote the manuscript; UB, HTN, and ZZ revised the manuscript. All
authors read and approved the final manuscript.
Acknowledgments We thank Dr. David Setzer for allowing us to use
his laboratory and the equipment for primer extension analysis.
Thanks are also expended to: Dr. Joann R. De Tar for her technical
assistance in Glycine max FAD2-1B atasiRNA design, and Mr. Neng
Wang for his Arabidopsis planting and plant care as well as Dr.
William Folk and Mrs. Theresa Musket for proof-reading. This work
was supported by the Mid-America Research and Development
Foundation and the Missouri Soybean Merchandising Council Grant
(Project No. 11-338).
123
2150
Compliance with ethical standards
Conflict of interest The authors declare that they have no conflict of
interest.
References
Allen E, Howell MD (2010) miRNAs in the biogenesis of transacting siRNAs in higher plants. Semin Cell Dev Biol
21:798–804
Allen E, Xie Z, Gustafson AM, Carrington JC (2005) microRNAdirected phasing during trans-acting siRNA biogenesis in plants.
Cell 121:207–221
Axtell MJ (2013) Classification and comparison of small RNAs from
plants. Annu Rev Plant Biol 64:137–159
Baulcombe DC (2007) Small RNA molecules that silence gene
expression are amplified by different mechanisms in nematodes
and plants. Science 315:199–200
Baykal U, Zhang Z (2010) Chapter XI: Small RNA-mediated gene
silencing for plant biotechnology. In: Catalano AJ (ed) Gene
silencing: theory, techniques and applications. Nova Science,
New York, pp 255–269
Brodersen P, Voinnet O (2006) The diversity of RNA silencing
pathways in plants. Trends Genet 22:268–280
Carbonell A, Takeda A, Fahlgren N, Johnson SC, Cupenrus JT,
Carrington JC (2014) New generation of artificial microRNA
and synthetic trans-acting small interfering RNA vectors for
efficient gene silencing in Arabidopsis. Plant Physiol
165:15–29
Chapman EJ, Carrington JC (2007) Specialization and evolution of
endogenous small RNA pathways. Nat Rev Genet 8:884–896
Clough SJ, Bent AF (1998) Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743
de la Luz Gutiérrez-Nava M, Aukerman MJ, Sakai H, Tingey SV,
Williams RW (2008) Artificial trans-acting siRNAs confer
consistent and effective gene silencing. Plant Physiol
147:543–551
Felippes FF, Weigel D (2009) Triggering the formation of tasiRNAs
in Arabidopsis thaliana: the role of microRNA miR173. EMBO
Rep 10:264–270
Hilson P, Allemeersch J, Altmann T, Aubourg S, Avon A, Beynon J
et al (2004) Versatile gene-specific sequence tags for Arabidopsis functional genomics: transcript profiling and reverse genetics
applications. Genome Res 14:2176–2189
Kovalic D, Kwak JH, Weisblum B (1991) General method for direct
cloning of DNA fragments generated by the polymerase chain
reaction. Nucleic Acids Res 19:4560
Li JF, Chung HS, Niu Y, Bush J, McCormack M, Sheen J (2013)
Comprehensive protein-based artificial microRNA screens for
effective gene silencing in plants. Plant Cell 25:1507–1522
123
Plant Cell Rep (2016) 35:2137–2150
Mead DA, Pey NK, Herrnstadt C, Marcil RA, Smith LM (1991) A
universal method for the direct cloning of PCR amplified nucleic
acid. Biotechnology 9:657–663
Montgomery TA, Yoo SJ, Fahlgren N, Gilbert SD, Howell MD,
Sullivan CM et al (2008) AGO1–miR173 complex initiates
phased siRNA formation in plants. Proc Natl Acad Sci USA
105:20055–20062
Murashige T, Skoog F (1962) A revised medium for rapid growth and
bioassays with tobacco tissue cultures. Physiol Plant 15:473–497
Park SY, Yin X, Duan K, Gelvin SB, Zhang Z (2014) Heat shock
protein 90.1 plays a role in Agrobacterium-mediated plant
transformation. Mol Plant 7:1793–1796
Pham AT, Lee JD, Shannon JG, Bilyeu KD (2010) Mutant alleles of
FAD2-1A and FAD2-1B combine to produce soybeans with the
high oleic acid seed oil trait. BMC Plant Biol 10:195
Purkayastha A, Dasgupta I (2009) Virus-induced gene silencing: a
versatile tool for discovery of gene functions in plants. Plant
Physiol Biochem 47:967–976
Ramegowda V, Mysore KS, SenthilKumar M (2014) Virus-induced
gene silencing is a versatile tool for unraveling the functional
relevance of multiple abiotic-stress-responsive genes in crop
plants. Front Plant Sci. doi:10.3389/fpls.2014.00323
Sashital D, Doudna JA (2010) Structural insights into RNA interference. Curr Opin Struct Biol 20:90–97
Schwab R, Palatnik JF, Riester M, Schommer C, Schmid M, Weigel
D (2005) Specific effects of microRNAs on the plant transcriptome. Dev Cell 8:517–527
Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D (2006)
Highly specific gene silencing by artificial microRNAs in
Arabidopsis. Plant Cell 18:1121–1133
Senthil-Kumar M, Mysore KS (2011) Caveat of RNAi in plants: the
off-target effect. Methods Mol Biol 744:13–25
Travella S, Klimm TE, Keller B (2006) RNA interference-based gene
silencing as an efficient tool for functional genomics in
hexaploid bread wheat. Plant Physiol 142:6–20
Voinnet O (2008) Use, tolerance and avoidance of amplified RNA
silencing by plants. Trends Plant Sci 3:317–328
Watson JM, Fusaro AF, Wang M, Waterhouse PM (2005) RNA
silencing platforms in plants. FEBS Lett 579:5982–5987
Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q
et al (2001) Construct design for efficient, effective and highthroughput gene silencing in plants. Plant J 27:581–590
Zamore P, Tuschl T, Sharp P, Bartel D (2000) RNAi: double-stranded
RNA directs the ATP-dependent cleavage of mRNA at 21 to 23
nucleotide intervals. Cell 101:25–33
Zeng P, Vadnais D, Zhang Z, Polacco J (2004) Refined glufosinate
selection in Agrobacterium-mediated transformation of soybean
[Glycine max (L.) Merr.]. Plant Cell Rep 22:478–482
Zhang Z (2014) Artificial trans-acting small interfering RNA: a tool
for plant biology study and crop improvements. Planta
239:1139–1146